Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Pregnancy outcomes of women with elevated second-trimester maternal serum alpha-fetoprotein.

OBJECTIVE: The aim of this study was to investigate the overall distribution of pregnancy outcomes in women with elevated second-trimester maternal serum alpha-fetoprotein (MS-AFP), and to determine the risk of adverse pregnancy outcomes (APOs) by MS-AFP level. MATERIALS AND METHODS: We retrospectively analyzed the clinical data of 429 women with elevated MS-AFP (≥2.5 multiple of the median (MOM)) and 1555 women with normal MS-AFP (0.5-2.49MOM) from a total of 46,741 prenatally screened singleton pregnant women. The overall distribution of APOs of the two groups, the risk of APOs by MS-AFP level, and the predictive value of elevated MS-AFP to APOs were analyzed. RESULTS: The incidence rate of APOs in elevated MS-AFP group was significantly higher than that in normal MS-AFP group (42.89 vs. 8.23%). In elevated MS-AFP group, the top three APOs, in term of incidence rate, were structural fetal abnormalities (7.93%), spontaneous abortion (7.46%) and preterm birth (7.23%); regarding to the risk, the top three APOs were stillbirth, spontaneous abortion and early-onset preeclampsia (odds ratio 35.98, 20.81 and 8.58 respectively). For structural fetal abnormalities, MS-AFP had predictive values for fetal open neural tube defects (ONTDs), gastroschisis and multiple malformations. CONCLUSION: Elevated MS-AFP is associated with increased risks of APOs. ONTDs complicate merely a small proportion of pregnancies with elevated MS-AFP, and the rest of them have high risks of obstetric complications. MS-AFP can help to identify these women at high risk of APOs in earlier second-trimester.

Marsdenia Tenacissima Extract Inhibits Proliferation and Promotes Apoptosis in Human Ovarian Cancer Cells.

BACKGROUND Marsdenia tenacissima extract (MTE) is a traditional Chinese medicine that can be effectively used against various cancers. However, to the best of our knowledge, its role in ovarian cancer is not known. This study investigated the effects of MTE on human ovarian cancer SKOV3 cells. MATERIAL AND METHODS The viability and cell cycle of SKOV3 cells were assessed using the cell counting kit-8 (CCK-8) and propidium Iodide (PI) staining kit, respectively. Cell apoptosis and mitochondrial membrane potential (MMP) were detected by flow cytometry. The expression levels of proliferation-related and apoptosis-related factors were tested by quantitative real-time PCR (qRT-PCR) and Western blot assays, respectively. RESULTS We found that MTE markedly reduced the viability of SKOV3 cells in dose-dependent and time-dependent manners. MTE induced cell cycle arrest by downregulating the levels of cyclin D1and cyclin B1. MTE (10, 20, and 40 mg/mL) markedly increased apoptosis rates (2.77±0.6%, 4.95±0.97%, and 12.16±0.69%, respectively), and enhanced the loss of MMP. MTE obviously downregulated the expression of B cell lymphoma-2 (Bcl-2) and upregulated the expression levels of fibroblast-associated (Fas), Fas ligand (FasL), cleaved cysteinyl aspartate-specific proteinas-3 (caspase-3), and Bcl-2-associated X protein (Bax) compared to the control group. In addition, the expressions of phosphorylated mammalian target of rapamycin (p-mTOR), phosphorylated protein kinase B (p-AKT), and phosphorylated-phosphatidylinositol 3 kinase (p-PI3K) were decreased by MTE. CONCLUSIONS MTE inhibited proliferation and induced apoptosis of SKOV3 cells. The depression of the PI3K/AKT/mTOR pathway may augment the protective effect of MTE. Thus, MTE might be expected to be a new drug for curing ovarian cancer.

Forkhead box C2 promotes the invasion ability of human trophoblast cells through Hedgehog (Hh) signaling pathway.

Embryonic development depends on the normal invasion of trophoblast cells. Forkhead box C2 (FOXC2) is a member of Forkhead box family, which is involved in the tumor cells invasion. The aim of this study was to explore the roles of FOXC2 on the invasion of human trophoblast cells, and further study its molecular mechanism. The mRNA and protein levels of FOXC2 in human normal trophoblast and choriocarcinoma cell lines were analyzed by quantitative real-time PCR (qRT-PCR) and Western blot assays, respectively. Methylthiazolyldiphenyl-tetrazo lium bromide (MTT) and transwell assays were separately performed to detect the adhesion and invasion of normal trophoblast cells treated with exogenous FOXC2 and FOXC2 siRNA. QRT-PCR and Western blot assays were used to test levels of the epithelial-mesenchymal transition (EMT)-related and Hedgehog (Hh) signaling pathway-related factors, respectively. Herein, our results found that the expression levels of FOXC2 in normal trophoblast cells were lower than choriocarcinoma cells. FOXC2 over-expression remarkably strengthened the adhesion and invasion abilities of normal trophoblast cells. Moreover, over-expression of FOXC2 significantly promoted the expression of human leukocyte antigen-G (HLA-G), matrix metalloproteinase-2 (MMP-2), Vimentin, sonic hedgehog (Shh), Glioma-associated oncogene homolog 1 (Gli1), and Snail, and inhibited E-cadherin expression. However, it showed the opposite tendency in FOXC2 siRNA group. In addition, there was no significant change in the expression of MMP9 among different groups. Above results illustrated that FOXC2 could promote the invasion ability of normal trophoblast cells by EMT-mediated Hh pathway.