First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Serologic and molecular characterization of the B(A) blood group in the Chinese population.

B(A) phenotype individuals have normal B antigen and a small amount of A antigen on the RBCs with anti-A in the plasma. Some highly potent monoclonal anti-A reagents are capable of agglutinating B(A) RBCs, which therefore usually results in a discrepancy between RBC and plasma ABO grouping. To date, five B(A) alleles (ABO B(A)01, B(A)02, B(A)03, B(A)04, and B(A)05) have been defined by nucleotide sequences. To get a more complete picture of B(A) phenotypes found in the Chinese population and resolve blood donor typing problems caused by B(A) alleles,a serologic and molecular study of nine unrelated Chinese individuals and three families carrying B(A) alleles was conducted. Allele B(A)02 with a 700C>G mutation, allele B(A)04 with a single 640A>G substitution, and allele B(A)05 with a 641T>C mutation were detected in multigenerational families and unrelated blood donors. Neither the B(A)01 nor B(A)03 alleles with 703A>G substitutions were observed in this study. In addition, a polymerase chain reaction with a sequence-specific primer genotyping assay was developed for rapid identification of B(A)02, B(A)04, and B(A)05 alleles using genomic DNA samples.

Characterization of HLA-B*5516, -B*1313, -B*9512, and -DRB1*1457 alleles identified in a southwest Chinese population.

The human leukocyte antigen (HLA)-B*5516 allele differs from the B*5502 by a single 97 T --> C substitution (His to Tyr at position 33) in exon 2. The B*1313 allele results from 419 T --> A and 420 A --> C substitutions, encoding a Leu to Tyr substitution at 140 in exon 2 of the B*1301 allele. The B*9512 allele differs from B*1502 by a single 360 G --> C substitution (Gln to His at 120) in exon 3. The DRB1*1457 allele appears to be a hybrid molecule generated by recombination between the DRB1*13 and DRB1*14 alleles. The serological equivalents of these new alleles are HLA-B22, -B13, -B15, and DR13, respectively. Family studies detected two rare haplotypes: A*11, B*9512, DRB1*14 and A*24, B*52, Cw*07, DRB1*1457, DRB3*020201, DQB1*050301. The gene frequencies of these alleles in the Chinese population are less than 0.0001.

Establishment of an HPA-1- to -16-typed platelet donor registry in China.

In order to determine gene frequencies of human platelet antigen (HPA) and establish a panel of accredited HPA-1a, -2a, -4a, -5a and -6a-negative donors as well as an HPA-typed platelet donor registry, a total of 1000 Chinese donors of Han nationality (500 from north China and 500 from south China) were typed for HPA-1 through -16 using a DNA-based polymerase chain reaction with sequence-specific primers genotyping method. The gene frequencies of HPA-1b, -2b, -3b, -4b, -5b, -6bw, -10bw and -15b were 0.0060, 0.0485, 0.4055, 0.0045, 0.0140, 0.0135, 0.0005 and 0.4680, respectively. The HPA-7bw, -8bw, -9bw, -11bw, -12bw, -13bw, -14bw and -16bw alleles were not found. The HPA-2b and -5b homozygous donors were detected at low frequencies. The HPA mismatch probabilities potentially leading to alloimmunization in random platelet transfusion vary with a region from 0.1% to 37% depending on the distribution patterns of common and less common alleles in each system. This study provides a useful HPA-typed plateletpheresis donor registry in China and could improve platelet antibody detection and HPA-matched platelet transfusion in alloimmune thrombocytopenic patients.

Identification of a novel HLA-A*0278 allele in a Chinese family.

A novel human leukocyte antigen-A (HLA-A) allele, A*0278, has been identified in a Chinese family using DNA-based typing and molecular cloning methods. The alleles A*0278 differs from its closest matching HLA sequence of A*0256 by a silent substitution at 102 A > C and by two replacement substitutions, 98T > A and 292 C > G in exon 2, resulting in a change of codon 33 from Phe (TTC) to Tyr (TAC) and codon 98 from His (CAC) to Asp (GAC). Serology study revealed that A*0278 is associated with HLA-A2 broad specificity. A polymerase chain reaction-sequence-specific primers-based assay was developed to identify A*0278. Family study indicated that the propositus inhered his father's HLA haplotype A*0278, B*35, DRB1*15. No further individuals of A*0278 were found in 5000 Chinese bone marrow donor volunteers.

Identification of a new HLA allele, A*1114, in a Chinese family.

A novel HLA-A allele, A*1114, was initially detected in two generations of a Chinese family by unusual polymerase chain reaction based sequence-specific primers ( PCR-SSP) reaction patterns and ambiguous sequence-based typing (SBT). Molecular cloning and sequencing analysis indicated that this new allele differs from HLA-A*1102 by three nucleotide substitutions in exon 3, 524 A-->G, 526 G-->C, and 527 C-->G, thus changing codon 175 from His to Arg (CAT-->CGT) and codon 176 from Ala to Arg (GCG-->CGG). Segregation analysis showed that the proband inherited his mother's HLA haplotype A*1114, B*5801, DRB1*1405. The serologic equivalent of A*1114 is a split antigen HLA-A11.2. A PCR-SSP method was developed to distinguish A*1114 from other A*11 alleles. No further individuals with A*1114 were found in 5000 Chinese bone marrow donors.

Identification of a novel allele HLA-B*5610 in a Chinese potential bone marrow donor.

A novel HLA-B allele, B*5610, has been identified in a potential bone marrow donor, his mother and brother using DNA-based typing and molecular cloning methods. The B*5610 allele differs from the closest matching HLA sequence of B*5602 by two nucleotide substitutions in exon 3, 559 C-->A and 560 T-->C, resulting in an amino acid change from Leu (CTG) to Thr (ACG) at codon 187. This new allele was segregated together with A*24020101 and DRB1*140101 in the proband's family. Serology study revealed that B*5610 is associated with B22 specificity. A PCR-SSP method was developed to distinguish B*5610 from other B*56 alleles. No further individuals with B*5610 were detected in 5000 Chinese bone marrow blood donors.

Cloning and complete sequence of a novel HLA-A null allele, A*0253 N, with a termination codon generated by a C to G mutation in exon 2.

A novel HLA-A null allele, A*0253 N, has been identified in two generations of a Chinese family using combined serological and molecular cloning approaches. Full-length genomic DNA sequencing indicated that this new allele differs from HLA-A*02011 by a single C to G substitution at nucleotide position 324 in exon 2. This mutation results in an amino acid change from a tyrosine codon to a stop codon at position 108. A PCR-SSP based method was developed to distinguish A*0253 N from A*02 alleles. No further individuals of A*0253 N were found in 718 Chinese blood donors who carry the HLA-A*02 allele1.

Passage of human T-cell leukemia virus type-1 during progression to cutaneous T-cell lymphoma results in myelopathic disease in an HTLV-1 infection model.

Studies comparing functional differences in human T-cell leukemia virus type 1 (HTLV-1) clones that mediate distinct outcomes in experimentally infected rabbits, resulted in a dermatopathic smoldering adult T-cell leukemia/lymphoma following chronic infection with HTLV-1 strain RH/K34. During the 3.5 years' follow-up, HTLV-1 skin disease progressed to cutaneous T-cell lymphoma. When infection was passed to several naive rabbits, progressive paraparesis due to myelopathic neurodegeneration, analogous to HTLV-associated myelopathy, resulted in one of 4 transfusion recipients. Similar proviral loads were detected in the two diseases, regardless of stage of progression or tissue compartment of infection. Complete proviral sequences obtained from the donor and affected recipient aligned identically with each other and with the inoculated virus clone. Existence of disparate pathogenic outcomes following infectious transmission further extends the analogy of using rabbits to model human infection and disease. Although the experimental outcomes shown are limited by numbers of animals affected, they mimic the infrequency of HTLV-1 disease and authenticate epidemiological evidence of virus sequence stability regardless of disease phenotype. The findings suggest that further investigation of a possible role for HTLV-1 in some forms of cutaneous T-cell lymphoma is warranted.

Evidence for humoral and cellular reactivity against keratin and thyroglobulin in HTLV-I infected rabbits.

Human T cell leukemia virus type I (HTLV-I) infection was initially associated with T cell leukemia and a progressive neurologic disease but has since been linked to an increasing number of autoimmune disorders, including Sjogren's syndrome, uveitis, and polyarthritis. A survey of serum samples from a rabbit model of HTLV-I infection revealed that all had antibodies against keratin and thyroglobulin. Sera from several infected rabbits also reacted with collagen, while antibody reactions with other autoantigens tested, including DNA, were rare and sporadic. In addition to antibodies, cellular reactivity to keratin, but not thyroglobulin, was demonstrated by cellular proliferation in presence of IL-2 and keratin. Expanded cell cultures were positive for T cell activation markers and CD8. Association of the auto-reactivity with HTLV-I infection rather than random anti-cellular responses was supported by the fact that no antikeratin or antithyroglobulin was seen in uninfected controls, including that inoculated with uninfected lymphocytes. Finding autoantibodies in rabbits infected using naked HTLV-I DNA clones provided further assurance that infection induced the autoimmune reactions detected.

Source and route of exposure influence infectivity of a molecular clone of human T cell leukemia virus type I.

Infection with human T cell leukemia virus type I (HTLV-I) is typically asymptomatic, but does result in diverse diseases ranging from adult T cell leukemia to spastic neuromyelopathy. To date, differences in HTLV-I provirus structure have not been correlated with pathogenic or asymptomatic outcome of infection. Molecular clones of HTLV-I are now available and represent a powerful tool to link virus structure to pathogenesis. Present studies to explore in vivo infectivity and pathogenicity of an HTLV-I molecular clone, K30p, have utilized the rabbit as a model system. This clone was administered to neonatal or adult rabbits by several different routes and infectivity and pathogenicity were examined. Detection of antiviral humoral immune responses, presence of provirus in tissue samples, and isolation of virus in cultures of blood lymphocytes were used to establish systemic HTLV-I infection. Intramuscular, but not nervous system, exposure to K30p HTLV-I naked DNA resulted in infection. Conversely, neural exposure to T cells that had been transfected with the K30p HTLV-I DNA consistently resulted in systemic infection. Despite detection of HTLV-I provirus in brain and spinal cord of some infected rabbits, no clinical or neuropathological changes occurred. Source and route of virus exposure played a role in infectivity, but did not influence the pathogenic outcome of HTLV-I infection.

Genes in the pX region of human T cell leukemia virus I influence Vav phosphorylation in T cells.

Human T cell leukemia virus I (HTLV-I) causes acute leukemic disease in a low percentage of infected individuals through obscure mechanisms. Our studies compare two rabbit HTLV-I-infected T cell lines: one, RH/K34, causes lethal experimental leukemia and the other, RH/K30, mediates asymptomatic infection. We show herein that the product of the protooncogene vav is constitutively Tyr-phosphorylated in RH/K34 but not in RH/K30. A role for the retrovirus in phosphorylation of Vav was assigned by transfection experiments with molecular clones of HTLV-I derived from the two lines. The HTLV-I molecular clone from RH/K30, but not that from RH/K34, down-regulates Vav phosphorylation in a Herpesvirus ateles-transformed T cell line. Use of recombinant virus clones revealed that a pX region sequence differing by two nucleotides between the two clones mediates this down-regulation. Because Vav is involved in T cell signaling and Vav phosphorylation occurs upon activation of T cells, control of the activation state of Vav by viral proteins may relate to the leukemogenic potential of certain HTLV-I-infected cells.

Experimental perinatal transmission of human immunodeficiency virus type 1 by passage of infected T cells.

Pediatric AIDS typically follows transmission of human immunodeficiency virus type 1 (HIV-1) from infected mothers to their offspring. The possibility that infected maternal-origin cells serve as a conveyance for mother-to-child HIV-1 transmission was investigated in a rabbit infection model. Administration of HIV-1-infected human T cells to pregnant rabbits was followed by evaluation of offspring, from newborn to 1.5 years of age. HIV-1 was detected in 11 of 19 vaginally delivered offspring born to mothers given infected cells during gestation. Interstitial pneumonias or lymphoid organ lesions, similar to those seen in human pediatric AIDS, occurred in some offspring. Persistence of inoculum cell (HLA)-specific gene sequences in offspring indicated that vertical transmission can be effected by T cell-associated virus. These results along with features of rabbit biology, including primate-type placentation, short gestation, and delivery of litters, suggest that the rabbit model is advantageous for studies of perinatal HIV-1 transmission.

Infectivity of chimeric human T-cell leukemia virus type I molecular clones assessed by naked DNA inoculation.

Two human T-cell leukemia virus type I (HTLV-I) molecular clones, K30p and K34p were derived from HTLV-I-infected rabbit cell lines. K30p and K34p differ by 18 bp with changes in the long terminal repeats (LTRs) as well as in the gag, pol, and rex but not tax or env gene products. Cells transfected with clone K30p were infectious in vitro and injection of the K30p transfectants or naked K30p DNA into rabbits leads to chronic infection. In contrast, K34p did not mediate infection in vitro or in vivo, although the cell line from which it was derived is fully infectious and K34p transfectants produce intact virus particles. To localize differences involved in the ability of the clones to cause infection, six chimeric HTLV-I clones were constructed by shuffling corresponding fragments containing the substitutions in the LTRs, the gag/pol region and the rex region between K30p and K34p. Cells transfected with any of the six chimeras produced virus, but higher levels of virus were produced by cells transfected with those constructs containing the K30p rex region. Virus production was transient except in cells transfected with K30p or with a chimera consisting of the entire protein coding region of K30p flanked by K34p LTRs; only the transfectants showing persistent virus production mediated in vitro infection. In vivo infection in rabbits following intramuscular DNA injection was mediated by K30p as well as by a chimera of K30p containing the K34p rex gene. Comparisons revealed that virus production was greater and appeared earlier in rabbits injected with K30p. These data suggest that several defects in the K34p clone preclude infectivity and furthermore, provide systems to explore functions of HTLV-I genes.

Experimental acute adult T cell leukemia-lymphoma is associated with thymic atrophy in human T cell leukemia virus type I infection.

Human T cell leukemia virus type I (HTLV-1) infection may lead to an acutely fatal adult T cell leukemia-lymphoma (ATLL), but HTLV-1-infected people usually remain asymptomatic. Why only certain HTLV-I infections lead to acute ATLL, which is characterized by leukemic infiltration of multiple organs and immune suppression, remains unknown. A readily accessible animal model in which the spectrum of consequences resulting from HTLV-I infection can be observed would greatly aid studies of this retrovirus. New Zealand White rabbits inoculated with either HTLV-1-infected CD25+ T cells or cell-free virus, were serially necropsied at different intervals after death or humane sacrifice. Tissues were preserved at necropsy or cultured in vitro and subsequently prepared for morphologic or molecular examination. Rabbits inoculated with RH/K34, a productively infected rabbit T cell line that contains a monoclonally integrated full-length HTLV-I provirus, developed acute ATLL-like biologically malignant lymphoproliferative disease with lymphocyte infiltration of viscera; lymphomas consisting primarily of monoclonal expansions of RH/K34 manifested a variety of diffuse pleomorphic histologic types. Concurrently, lymphoproliferative disease was associated with onset of thymic atrophy in the presence of rapidly increasing thymic proviral load. In contrast, rabbits given two other HTLV-1 inocula, originally derived (as was RH/K34) using the human T cell line MT-2 as virus source, also became infected but did not develop thymic atrophy or the ATLL-like disease. HTLV-1 infection, thymic atrophy, and leukemic infiltration similar to acute ATLL occurred reproducibly in a New Zealand White rabbit model independent of RH/K34 inoculum and host histocompatibility. Thymic atrophy in RH/K34-inoculated rabbits, but not in rabbits given other similar HTLV-1, was consistent with immunosuppression sufficient to prevent rejection of the inoculum. Although the short, 8-day course of the experimental ATLL precludes its having a molecular pathogenesis identical to the human condition, the systemic consequences of acute ATLL, including its association with thymic atrophy, are closely modeled.

Replication of HIV type 1 in rabbit cell lines is not limited by deficiencies in tat, rev, or long terminal repeat function.

HIV-1 infection has been documented in rabbits, but infection proceeds slowly in this species. Human and rabbit cell lines were compared in order to identify barriers to efficient HIV-1 infection of rabbit cells. A direct comparison of human and rabbit CD4 as receptor for HIV-1 indicated that the rabbit CD4 homolog did not function well even when expressed by human cells. Examination of viral RNA production indicated that the major HIV transcripts were produced in HIV-infected rabbit cells, but were present at levels significantly lower than those found for human cells. Ability of HIV-1 LTRs to direct protein expression in human and rabbit cells was compared using gene constructs with the chloramphenicol acetyltransferase (cat) gene flanked by HIV-1 LTRs. Chloramphenicol acetyltransferase protein expression was equivalent in rabbit and human cell lines transfected with the HIV-1/CAT constructs and cotransfections with the HIV-1 tat gene led to similar increases in CAT expression. Subsequent transfections with an infectious molecular HIV clone yielded approximately equal levels of HIV protein expression in rabbit and human cell lines, suggesting that major barriers to virus production in rabbit lines exist at steps prior to transcription of the viral genome. Because HTLV-I replicates with high efficiency in rabbit cells, a chimeric virus clone was constructed consisting of the 5' portion of HIV-1 through the nef coding sequence followed by the 3' HTLV-I LTR. Transfection of most rabbit cell lines with the chimera produced levels of p24gag protein higher than those transfected with the parent HIV-1 clone. By contrast, the unmodified HIV clone replicated more efficiently in all human cell lines tested.

Characterization of an infectious molecular clone of human T-cell leukemia virus type I.

An infectious molecular clone of human T-cell leukemia virus type I (HTLV-I) was derived from an HTLV-I-transformed rabbit T-cell line, RH/K30, obtained by coculture of rabbit peripheral blood mononuclear cells (PBMC) with the human HTLV-I-transformed cell line MT-2. The RH/K30 cell line contained two integrated proviruses, an intact HTLV-I genome and an apparently defective provirus with an in-frame stop codon in the env gene. A genomic DNA fragment containing the intact HTLV-I provirus was cloned into bacteriophage lambda (K30 phi) and subcloned into a plasmid vector (K30p). HTLV-I p24gag protein was detected in culture supernatants of human and rabbit T-cell and fibroblast lines transfected with these clones, at levels comparable to those of the parental cell line RH/K30. Persistent expression of virus was observed in one of these lines, RL-5/K30p, for more than 24 months. Biologic characterization of this cell line revealed the presence of integrated HTLV-I provirus, spliced and unspliced mRNA transcripts, and typical extracellular type C retrovirus particles. As expected, these virus particles contained HTLV-I RNA and reverse transcriptase activity. The transfected cells also expressed surface major histocompatibility complex class II, whereas no expression of this molecule was detected in the parental RL-5 cell line. Virus was passaged by cocultivation of irradiated RL-5/K30p cells with either rabbit PBMC or human cord blood mononuclear cells, demonstrating in vitro infectivity. The virus produced in these cells was also infectious in vivo, since rabbits injected with RL-5/K30p cells became productively infected, as evidenced by seroconversion, amplification of HTLV-I-specific sequences by PCR from PBMC DNA, and virus isolation from PBMC. Availability of infectious molecular clones will facilitate functional studies of HTLV-I genes and gene products.

A genetically determined insertion/deletion related polymorphism in human T cell receptor beta chain (TCRB) includes functional variable gene segments.

Polymorphism in the human T cell receptor beta chain (TCRB) gene complex includes haplotypes with different numbers of TCRBV genes. An insertion/deletion related polymorphism (IDRP) in the human TCRBV region was found to involve TCRBV gene segments. Inserted TCRB haplotypes contain an additional 21.5 kb in which three TCRBV genes are encoded, members of the TCRBV7, TCRBV9, and TCRBV13 families. Two TCRBV gene segments were present only in inserted haplotypes; one of these, TCRBV7S3, is a functional gene and the other, TCRBV9S2(P), is a pseudogene because of an inframe termination colon. In addition, inserted haplotypes contain two identical copies of the TCRBV13S2 gene, whereas deleted haplotypes have only one copy. Deleted haplotypes could be subdivided into two types, deleted*1 and deleted*2, on the basis of sequence variations in TCRBV6S7 and TCRBV13S2 genes. Both deleted*1 and deleted*2 haplotypes contained the same number of TCRBV genes; both contain 60 genes of which 50 are functional, whereas, inserted haplotypes contained 63 genes of which 52 are functional. Comparisons of inserted region sequences with the homologous region in a deleted haplotype, and with sequences surrounding related TCRBV genes, revealed patterns of similarity that suggest insertion as well as deletion events have occurred in the evolution of the TCRBV gene complex. These data indicate that the genomic TCR repertoire is expanded in individuals who have inserted TCRBV haplotypes. The presence of additional TCRBV genes or, alternatively, the absence of certain TCRBV genes may have an impact upon immune responses and susceptibility to autoimmune diseases.

[A rapid and simple method for direct genotype determination of ABO blood group].

We report the use of an allele-specific polymerase chain reaction (ASPCR) format together with low melting temperature agarose gel electrophoresis which allows rapid identification of the six major genotypes of the ABO blood group. Four sequence specific primer sets, each specific for a different set of ABO alleles, were used. Twenty individuals, whose ABO genotypes were previously determined by serological and family analysis, were typed with this new approach. A 100% correlation between serology and the ASPCR was found. This method is rapid, simple, and reproducible. Potential applications include identification of ABO subgroups and variants, paternity testing, as well as forensic science.