A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

Lentivirus Is an Efficient and Stable Transduction Vector for Intervertebral Disc Cells.

OBJECTIVE: To evaluate transduction efficacy and sustainability of lentiviral vector for intervertebral disc cells both in vitro and in vivo. METHODS: Human nuclear pulposus and anulus fibrosus cells isolated from disc tissue of 28 patients during surgical disc procedures were cultured and subsequently transduced using recombinant lentivirus carrying a gene for enhanced green fluorescent protein at multiplicities of infection of 0, 15, 30, 60, 90, and 150. Cell viability was determined using the trypan blue exclusion test. Transduction efficiency was measured by fluorescence-activated cell sorting analysis. In vivo experiments were done by injecting lentivirus into rat intervertebral discs. Disc tissue was harvested 7, 14, 21, and 28 days after transduction, and enhanced green fluorescent protein expression was examined using an inverted fluorescent microscope. RESULTS: Intervertebral disc cells transduced with different doses of lentivirus showed equally good viabilities compared with cells in the control group, as determined by cell morphology and growth curves after transduction. The transduction ratio for disc cells after transduction reached its optimum of 97% at 60 multiplicities of infection, independent of patient age, sex, surgical procedure, diagnosis, disc level, or degeneration grade. In vivo frozen sections revealed that enhanced green fluorescent protein expression peaked on the 7th day and remained detectable the 28th day after transduction. No significant systemic symptoms were observed during the in vivo experiment. CONCLUSIONS: Lentivirus appears to be an efficient and stable transduction vector for intervertebral disc cells. It has potential as a gene therapy tool for treating human degenerative disc disease.

Isolated complete caudate lobectomy for hepatic tumor of the anterior transhepatic approach: surgical approaches and perioperative outcomes.

BACKGROUND: How to resect the caudate lobe safely is a major challenge to current liver surgery which requires further study. METHODS: Nine cases (6 hepatic cell carcinoma, 2 cavernous hemangioma and 1 intrahepatic cholangiocacinoma) were performed using the anterior transhepatic approach in the isolated complete caudate lobe resection. During the operation, we used the following techniques: the intraoperative routine use of Peng's multifunction operative dissector (PMOD), inflow and outflow of hepatic blood control, low central venous pressure and selective use of liver hanging maneuver. RESULTS: There were no perioperative deaths observed after the operation. The median operating time was 230 ± 43.6 minutes, the median intraoperative blood loss was 606.6 ± 266.3 ml and the median length of postoperative hospital stay was 12.6 ± 2.9 days. The incidence of complications was 22.22% (2/9). CONCLUSION: PMOD and "curettage and aspiration" technique can be of great help of in the dissection of vessels and parenchyma, clearly making caudate lobe resection safer, easier and faster.

Granulocyte-macrophage colony-stimulating factor potentiates rituximab in patients with relapsed follicular lymphoma: results of a phase II study.

PURPOSE: We hypothesized that granulocyte-macrophage colony-stimulating factor (GM-CSF) could potentiate the clinical activity of rituximab given its individual and cooperative effects on Fc gamma RIIa- and Fc gamma RIIIa-expressing cells. A phase II clinical study combining GM-CSF and rituximab was initiated in patients with relapsed follicular lymphoma (FL) to determine the clinical and biologic responses, as well as safety of the combination. PATIENTS AND METHODS: Thirty three patients with relapsed FL were treated with GM-CSF 5 microg/kg/d on days 1 to 8 and rituximab 375 mg/m(2) on day 5 of each 21-day cycle for four cycles. Clinical response and tolerability were examined according to international criteria. Biologic monitoring included evaluation of immune cells involved in rituximab activity. RESULTS: Of 33 evaluated patients, a 70% overall response rate (complete response plus complete response unconfirmed, 45%) and a median progression-free survival (PFS) of 16.5 months were achieved. Outcome was influenced by the quality of response and the Follicular Lymphoma International Prognostic Index (FLIPI), where low- and intermediate-risk FLIPI groups were associated with significantly better PFS. After treatment there was a significant increase in granulocyte and monocyte counts. Examination of dendritic cell response showed an overall increase in plasmacytoid dendritic cells, especially in non-complete response patients, after treatment. Addition of GM-CSF did not impair tolerance to rituximab, and adverse events were rare and mild. DISCUSSION: GM-CSF plus rituximab results in high response rates, along with a tolerable safety profile in patients with relapsed or progressive FL. The improved efficacy over rituximab monotherapy may be due to increases seen in monocyte, granulocyte, and dendritic cell populations.

Experience in resection of hilar cholangiocarcinoma: a report of 54 cases / 中华外科杂志

<p><b>OBJECTIVE</b>To summarize the experience in ameliorating curative resection rate and major postoperative complication rate for treatment of hilar cholangiocarcinoma.</p><p><b>METHODS</b>Respective analysis was made on the clinical data of 54 consecutive cases who underwent resection of hilar cholangiocarcinoma from Jan. 1998 to Dec. 2004.</p><p><b>RESULTS</b>In this group 54 cases received tumor resection with a resection rate of 63.5%. Combined partial hepatectomy was performed in 14 patients, while combined pancreaticoduodenectomy (Whipple) in 3 patients, and combined resection of portal vein in 2 patients and combined resection of hepatic artery in 2 patients. Thirty patients had curative resection. The curative resection rate was greatly increased from 27.0% (before 2001) to 41.7% (after 2001) in this group with well controlled perioperative mortality and postoperative complications rate (e.g. hepatic failure and major infection). The gross 1-, 2-, and 3-year survival rates for the whole group were 67.4%, 28.1% and 13.5% respectively. The 1-, 2-, and 3-year survival rates for curative resection were 87%, 36% and 24% respectively. The 1-, 2-year survival rates for palliative resection were 42% and 18%.</p><p><b>CONCLUSIONS</b>Enhanced surgical technique resulted in better clinical outcomes.</p>