Network pharmacology-based approach to investigate the molecular targets of essential oil obtained from lavender for treating breast cancer.

Lavender essential oil (LEO) is known for its medicinal use in the development of pharmaceuticals. Further investigations were demonstrated that LEO has many biological properties including apoptosis. However, The anti-breast cancer activity and mechanism of LEO are still unclear. we aim to elucidate the elusive anti-breast cancer activity and mechanism of LEO by unveiling the intricate molecular targets that it engages with, thereby priming it for effective therapeutic intervention against breast carcinoma. In this paper, we extracted LEO from lavender and analyzed it's chemical constituents by using hydro-distillation and gas chromatography-mass spectrometry (GS-MS/MS) method, respectively. The active components against breast cancer and it's molecular targets were selected and biological process, molecular function, cellular component and involving pathways were evaluated via network pharmacology approach. Cell viability, apoptosis and cell cycle assay were used to evaluate anti-breast cancer effect of LEO. Employing the western blotting method to validate target protein expression following LEO treatment in vitro. We found the 21 effective components and 213 drug-disease common targets of LEO. Amoung them, 7 active components and 19 targets were identified as potential therapeutic targets. Gene ontology results revealed that the drug-disease common targets of LEO were mainly distributed in membrane region, involved in peptide-tyrosine phosphorylation, and primarily associated with protein tyrosine kinase. We also found that drug-disease common targets might contribute to the regulation of PI3K-AKT signaling pathway by using KEGG pathway analysis. Besides, our study demonstrated reduced cell viability, induced apoptosis in MCF-7 and MDA-MB-231 treated with LEO while cell cycle arrest was not altered. The AKT1 expression down-regulated while PIK3CA expression was increased in both cell lines. Our findings indicate that LEO has the ability to induce apoptosis by modulating the expression of PI3K-AKT signaling pathway in these cell lines.

Neutralization against SARS-CoV-2 Delta/Omicron variants and B cell response after inactivated vaccination among COVID-19 convalescents.

Emerging SARS-CoV-2 variants have made COVID-19 convalescents susceptible to re-infection and have raised concern about the efficacy of inactivated vaccination in neutralization against emerging variants and antigen-specific B cell response. To this end, a study on a long-term cohort of 208 participants who have recovered from COVID-19 was conducted, and the participants were followed up at 3.3 (Visit 1), 9.2 (Visit 2), and 18.5 (Visit 3) months after SARS-CoV-2 infection. They were classified into three groups (no-vaccination (n = 54), one-dose (n = 62), and two-dose (n = 92) groups) on the basis of the administration of inactivated vaccination. The neutralizing antibody (NAb) titers against the wild-type virus continued to decrease in the no-vaccination group, but they rose significantly in the one-dose and two-dose groups, with the highest NAb titers being observed in the two-dose group at Visit 3. The NAb titers against the Delta variant for the no-vaccination, one-dose, and two-dose groups decreased by 3.3, 1.9, and 2.3 folds relative to the wild-type virus, respectively, and those against the Omicron variant decreased by 7.0, 4.0, and 3.8 folds, respectively. Similarly, the responses of SARS-CoV-2 RBD-specific B cells and memory B cells were boosted by the second vaccine dose. Results showed that the convalescents benefited from the administration of the inactivated vaccine (one or two doses), which enhanced neutralization against highly mutated SARS-CoV-2 variants and memory B cell responses. Two doses of inactivated vaccine among COVID-19 convalescents are therefore recommended for the prevention of the COVID-19 pandemic, and vaccination guidelines and policies need to be updated.

Long-term outcomes of COVID-19 convalescents: An 18.5-month longitudinal study in Wuhan.

OBJECTIVES: This study aimed to describe the full scope of long-term outcomes and the ongoing pathophysiological alterations among COVID-19 survivors. METHODS: We established a longitudinal cohort of 208 COVID-19 convalescents and followed them at 3.3 (interquartile range [IQR]: 1.3, 4.4, visit 1), 9.2 (IQR: 9.0, 9.6, visit 2), and 18.5 (IQR: 18.2, 19.1, visit 3) months after infection, respectively. Serial changes in multiple physical and psychological outcomes were comprehensively characterized. We, in addition, explored the potential risk factors of SARS-CoV-2 antibody response and sequelae symptoms. RESULTS: We observed continuous improvement of sequelae symptoms, lung function, chest computed tomography (CT), 6-minute walk test, and the Borg dyspnea scale, whereas sequelae symptoms (at least one) and abnormal chest CT patterns still existed in 45.2% and about 30% of participants at 18.5 months, respectively. Anxiety and depression disorders were alleviated for the convalescents, although depression status was sustained for a longer duration. CONCLUSIONS: Most COVID-19 convalescents had an overall improved physical and psychological health status, whereas sequelae symptoms, residual lesions on lung function, exercise impairment, and mental health disorders were still observed in a small proportion of participants at 18.5 months after infection. Implementing appropriate preventive and management strategies for the ever-growing COVID-19 population is warranted.

Tandem Cas13a/crRNA-Mediated CRISPR-FET Biosensor: A One-for-All Check Station for Virus without Amplification.

The path toward field-effect transistor (FET) application from laboratory to clinic has delivered a compelling push in the biomedical domain, yet ultrasensitive and timely pathogen identification without PCR remains a long-lasting challenge. Herein, we create a generic check station termed "CRISPR-FET", first incorporating the CRISPR/Cas13a system within the FET modality, for accelerated and unamplified detection of viral RNA. Unlike conventional FETs bearing target-specific receptors, this sensor holds three unique advancements: (i) an ingenious sensing mechanism is used, which converts the signal of a large-sized analyte into an on-chip cleavage response of an immobilized CRISPR reporter, enabling signal generation events to occur all within the Debye length; (ii) the multipurpose inspection of the CoV ORF1ab, CoV N gene, and HCV RNA unveils the potential for "one-for-all" scalable FET-based molecular diagnostics; and (iii) it is shown that Cas13a-crRNAs targeting different sites of the viral genome can be deployed in tandem to amplify the FET response, empowering the detection limit down to 1.56 aM, which is a world-record level of sensitivity in the FET for direct viral gene sensing. Notably, a brilliant clinical applicability was made in distinguishing HCV-infected patients from normal controls. Overall, this study sheds new insights into FET-based nucleic acid sensing technology and invokes a vision for its possible future roles in diagnosis of various viral diseases.

Src acts as the target of matrine to inhibit the proliferation of cancer cells by regulating phosphorylation signaling pathways.

Studies have shown that matrine has antitumor activity against many types of cancers. However, the direct target in cancer cells of its anticancer effect has not been identified. The purpose of this study was to find the molecular target of matrine to inhibit the proliferation of cancer cells and explore its mechanism of action. Herein we showed that matrine inhibited the proliferation of cancer in vitro and in vivo. Pull-down assay with matrine-amino coupling resins and liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) identified Src as the target of matrine. Cellular thermal shift assay (CETSA) and drug affinity responsive target stability (DARTS) provided solid evidences that matrine directly bound to Src. Bioinformatics prediction and pull-down experiment demonstrated that Src kinase domain was required for its interaction with matrine and Ala392 in the kinase domain participated in matrine-Src interaction. Intriguingly, matrine was proven to inhibit Src kinase activity in a non-ATP-competitive manner by blocking the autophosphorylation of Tyr419 in Src kinase domain. Matrine down-regulated the phosphorylation levels of MAPK/ERK, JAK2/STAT3, and PI3K/Akt signaling pathways via targeting Src. Collectively, matrine targeted Src, inhibited its kinase activity, and down-regulated its downstream MAPK/ERK, JAK2/STAT3, and PI3K/Akt phosphorylation signaling pathways to inhibit the proliferation of cancer cells.

Validation and update of a multivariable prediction model for the identification and management of patients at risk for hepatocellular carcinoma.

BACKGROUND: A hepatocellular carcinoma (HCC) prediction model (ASAP), including age, sex, and the biomarkers alpha-fetoprotein and prothrombin induced by vitamin K absence-II, showed potential clinical value in the early detection of HCC. We validated and updated the model in a real-world cohort and promoted its transferability to daily clinical practice. METHODS: This retrospective cohort analysis included 1012 of the 2479 eligible patients aged 35 years or older undergoing surveillance for HCC. The data were extracted from the electronic medical records. Biomarker values within the test-to-diagnosis interval were used to validate the ASAP model. Due to its unsatisfactory calibration, three logistic regression models were constructed to recalibrate and update the model. Their discrimination, calibration, and clinical utility were compared. The performance statistics of the final updated model at several risk thresholds are presented. The outcomes of 855 non-HCC patients were further assessed during a median of 10.2 months of follow-up. Statistical analyses were performed using packages in R software. RESULTS: The ASAP model had superior discriminative performance in the validation cohort [C-statistic = 0.982, (95% confidence interval 0.972-0.992)] but significantly overestimated the risk of HCC (intercept - 3.243 and slope 1.192 in the calibration plot), reducing its clinical usefulness. Recalibration-in-the-large, which exhibited performance comparable to that of the refitted model revision, led to the retention of the excellent discrimination and substantial improvements in the calibration and clinical utility, achieving a sensitivity of 100% at the median prediction probability of the absence of HCC (1.3%). The probability threshold of 1.3% and the incidence of HCC in the cohort (15.5%) were used to stratify the patients into low-, medium-, and high-risk groups. The cumulative HCC incidences in the non-HCC patients significantly differed among the risk groups (log-rank test, p-value < 0.001). The 3-month, 6-month and 18-month cumulative incidences in the low-risk group were 0.6%, 0.9% and 0.9%, respectively. CONCLUSIONS: The ASAP model is an accurate tool for HCC risk estimation that requires recalibration before use in a new region because calibration varies with clinical environments. Additionally, rational risk stratification and risk-based management decision-making, e.g., 3-month follow-up recommendations for targeted individuals, helped improve HCC surveillance, which warrants assessment in larger cohorts.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Peripheral blood inflammatory markers in predicting prognosis in patients with COVID-19. Some differences with influenza A.

BACKGROUND: To evaluate the ability of peripheral blood inflammatory markers in predicating the typing of COVID-19, prognosis, and some differences between COVID-19 and influenza A patients. METHODS: Clinical data on 285 cases laboratory-confirmed as SARS-CoV-2 infection were obtained from a Wuhan local hospital's electronic medical records according to previously designed standardized data collection forms. Additional 446 Influenza A outpatients' hematologic data were enrolled for comparison. RESULTS: NLR, SII, RLR, PLR, HsCRP, and IL-6 were significant higher and LMR was lower in severe COVID-19 patients than in mild COVID-19 patients (p < .001). PLR and LMR were lower in the individuals with influenza A than those with COVID-19 (p < .01). COVID-19 patients with higher levels of NLR, SII, RLR, PLR, HsCRP, and IL-6 and lower LMR were significantly associated with the severe type. AUC of NLR (0.76) was larger while the specificity of IL-6 (86%) and sensitivity of HsCRP (89%) were higher than other inflammatory markers in predicating the typing of COVID-19. PT had obvious correlation with all the inflammatory markers except RPR. NLR showed positive correlations with AST, TP, BUN, CREA, PT, and D-dimer. Patients with high IL-6 levels have a relatively worse prognosis (HR = 2.30). CONCLUSION: Peripheral blood inflammatory markers reflected the intensity of inflammation and associated with severity of COVID-19.NLR was more useful to predict severity as well as IL-6 to predict prognosis of COVID-19. PLR and LMR were initially found to be higher in SARS-CoV-2 virus-infected group than in influenza A.

Escherichia coli PagP Enzyme-Based De Novo Design and In Vitro Activity of Antibacterial Peptide LL-37.

BACKGROUND The aim of this study was to investigate the antimicrobial property of peptide LL-37 sequences. MATERIAL AND METHODS Humanized antibacterial peptide LL-37 and the mutant were prepared by chemical synthesis. The physicochemical properties of antibacterial peptide LL-37 were analyzed by SWISS-MODEL online prediction tool. Molecular docking between antibacterial peptide LL-37 fragments and palmitoyl transferase PagP was made with Lamarckian genetic algorithm by AutoDock1.5.6. RESULTS The systems contacted each other at 8.75 picosec. After 20 picsec, the system had no trend of dissociation, and the bond energy of weak bond -C-O-H…NH2-CH2- was calculated. The hydrophobic groups were important factors that led to contact and merged the two parts. The contacted weak bond -C-O-H…NH2-CH2- was the bridge for contacting LL-37 with palmitoyl transferase PagP. The binding sites of antibacterial peptide LL-37 and palmitoyl transferase PagP mainly included LYS8, GLU11, LEU28, LYS12, PHE27, ILE13, and PHE6 of antibacterial peptide LL-37 and ARG94, TRP89, ASN65, SER3, GLU90, GLU90, ASN100, HIS102, and THR92 of palmitoyl transferase PagP. CONCLUSIONS Antibacterial peptide LL-37 had stronger antibacterial effect via inhibition of activity of PagP.

Prevalence of mutations in HBV DNA polymerase gene associated with nucleos(t)ide resistance in treatment-naive patients with Chronic Hepatitis B in Central China

Abstract Objective There are a lot of disagreements in the studies on hepatitis B virus (HBV) DNA polymerase mutation rate associated with nucleos(t)ide analogues (NAs) in treatment-naive chronic hepatitis B (CHB) patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China. Methods This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay. Results 269 patients were infected with HBV genotype B (81.4%), C (17.9%), and both B and C (0.7%). Mutations in HBV DNA polymerase were detected in 24 patients (8.9%) including rtM204I/V (n = 6), rtN236T (n = 5), rtM250V (n = 2), rtL180M (n = 2), rtT184G (n = 1), rtM207I (n = 1), rtS202I (n = 1), rtM204V/I & rtL180M (n = 5), and rtM204I & rtM250V (n = 1). Conclusion Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM), adefovir (ADV), and telbivudine (LdT).

Prevalence of mutations in HBV DNA polymerase gene associated with nucleos(t)ide resistance in treatment-naive patients with Chronic Hepatitis B in Central China.

OBJECTIVE: There are a lot of disagreements in the studies on hepatitis B virus (HBV) DNA polymerase mutation rate associated with nucleos(t)ide analogues (NAs) in treatment-naive chronic hepatitis B (CHB) patients. This is the first study aimed to investigate the prevalence of spontaneous HBV resistance mutations in Central China. METHODS: This study included treatment-naive patients with CHB from June 2012 to May 2015 receiving care at the Institute of Liver Disease in Central China. All patients completed a questionnaire covering different aspects, such as family medical history, course of liver disease, medication history, alcohol use, among others. Mutations in HBV DNA polymerase associated with NAs resistance were detected using INNO-LiPA assay. RESULTS: 269 patients were infected with HBV genotype B (81.4%), C (17.9%), and both B and C (0.7%). Mutations in HBV DNA polymerase were detected in 24 patients (8.9%) including rtM204I/V (n=6), rtN236T (n=5), rtM250V (n=2), rtL180M (n=2), rtT184G (n=1), rtM207I (n=1), rtS202I (n=1), rtM204V/I & rtL180M (n=5), and rtM204I & rtM250V (n=1). CONCLUSION: Spontaneous HBV resistance mutations in HBV DNA polymerase were found in treatment-naive patients with CHB in Central China. These findings suggest that we should analyze HBV DNA polymerase resistance mutation associated with NAs before giving antiviral therapy such as lamivudine (LAM), adefovir (ADV), and telbivudine (LdT).

Relationship between cervical disease and infection with human papillomavirus types 16 and 18, and herpes simplex virus 1 and 2.

Persistent infection with high-risk HPV, particularly Type HPV 16 and 18, is necessary in the development of cervical cancer, but apart from HPV infection, other causative factors of most cervical cancers remain unknown. The aim of this study was to determine the prevalence of HPV 16 and HPV 18 and HSV 1 and HSV 2 in cervical samples, and to assess the role of HSVs in cervical carcinogenesis. Two hundred thirty-three healthy controls and 567 cases (333 of cervicitis, 210 of cervical intraepithelial neoplasia, and 24 of squamous cell carcinoma) in cervical exfoliative cells were tested for HPV 16, HPV 18, HSV 1, and HSV 2 DNA using the triplex real-time polymerase chain reaction method. In contrast to healthy women, positive rate of HPV is related significantly to cervical lesions (odds ratios (ORs) = 4.1, P < 0.01 for cervical intraepithelial neoplasia; ORs = 24.9, P < 0.01 for squamous cell carcinoma), but not cervicitis (ORs = 2.3, P > 0.05). HSV 2 prevalence in cervical intraepithelial neoplasia and squamous cell carcinoma was higher than in healthy women (ORs = 4.9, P < 0.05 for cervical intraepithelial neoplasia; ORs = 4.7, P < 0.05 for squamous cell carcinoma). HSV 2 coinfection with HPV in cervical intraepithelial neoplasia and squamous cell carcinoma was strongly higher than in healthy women (ORs = 34.2, P < 0.01 for cervical intraepithelial neoplasia; ORs = 61.1, P < 0.01 for squamous cell carcinoma). The obtained results indicated that the presence of HPV is associated closely with cervical cancer, and that HSV 2 infection or co-infection with HPV might be involved in cervical cancer development, while HSV 1 might not be involved.

A novel multiplex real-time PCR assay for the detection and quantification of HPV16/18 and HSV1/2 in cervical cancer screening.

Infection with human papillomavirus (HPV), particularly HPV16 and HPV18, is the main cause of invasive cervical cancer, although other factors such as herpes simplex virus (HSV) may act in conjunction with HPV in this context. To explore the possibility of developing a system for rapid diagnosis and clinical screening of cervical cancer, we developed a multiplex real-time PCR assay that can simultaneously detect and quantify HPV16/18 and HSV1/2. To evaluate its possibilities and practical uses, 177 samples collected from patients with suspected HPV and HSV infection in exfoliated cervical cells, genital herpes or labial herpes were tested by multiplex real-time PCR and compared with results obtained by DNA sequencing. Each virus was detected over a range from 1.0 × 10(1) to 1.0 × 10(7) copies/reaction. The clinical sensitivity was 100% for HPV16/18 and HSV1/2. The clinical specificity was 97.1% for HPV16, 98.1% for HPV18, 97.0% for HSV1 and 96.0% for HSV2. The kappa value was 0.96 for HPV16, 0.92 for HPV18, 0.94 for HSV1 and 0.93 for HSV2, when DNA sequencing was used as the reference standard. In summary, this novel multiplex real-time PCR allows the rapid and specific detection of HPV16/18 and HSV1/2, as well as coinfection with HPV and HSV, in clinical samples. In the future, this multiplex real-time PCR assay will assist in cervical cancer screening, viral treatment evaluation and epidemiological studies in which high throughput analysis is required.

A highly sensitive TaqMan real-time PCR assay for early detection of Schistosoma species.

Schistosomiasis is a major infectious disease and a public health concern in many areas in China and other countries. Sensitive method for detection of the parasite is critical for early diagnosis and for monitoring of effective treatment of the disease. In this study, we developed a highly sensitive TaqMan real-time PCR assay for the detection of Schistosoma japonicum DNA in mouse feces and serum samples. This assay was based on the DNA sequence of the S. japonicum 18S rRNA gene and was able to detect 10 fg of S. japonicum genomic DNA, which is 100 times more sensitive than conventional PCR. We were able to detect the S. japonicum DNA one week post-infection in mouse sera and 4 weeks post-infection in feces, which was one week earlier than egg detection by microscopy in feces. This assay was also highly specific for Asian Schistosomes which are causative species of human Schistosomiasis. In single sex male cercariae infected mice, parasite DNA was only detected in the first 4 weeks post-infection, suggesting that the DNA was derived from decaying worms' corpse in the first 4 weeks whereas the DNA was mainly from decaying parasite eggs afterwards. Therefore we conclude that the established TaqMan real-time PCR assay is a sensitive, specific and convenient method that could be used for the early diagnostic evaluation of S. japonicum infection in humans and for monitoring outbreaks in endemic areas with low prevalence.

Novel multiplex real-time PCR system using the SNP technology for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and genetic typing of serovars of C. trachomatis and U. parvum in NGU.

To explore the possibilities of a novel multiplex real-time PCR system for rapid diagnosis, genetic typing of serovars and clinical application in NGU, we developed a multiplex real-time PCR system for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and molecular detection of serovars of C. trachomatis and U. parvum in NGU using the SNP technology and TaqMan-LNA probe. In 57 pathogen-positive clinical specimens, we identified the following C. trachomatis serovars: D (20.05%, 12/57), E (36.84%, 21/57), F (19.30%, 11/57), G (8.77%, 5/57), H (5.26%, 3/57), J (3.51%, 2/57), and K (5.26%, 3/57). In 115 pathogen-positive clinical specimens, we identified the following U. parvum serovars: 1 (0.87%, 2/115), 3 (55.65%, 64/115), 6 (20.87%, 24/115) and 14 (21.74%, 25/115). Our fast pathogen diagnosis and serotyping assay using real-time TaqMan-LNA PCR may improve our ability to study the pathogenesis and epidemiology of NGU.

[Fluorescent quantitative real-time PCR for detection of Schistosoma japonicum].

OBJECTIVE: To establish a sensitive and specific fluorescent quantitative real-time PCR method for the detection of Schistosoma japonicum. METHODS: Based on 18SrRNA sequence of S. japonicum, a PCR assay was established. The 1450bp fragment was amplified and cloned into T vector which was subsequently transformed into E.coli DH5alpha. Following extraction and identification, the positive recombinant plasmid was used as quantitative template to generate standard curve. Reproducibility and specificity of the assay was determined as well. RESULTS: The standard curve established by recombinant plasmid showed a fine linear relationship between threshold cycle (Ct) and template concentration, and the correlation coefficient was 0.998 7. Using the coefficient of variation (CV) value to evaluate the reproducibility, at the template concentration of 1.05 x 10(7)-1.05 x 10(3) copies per reaction, the average Ct values were 17.55,20.93,24.32, 27.59, 30.95, and the CV values were 1.31%, 1.53%, 0.90%, 1.85% and 0.90% respectively. In the evaluation of the reproducibility, the mean interassay CV was 1.27% and no unspecific amplification was observed. The real-time PCR assay could quantitatively detect as low as 6.15 pg S. japonicum genome in the study(Ct < or = 30.95), and the detection should be done in 3 hours. CONCLUSION: A fluorescent quantitative real-time PCR for the detection of S. japonicum is developed, which is rapid, sensitive and specific for pathogen detection.

[Relationship between hepatitis B virus in gastric mucosa and syndrome of disharmony between liver and stomach in patients with chronic hepatitis B].

OBJECTIVE: To study the relationship between the infection of hepatitis B virus (HBV) in gastric mucosa and the syndrome of disharmony between liver and stomach. METHODS: Subjects were divided into 2 groups: 30 patients with chronic hepatitis B (CHB) and the syndrome of disharmony between liver and stomach in hepatitis group, and 30 patients with chronic gastritis and the syndrome of disharmony between liver and stomach in gastritis group. Liver function and the markers of HBV were detected. The contents of HBV-DNA in serum and in gastric mucosa were assayed respectively by fluorescence quantitative polymerase chain reaction (FQ-PCR). RESULTS: (1) The incidence of gastric mucosal lesion in hepatitis group was up to 96.7% (29/30). (2) Scores of the syndrome of disharmony between liver and stomach in hepatitis group were significantly lower than those in gastritis group (P<0.05). The positive rates of HBV-DNA in serum, gastric fundus, body and antrum were 56.7%, 76.7%, 76.7% and 70.0%, respectively. (3) A positive correlation was found not only among the content of HBV-DNA in serum and the contents of HBV-DNA in gastric mucosa (r=0.66-0.94, P<0.01), but also among the contents of HBV-DNA in serum, gastric mucosa and the total score of the syndrome of disharmony between liver and stomach in hepatitis group (r=0.36-0.52, P<0.05). CONCLUSION: The infection of HBV is involved in the syndrome of disharmony between liver and stomach. Gastric mucosal lesion is universal in CHB patients with the syndrome of disharmony between liver and stomach.