Anti-neurofascin-155 antibody mediated a distinct phenotype of chronic inflammatory demyelinating polyradiculoneuropathy.

BACKGROUND: To investigate Ranvier's autoantibodies prevalence and isotypes in various peripheral neuropathy variants, compare clinical features between seronegative and seropositive patients, and elucidate immune mechanisms underlying antibody generation. METHODS: Antibodies against anti-neurofascin-155 (NF155), NF186, contactin-1 (CNTN1), CNTN2, contactin-associated protein 1 (CASPR1), and CASPR2 were identified through cell-based assays. Plasma cytokines were analyzed in anti-NF155 antibody-positive chronic inflammatory demyelinating polyneuropathy (NF155+ CIDP) and Ranvier's antibodies-negative CIDP (Ab- CIDP) patients using a multiplexed fluorescent immunoassay, validated in vitro in a cell culture model. RESULTS: In 368 plasma samples, 50 Ranvier's autoantibodies were found in 45 individuals, primarily in CIDP cases (25 out of 69 patients) and in 10 out of 122 Guillain-Barré syndrome patients. Anti-NF155 and CNTN1-IgG were exclusive to CIDP. Fourteen samples were NF155-IgG, primarily IgG4 subclass, linked to CIDP features including early onset, tremor, sensory disturbance, elevated CSF protein, prolonged motor latency, conduction block, and poor treatment response. NF155-IgG had low sensitivity (20.28%) but high specificity (100%) for CIDP, rising to 88.88% with tremor and prolonged motor latency. Cytokine profiling in NF155+ CIDP revealed distinct immune responses involving helper T cells, toll-like receptor pathways. Some NF155+ CIDP patients had circulating NF155-specific B cells producing NF155-IgG without antigen presence, suggesting therapeutic potential. CONCLUSION: The study emphasizes the high specificity and sensitivity of NF155-IgG for diagnosing CIDP characterized by distinctive features. Further investigation into circulating NF155-specific B cell phenotypes may pave the way for B cell directed therapy.

Anti-ganglioside Antibodies in Guillain-Barre Syndrome: A Novel Immunoblotting-Panel Assay.

Objective: This study aimed to determine the diagnostic efficiency of a novel immunoblotting detection assay for anti-ganglioside antibodies (AGAs) in the Guillain-Barre syndrome (GBS). Method: Serum immunoglobulin (IgG and IgM) of AGAs were measured in 121 participants from a registered cohort study of immune-mediated neuropathies and 29 healthy controls by immunoblotting panel assay. Sensitivity, specificity, and positive predictive value (PPV) of the assay were compared to calculate the diagnostic accuracy. Result: In our cohort, any of the AGAs were positive in 42.4% of the GBS patients. The sensitivity and specificity of AGAs (both IgG and IgM) in the diagnosis of GSB were 42 and 76% while for IgG-AGAs were 35 and 87%. AGAs positivity had a significant association with the AMAN subtype (P = 0.0004), and the sensitivity, specificity of AGAs in AMAN were 86, 69%, respectively with high (AUC = 0.78, p = 0.002) discriminative powers. GM1-IgG AGA was more common and specific to AMAN patients than other GBS forms (p = 0.008). Conclusion: Our novel immunoblotting detection assay could complement GBS diagnosis. IgG-AGAs were more likely to be detected in GBS, and GM1-IgG AGA could assist AMAN diagnosis.

Imaging detection of cerebral artery fenestrations and their clinical correlation with cerebrovascular diseases.

OBJECTIVES: Cerebral artery fenestrations detected incidentally during computed tomographic angiography (CTA) or magnetic resonance angiography (MRA) are reported to be associated with aneurysmal dilatation, which may cause cerebrovascular diseases, arteriovenous malformations, or, rarely, ischemic symptoms. METHODS: We retrospectively analyzed CTA and MRA of patients with cerebral artery fenestration examined between January 2014 and December 2017. The location, shape, and other associated vascular diseases were described. RESULTS: Two hundred eleven cerebral artery fenestrations were found in 208 patients for a detection rate of 1.13% (208/18,360). Basilar artery fenestrations were most common, accounting for 50.2% (106/211). The fenestration was <5 mm in 115 patients (54.5%), 5-10 mm in 63 (29.9%), and ≥10 mm in 33 (15.6%). Forty-one patients had other vascular malformations, including 29 aneurysms. Except for one aneurysm, which was at the site of the fenestration, all other aneurysms were separate from the fenestrations. 26 patients had cerebral infarctions; among them, 11 had cerebral infarctions in the blood supply area of the arterial fenestration. CONCLUSIONS: Cerebral artery fenestration is an uncommon finding at cerebral imaging, but mostly affects the basilar artery. Cerebral artery fenestrations could be associated with cerebrovascular diseases and malformations, but the present study could not evaluate the cause-to-effect relationship.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Basilar artery fenestration: an unusual possible cause of ischaemic stroke?

Basilar artery fenestration is an uncommon congenital dysplasia and may be associated with ischaemic stroke. We present a case of a previously healthy 36-year-old man who presented with vertigo and vomiting. MRI showed posterior circulation territory infarction. High-resolution magnetic resonance angiography revealed a slit-like fenestration in the basilar artery. This patient had no traditional vascular risk factors or aetiology of cryptogenic stroke. The patient recovered from his neurological deficit after antiplatelet therapy and was given prophylactic aspirin therapy. There was no recurrence of symptoms after 12 months of follow-up.

MicroRNAs Correlate with Multiple Sclerosis and Neuromyelitis Optica Spectrum Disorder in a Chinese Population.

BACKGROUND Recent studies identified a set of differentially expressed miRNAs in whole blood that may discriminate neuromyelitis optica spectrum disorders (NMOSD) from relapsing-remitting multiple sclerosis (RRMS). This study invalidated 9 known miRNAs in Chinese patients. MATERIAL AND METHODS The levels of miRNAs in whole blood were assayed in healthy controls (n=20) and patients with NMOSD (n=45), RRMS (n=17) by quantitative real-time polymerase chain reaction (qRT-PCR), and pairwise-compared between groups. They were further analyzed for association with clinical features and MRI findings of the diseases. RESULTS Compared with healthy controls, miR-22b-5p, miR-30b-5p and miR-126-5p were down-regulated in NMOSD, in contrast, both miR-101-5p and miR-126-5p were up-regulated in RRMS. Moreover, the levels of miR-101-5p, miR-126-5p and miR-660-5p, were significantly higher in RRMS than in NMOSD (P=0.04, 0.01 and 0.02, respectively). The level of miR-576-5p was significantly higher in patients underwent relapse for ≤3 times than those for ≥4 times. In addition, its level was significantly higher in patients suffered from a severe visual impairment (visual sight ≤0.1). Moreover, the levels of each of the 9 miRNAs were lower in NMOSD patients with intracranial lesions (NMOSD-IC) than those without (NMOSD-non-IC). Despite correlations of miRNAs with these disease subtypes, all AUCs of ROC generated to discriminate patients and controls, as well as intracranial lesions, were <0.8. CONCLUSIONS Certain miRNAs are associated with RRMS and NMOSD. They are also related to the clinical features, especially intracranial lesions of NMOSD. However, none of the miRNAs alone or in combination was powerful to ensure the diagnosis and differentiation of the 2 disease subtypes.

Clinical manifestations and spinal cord magnetic resonance imaging findings in Chinese neuromyelitis optica patients.

Neuromyelitis optica (NMO) is a disease distinct from multiple sclerosis in terms of clinical and magnetic resonance imaging (MRI) manifestations. Antibody to aquaporin-4 (AQP4) has been identified as a specific biomarker and part of the diagnostic criteria for NMO. Although it is relatively common in Asia, a comprehensive clinical and imaging evaluation of NMO has not been reported in Chinese patients. Here, we reviewed data from 57 Chinese cases. The patients had an obvious female preponderance (female/male = 8.5:1), and transverse myelitis (82.5%) and optic neuritis (56.1%) were the most common manifestations. In MRI, longitudinally extensive transverse myelitis (6.9 ± 2.3 segments) dominated the spinal cord lesions, which were mainly (69.7%) distributed in cervical and thoracic cord. However, the length of the lesions was not correlated with onset age, paralysis severity, relapse rate, or duration. Among 29 patients who underwent AQP4 antibody assay, 17 (58.6%) were positive. There was no difference between seropositive and seronegative patients in terms of female preponderance, onset age, relapse rate, and Expanded Disability Status Scale score. However, seropositive patients had significantly more damaged segments (8.3 ± 3.5) than did seronegative patients (4.5 ± 1.6) (p < 0.001). The data revealed the clinical and MRI characteristics and AQP4 antibody status of NMO in Chinese patients and the correlations between them, which may have important implications for the diagnosis of the disease.

Regional gray matter atrophy and neuropsychologcal problems in relapsing-remitting multiple sclerosis.

In multiple sclerosis, gray matter atrophy is extensive, and cognitive deficits and mood disorders are frequently encountered. It has been conjectured that focal atrophy is associated with emotional decline. However, conventional MRI has revealed that the pathological characteristics cannot fully account for the mood disorders. Moreover, there is no correlation between cognitive disorders and MRI results in clinically isolated syndromes or in cases of definite multiple sclerosis. In this case-control study, voxel-based morphometric analysis was performed on 11 subjects with relapsing-remitting multiple sclerosis, and the results show that these patients exhibit gray matter atrophy. Moreover, the gray matter atrophy in the superior and middle gyri of the right frontal lobe in patients with multiple sclerosis was correlated with scores from the Hamilton Anxiety Rating Scale. The scores obtained with the Repeatable Battery for the Assessment of Neuropsychological Status were associated with gray matter atrophy in the middle gyrus of the left frontal lobe, the superior and middle gyrus of the right frontal lobe, the middle gyrus of the left cingulate, the superior and middle gyri of the left frontal lobe, and the triangular area of the left frontal lobe. However, there was no statistical significance. These findings suggest that the cingulate and frontal cortices of the nant hemisphere are the most severely atrophic regions of the brain, and this atrophy is correlated with cognitive decline and emotional abnormalities.