ABSTRACT
Esophagotracheal fistula (ETF), one of the most serious complications in the treatment of esophageal cancer, presents a complex management challenge. Early diagnosis and treatment are crucial to alleviate clinical symptoms and improve the quality of life of patients with ETF. The most commonly used method for treating ETF is esophageal stenting. However, because of the variable location and size of the fistula, stent placement alone sometimes fails to completely close the fistula, and complications such as fracture and displacement of the esophageal stent may occur. Therefore, safer and more effective methods for the treatment of ETF are required. In recent years, the application of bioactive factors to promote human tissue repair and wound healing has increased and achieved good therapeutic results. We herein describe a case in which we performed endoscopic injection of platelet-rich plasma directly into the ETF site and achieved a favorable outcome. This case suggests that local injection of platelet-rich plasma is a novel treatment modality for ETF.
Subject(s)
Esophageal Neoplasms , Platelet-Rich Plasma , Tracheoesophageal Fistula , Humans , Tracheoesophageal Fistula/complications , Tracheoesophageal Fistula/therapy , Treatment Outcome , Quality of Life , Esophageal Neoplasms/complicationsABSTRACT
In recent years, the oral administration of vinorelbine has gradually replaced intravenous administration in the treatment of several types of tumors. Even though the risk of phlebitis is avoided with oral administration, oral vinorelbine is still not a highly patient-compliant route due to the severe gastrointestinal toxicity. Vinorelbine-loaded liposomes with high encapsulation efficiency and suitable particle size were prepared using the ammonium sulfate gradient method. Chitosan-coated liposomes showed the slowest in vitro release compared to uncoated liposomes and vinorelbine solution. No damage was observed in the intestinal epithelial cells of mice orally administered with coated vinorelbine liposomes due to the low presence of the free drug in the gastrointestinal tract and the LD50 was increased from 129.83 to 182.25 mg/kg compared to oral vinorelbine solution. In addition, the positive surface potential of chitosan-coating endowed liposomes with mucosal adhesive function, delaying the time to reach the peak plasma concentration of vinorelbine from 1 to 4 h after administration. And bioavailability was increased to 2.1-fold compared to vinorelbine solution. In short, a new strategy to address the severe gastrointestinal side effects of oral vinorelbine has been developed.
Subject(s)
Chitosan , Liposomes , Administration, Oral , Animals , Biological Availability , Mice , VinorelbineABSTRACT
BACKGROUND: This study investigates the effect of dexmedetomidine (DEX), a highly selective agonist of alpha 2-adrenergic receptors (α2-ARs), on the regulation of hepatic macrophage activation in liver regeneration. METHODS: A two-thirds partial hepatectomy (PHx) mouse model was performed. DEX (25 µg/kg) or a vehicle control (saline) was injected i.p. at 30 min before and every 12 h after PHx. The expression of α2B-ARs in the liver was detected using immunofluorescence staining. The effects of DEX on liver regeneration were assessed by Ki67 staining. The gene expression of inflammatory cytokines in isolated hepatic macrophages was quantified 36 h after the PHx. RESULTS: α2B-ARs colocalized with hepatic macrophages after the PHx. The number of Ki67-positive hepatocytes in the mice treated with DEX was markedly increased (p < 0.05). The increases in Ki67-positive hepatocytes after treatment with DEX were inhibited in the macrophage-depleted mice. DEX treatment inhibited the expression of major pro-inflammatory cytokines interleukin (IL)-1ß, IL-6, and tumor necrosis factor and elevated the expression of anti-inflammatory cytokines IL-4, IL-10, and transforming growth factor-ß1 in hepatic macrophages 36 h after the PHx (p < 0.05). CONCLUSIONS: The α2B-AR subtype is expressed in hepatic macrophages after a PHx. DEX modulates hepatic macrophage activation toward an anti-inflammatory phenotype via α2B-AR, which promotes the process of liver regeneration.
Subject(s)
Dexmedetomidine , Liver Regeneration , Animals , Anti-Inflammatory Agents , Cytokines/metabolism , Dexmedetomidine/metabolism , Dexmedetomidine/pharmacology , Dexmedetomidine/therapeutic use , Hepatectomy , Ki-67 Antigen/metabolism , Liver/metabolism , Liver Regeneration/physiology , Macrophage Activation , MiceABSTRACT
Objective@#To understand the current situation and associated factors of cellphone usage and addiction among Chinese children and adolescents, to provide reference for effective prevention and intervention of cellphone addiction.@*Methods@#Using a stratified random sampling approach, 11 213 children and adolescents and their parents from 31 provinces, municipalities and autonomous regions in China were recruited and surveyed.@*Results@#The median of daily mobile phone use time among Chinese children and adolescents were 120.00 minutes, as reported by either children or parents. Child s age( β =0.12), hedonic( β =0.11) and social( β =0.09) cellphone use motivations positively related to time spent on cellphone( P <0.01). Cellphone related parental communication( β =-0.06) and knowledge( β =-0.03), as well as cellphone usage on instrumental( β =-0.04) or self representation( β =-0.16) motivation negatively related to time spent on cellphone( P <0.05). Child s age( β =-0.04), cellphone related parental communication( β =-0.09) and awareness( β =-0.14), cellphone use on instrumental motivation( β =-0.22) were negatively associated with cellphone addiction among children and adolescents( P <0.05). Cellphone related parental monitoring( β =0.07), as well as cellphone usage on self representation motivation( β =0.03) or hedonic motivation( β =0.29) positively related to cellphone addiction in children and adolescents( P <0.05).@*Conclusion@#Time spent on mobile phone and mobile phone addiction of Chinese children and adolescents are influenced by various internal and external factors, such as the mobile phone use motivation and parenting style.Future school education should help children develop scientific motivation for mobile phone use. Family education should help parents develop positive parenting behaviors such as communication and awareness, so as to reduce the possibility of improper mobile phone use.
ABSTRACT
PURPOSE: Currently, there is no favorable treatment plan for inflammatory pain, so exploring new analgesics is still a research hotspot in this area. Cyclin-dependent protein kinase 5 (Cdk5) is a pain-related protein kinase, but its mechanism in inflammatory pain has not been clarified. This research aimed to explore the mechanism of Cdk5-synaptophysin (Syn)-soluble N-ethylmaleimide-sensitivity factor (NSF) attachment protein receptor (SNARE) in acute and chronic inflammatory pain. METHODS: Rat models of acute and chronic inflammatory pain were induced by formalin and complete Freund's adjuvant (CFA), separately, and some rats injected with normal saline through intraplantar injection were divided into a control group. Thirty minutes before modeling, rats were given Cdk5 inhibitor (Roscovitine, Ros), SNARE scavenger (botulinum toxin A, BTTA), glutamate receptor inhibitor (MK801), and dimethyl sulfoxide (DMSO) through spinal canals, and the paw withdrawal threshold (PWT) and thermal withdrawal latency (PWL) at difference time points were compared. RESULTS: Compared with rats in the control group, those in the rat models of acute and chronic inflammatory pain showed lower PWT and PWL, higher Cdk5 enzyme level, tight correlation of Cdk5 with Syn, SNARE, p25 proteins, and higher levels of Cdk5, Syn and SNARE. And the above situation was dramatically reversed under intervention of Ros, BTTA and MK801. CONCLUSION: Cdk5-Syn-SNARE pathway is a therapeutic target for inflammatory pain. Blocking the activation of this pathway is beneficial to exert analgesic effect.
ABSTRACT
Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.