Phylogenetic relationships among algae based on complete large-subunit rRNA sequences.

The complete or nearly complete large-subunit rRNA (LSU rRNA) sequences were determined for representatives of several algal groups such as the chlorarachniophytes, cryptomonads, haptophytes, bacillariophytes, dictyochophytes and pelagophytes. Our aim was to study the phylogenetic position and relationships of the different groups of algae, and in particular to study the relationships among the different classes of heterokont algae. In LSU rRNA phylogenies, the chlorarachniophytes, cryptomonads and haptophytes seem to form independent evolutionary lineages, for which a specific relationship with any of the other eukaryotic taxa cannot be demonstrated. This is in accordance with phylogenies inferred on the basis of the small-subunit rRNA (SSU rRNA). Regarding the heterokont algae, which form a well-supported monophyletic lineage on the basis of LSU rRNA, resolution between the different classes could be improved by combining the SSU and LSU rRNA data. Based on a concatenated alignment of both molecules, the phaeophytes and the xanthophytes are sister taxa, as well as the pelagophytes and the dictyochophytes, and the chrysophytes and the eustigmatophytes. All these sister group relationships are highly supported by bootstrap analysis and by different methods of tree construction.

Pelistega europaea gen. nov., sp. nov., a bacterium associated with respiratory disease in pigeons: taxonomic structure and phylogenetic allocation.

Twenty-four strains isolated mainly from infected respiratory tracts of pigeons were characterized by an integrated genotypic and phenotypic approach. An extensive biochemical examination using conventional tests and several API microtest systems indicated that all isolates formed a phenotypically homogeneous taxon with a DNA G + C content between 42 and 43 mol%. Whole-cell protein and fatty acid analysis revealed an unexpected heterogeneity which was confirmed by DNA-DNA hybridizations. Four main genotypic sub-groups (genomovars) were delineated. 16S rDNA sequence analysis of a representative strain indicated that this taxon belongs to the beta-subclass of the Proteobacteria with Taylorella equigenitalis as its closest neighbour (about 94.8% similarity). A comparison of phenotypic and genotypic characteristics of both taxa suggested that the pigeon isolates represented a novel genus for which the name Pelistega is proposed. In the absence of differential phenotypic characteristics between the genomovars, it was preferred to include all of the isolates into a single species, Pelistega europaea, and strain LMG 10982 was selected as the type strain. The latter strain belongs to fatty acid cluster I and protein electrophoretic sub-group 1, which comprise 13 and 5 isolates, respectively. It is not unlikely that the name P. europaea will be restricted in the future to organisms belonging to fatty acid cluster I, or even to protein electrophoretic sub-group 1, upon discovery of differential diagnostic features.

16S rRNA gene sequence analyses and inter- and intrageneric relationships of Xanthomonas species and Stenotrophomonas maltophilia.

The nearly complete, PCR-amplified, 16S rRNA gene sequences have been determined from the representative type strains of eight xanthomonad phena, including six validly described species of the genus Xanthomonas and Stenotrophomonas maltophilia. Pairwise sequence comparisons and phylogenetic analysis demonstrated that the xanthomonads comprise a monophyletic lineage-within the gamma-subclass of the Proteobacteria. Although the genus Xanthomonas was observed to comprise a cluster of very closely related species, the observed species-specific primary sequence differences were confirmed through sequencing additional strains belonging to the respective species.

Coniosporium perforans and C. apollinis, two new rock-inhabiting fungi isolated from marble in the Sanctuary of Delos (Cyclades, Greece).

Coniosporium perforans and C. apollinis, originating from marble in the Mediterranean basin, are described as new species of rock inhabiting microcolonial fungi. The morphologically similar species Monodictys castaneae (Wallr.) S. Hughes, Phaeosclera dematioides Sigler et al., and a Coniosporium-like strain are compared using 18S rDNA phylogeny and Restriction Length Fragment Polymorphism analysis of Internal Transcribed Spacer regions. Sarcinomyces crustaceus Lindner is additionally compared on the basis of 18S rDNA sequencing data. Phylogenetic analysis suggests that Phaeosclera dematioides is related to the ascomycetous order Dothideales and Monodictys castaneae to the Pleosporales, whereas the three Coniosporium species studied are a sister group to the Herpotrichiellaceae (Chaetothyriales). A similar affinity was suggested previously for the recently described meristematic rock-fungus Sarcinomyces petricola Wollenzien & de Hoog. Sarcinomyces crustaceus appears unrelated to this group, and hence the present new taxa cannot be described in this genus.

RP4::Mu3A-mediated in vivo cloning and transfer of a chlorobiphenyl catabolic pathway.

Chromosomal DNA fragments encoding the ability to utilize biphenyl as sole carbon source (Bph+) were mobilized by means of plasmid RP4::Mu3A from strain JB1 (tentatively identified as Burkholderia sp.) to Alcaligenes eutrophus CH34 at a frequency of 10(-3) per transferred plasmid. The mobilized DNA integrated into the recipient chromosome or was recovered as catabolic prime plasmids. Three Bph+ prime plasmids were transferred from A. eutrophus to Escherichia coli and back to A. eutrophus without modification of the phenotype. The transferred Bph+ DNA segments allowed metabolism of biphenyl, 2-, 3- and 4-chlorobiphenyl, and diphenylmethane. Genes involved in biphenyl degradation were identified on the prime plasmids by DNA-DNA hybridization and by gene cloning. Bph+ prime plasmids were transferred to Burkholderia cepacia, Pseudomonas aeruginosa, Comamonas testosteroni and A. eutrophus and the catabolic genes were expressed in those hosts. Transfer of the plasmid to the 3-chlorobenzoate-degrading bacterium Pseudomonas sp. B13 allowed the recipient to mineralize 3-chlorobiphenyl. Other catabolic prime plasmids were obtained from JB1 by selection on m-hydroxybenzoate and tyrosine as carbon sources. 16S rRNA sequence data demonstrated that the in vivo transfer of bph was achieved between bacteria belonging to two different branches of the beta-Proteobacteria.

Phylogenetic relationships of nonaxenic filamentous cyanobacterial strains based on 16S rRNA sequence analysis.

In order to determine the nearly complete 16S rRNA gene sequences of cyanobacteria originating from nonaxenic cultures, a cyanobacterium-specific oligonucleotide probe was developed to distinguish polymerase chain reaction (PCR) products of the cyanobacterial rRNA operons from those resulting from amplification of contaminating bacteria. Using this screening method the 16S rRNA genes of four nonaxenic filamentous cyanobacterial strains belonging to the genera Leptolyngbya and Oscillatoria were cloned and sequenced. For the genus Leptolyngbya, the 16S rRNA sequence of the axenic strain PCC 73110 was also determined. Phylogenetic trees were constructed based on complete and partial sequences. The results show that the strains Leptolyngbya foveolarum Komárek 1964/112, Leptolyngbya sp. VRUC 135 Albertano 1985/1, and Leptolyngbya boryanum PCC 73110 belong to the same cluster. Strain Oscillatoria cf. corallinae SAG 8.92, which contains the rare photosynthetic pigment CU-phycoerythrin, is not closely related to other CU-phycoerythrin-containing cyanobacteria. Oscillatoria agardhii CYA 18, which is a representative of planktonic Oscillatoria species that form toxic blooms in Norwegian inland waters, has no close relatives in the tree.

The phylogeny of the Hyphochytriomycota as deduced from ribosomal RNA sequences of Hyphochytrium catenoides.

Based on biochemical and ultrastructural data, hyphochytriomycetes are believed to share an ancestor with oomycetes and heterokont algae. In order to study the phylogeny of the hyphochytriomycetes, we determined both the small- and large-subunit ribosomal RNA sequence of Hyphochytrium catenoides. Phylogenetic trees were constructed using the neighbor-joining and maximum-parsimony method and include representatives of Chlorobionta, Fungi, Metazoa, Alveolata, and all known Heterokonta. Our main conclusion is that the hyphochytriomycetes form a monophyletic group with the oomycetes and heterokont algae and that they are probably the closest relatives of the oomycetes. However, the order of divergence between the various heterokont algal phyla and the oomycete-hyphochytriomycete cluster remains uncertain.

The evolutionary position of the rhodophyte Porphyra umbilicalis and the basidiomycete Leucosporidium scottii among other eukaryotes as deduced from complete sequences of small ribosomal subunit RNA.

The complete small ribosomal subunit RNA (srRNA) sequence was determined for the red alga Porphyra umbilicalis and the basidiomycete Leucosporidium scottii, representing two taxa for which no srRNA sequences were hitherto known. These sequences were aligned with other published complete srRNA sequences of 58 eukaryotes. Evolutionary trees were reconstructed by a matrix optimization method from a dissimilarity matrix based on sections of the alignment that correspond to structurally conservative areas of the molecule that can be aligned unambiguously. The overall topology of the eukaryotic tree thus constructed is as follows: first there is a succession of early diverging branches, leading to a diplomonad, a microsporidian, a euglenoid plus kinetoplastids, an amoeba, and slime molds. Later, a nearly simultaneous radiation seems to occur into a number of taxa comprising the metazoa, the red alga, the sporozoa, the higher fungi, the ciliates, the green plants, plus some other less numerous groups. Because the red alga diverges late in the evolutionary tree, it does not seem to represent a very primitive organism as proposed on the basis of morphological and 5S rRNA sequence data. Asco- and basidiomycetes do not share a common ancestor in our tree as is generally accepted on the basis of conventional criteria. In contrast, when all alignment positions, rather than the more conservative ones, are used to construct the evolutionary tree, higher fungi do form a monophyletic cluster. The hypothesis that higher fungi and red algae might have shared a common origin has been put forward. Although the red alga and fungi seem to diverge at nearly the same time, no such relationship can be detected. The newly determined sequences can be fitted into a secondary structure model for srRNA, which is now relatively well established with the exception of uncertainties in a number of eukaryote-specific expansion areas. A specific structural model featuring a pseudoknot is proposed for one of these areas.

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general.

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Primary and secondary structure of the 18 S ribosomal RNA of the insect species Tenebrio molitor.

The sequence of the 18 S rRNA of Tenebrio molitor is reported. A detailed secondary structure model for eukaryotic small subunit rRNAs is proposed. The model comprises 48 universal helices that eukaryotic and prokaryotic small subunit rRNAs have in common, plus a number of helices in areas of variable secondary structure. For the central area of the model, an alternative structure is possible, applicable only to eukaryotic small subunit rRNAs. Possibly, small subunit rRNA switched to this alternative conformation after the eukaryotic branch had been established in evolution. Another possibility is that the two conformers represent a dynamic structural switch functioning during the translational activity of the eukaryotic ribosome.

The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria.

The 5S ribosomal RNA sequences have been determined for the rhodoplast of the red alga Porphyra umbilicalis and the chloroplast of the conifer Juniperus media. The 5S RNA sequence of the Vicia faba chloroplast is corrected with respect to a previous report. A survey of the known sequences and secondary structures of 5S RNAs from plastids and cyanobacteria shows a close structural similarity between all 5S RNAs from land plant chloroplasts. The algal plastid 5S RNAs on the other hand show much more structural diversity and have certain structural features in common with bacterial 5S RNAs. A dendrogram constructed from the aligned sequences by a clustering algorithm points to a common ancestor for the present-living cyanobacteria and the land plant plastids. However, the algal plastids branch off at an early stage within the plastid-cyanobacteria cluster, before the divergence between cyanobacteria and land plant chloroplasts. This evolutionary picture points to the occurrence of multiple endosymbiotic events, with the ancestors of the present algal plastids already established as photosynthetic endosymbionts at a time when the ancestors of the present land plant chloroplasts were still free-living cells.

Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria.

The primary structure of 5S ribosomal RNA has been determined in five species belonging to the genus Mycobacterium and in Micrococcus luteus. The sequences of 5S RNAs from Actinomycetes and relatives point to the existence in this taxon of a bulge on the helix that joins the termini of the molecule. An attempt was made to reconstruct bacterial evolution from a sequence dissimilarity matrix based on 142 eubacterial 5S RNA sequences and corrected for multiple mutation. The algorithm is based on weighted pairwise clustering, and incorporates a correction for divergent mutation rates, as derived by comparison of sequence dissimilarities with an external reference group of eukaryotic 5S RNAs. The resulting tree is compared with the eubacterial phylogeny built on 16S rRNA catalog comparison. The bacteria for which the 5S RNA sequence is known form a number of clusters also discernible in the 16S rRNA phylogeny. However, the branching pattern leading to these clusters shows some notable discrepancies with the aforementioned phylogeny.

Nucleotide sequence, secondary structure and evolution of the 5S ribosomal RNA from five bacterial species.

The nucleotide sequences of the 5S ribosomal RNAs of the bacteria Agrobacterium tumefaciens, Alcaligenes faecalis, Pseudomonas cepacia, Aquaspirillum serpens and Acinetobacter calcoaceticus have been determined. The sequences fit in a generally accepted model for 5S RNA secondary structure. However, a closer comparative examination of these and other bacterial 5S RNA primary structures reveals the potential of additional base pairing and of multiple equilibria between a set of slightly different alternative secondary structures in one area of the molecule. The phylogenetic position of the examined bacteria is derived from a 5S RNA sequence alignment by a clustering method and compared with the position derived on the basis of 16S ribosomal RNA oligonucleotide catalogs.

Sequences of three molluscan 5 S ribosomal RNAs confirm the validity of a dynamic secondary structure model.

The collection of known 5 S rRNA primary structures is enriched with the sequences from three mollusca, the snails Helix pomatia and Arion rufus, and the mussel Mytilus edulis. The three sequences can be fitted in a five-helix secondary structure model previously shown (De Wachter et al. (1982) Biochimie 64, 311-329) to apply to all 5 S RNAs regardless of their origin. One of the helices in this model can undergo a bulge-internal loop transition. Within the metazoan kingdom, the dimensions of each helix and loop are rigidly conserved, except for one helix which can comprise either 6 or 7 base pairs.

The sequence of 5S ribosomal RNA of the crustacean Artemia salina.

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).