ABSTRACT
Differences in the features of aggressiveness of non-melanoma skin cancer (NMSC) subtypes, between basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are relevant characteristics. Comparing the characteristics between NMSC subtypes might help identify molecules associated with cancer metastasis and invasion. Considering these facts, the current study aimed to identify a molecular target for inhibiting skin cancer metastasis and invasion. Proteomic analysis suggested that heat shock protein 90 kDa, alpha, class B member 1 (HSP90AB1), pentaxin (PTX3), caspase-14 (CASP14), S100, actin-1, and profilin were the primary targets related to metastasis and invasion. However, after a differential expression comparison between BCC and SCC, HSP90AB1 was identified as the best target to repress metastasis and invasion. Based on molecular docking results, gallic acid (GA) was selected to inhibit HSP90AB1. A specific Hsp90ab1 siRNA targeting was designed and compared to GA. Interestingly, GA was more efficient in silencing HSP90AB1 than siRNAhsp90ab1. Hence, our data suggest that HSP90AB1 is a crucial biomarker for identifying invasion and metastasis and that its inhibition may be a viable strategy for treating skin cancer.
Subject(s)
Carcinoma, Basal Cell , Carcinoma, Squamous Cell , Skin Neoplasms , Humans , Heat-Shock Proteins , Gallic Acid/pharmacology , Proteomics , Molecular Docking Simulation , Carcinoma, Basal Cell/metabolism , Carcinoma, Squamous Cell/pathology , Skin Neoplasms/drug therapy , Skin Neoplasms/genetics , Skin Neoplasms/metabolism , HSP90 Heat-Shock Proteins/geneticsABSTRACT
OBJECTIVE: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival. MATERIALS AND METHODS: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC. RESULTS: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors. CONCLUSION: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival.
Subject(s)
Carcinoma, Squamous Cell , Head and Neck Neoplasms , Mouth Neoplasms , Humans , Squamous Cell Carcinoma of Head and Neck/genetics , Carcinoma, Squamous Cell/pathology , Transcriptome , Mouth Neoplasms/metabolism , Gene Expression Regulation, Neoplastic , Survival Analysis , Biomarkers, Tumor/genetics , Head and Neck Neoplasms/genetics , PrognosisABSTRACT
Radiation therapy for head and neck squamous cell carcinoma (HNSCC) is associated with several complications. Although photobiomodulation (PBM) has radioprotective effects in normal tissue, it could also enhance the growth of neoplastic cells. Thus, the present study aimed to investigate the cellular response of oral squamous cell carcinoma with pre-exposure to low-level phototherapy before radiotherapy. SCC9, Cal-27, A431, and HaCaT cell lines were subjected to low-level light therapy and radiotherapy. The cells were treated with a single energy density (300 J/cm2) of a light-emitting diode (660 nm) prior to ionizing radiation at different doses (0, 2, 4, and 6 Gy). After 24 h, wound scratch, proliferation, clonogenic cell survival, cell death, and reactive oxygen species (ROS) analyses were performed to evaluate cell response. The cell lines pre-exposed to PBM at the analyzed dosage were radiosensitive. The treatment significantly reduced cell proliferation and clonogenic cell survival. Migration and cell death assays also revealed positive results, with the treatment group showing lower rate of migration and higher cell death than did the control group. Moreover, PBM effectively increased the intracellular levels of ROS. PBM at 300 J/cm2 is a promising radiosensitizing modality to reduce the radiation dose and avoid the intolerable side effects of radiotherapy for HNSCC, thus increasing the probability of successful treatment. However, further studies are needed to support and confirm the results.
Subject(s)
Carcinoma, Squamous Cell , Head and Neck Neoplasms , Low-Level Light Therapy , Mouth Neoplasms , Humans , Squamous Cell Carcinoma of Head and Neck/radiotherapy , Squamous Cell Carcinoma of Head and Neck/etiology , Mouth Neoplasms/radiotherapy , Mouth Neoplasms/pathology , Carcinoma, Squamous Cell/radiotherapy , Carcinoma, Squamous Cell/pathology , Low-Level Light Therapy/methods , Reactive Oxygen Species , Head and Neck Neoplasms/radiotherapyABSTRACT
COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® â« blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
Subject(s)
COVID-19/genetics , RNA, Antisense/genetics , SARS-CoV-2/genetics , Algorithms , COVID-19/virology , Computer Simulation , Gene Expression Regulation, Viral , HumansABSTRACT
Cancer patients present a higher risk of experiencing anxiety disorders (AD). However, it is not clear if AD might be associated with cancer development. Thus, our study aimed to evaluate if AD might be related to head and neck squamous cell carcinoma (HNSCC) development. The combination of an applied animal basic study and a retrospective diagnostic case and control study in patients was performed. As a result, we obtained that stress reduced the locomotor activity of the animals in the group stress and stress + 4NqO (p < 0.0001). The stress showed no influence on the progression of neoplasia in mice. In the same way, the case group did not present differences in anxiety scores in comparison to control. Moreover, no association between HNSCC staging and anxiety scores was observed. In conclusion, our in vivo findings in humans and animals have shown that there is no relationship between AD and oral squamous cell carcinoma.
ABSTRACT
Radiation Therapy (RT) is a treatment option for a large number of neoplasias. However, the effect of RT on the level of hypoxia markers is poorly understood. The present study aimed to investigate the effect of RT on the levels of hypoxic markers in Oral squamous cell carcinoma (OSCC). Evaluation of HIF-1α and miR-210 levels in OSCC was performed. Then a proteomic analysis was performed to identify candidate hypoxic targets of RT. To validate proteomic studies, the effect of RT on HIF-1α, miR-210, PDH-A and LDH-A levels under hypoxia was assessed by qRT-PCR. The impact of RT in hypoxia markers was evaluated in patients to confirm in vitro results. An increase in the HIF-1α levels was observed in OSCC. RT reduced OSCC cell proliferation and migration. Interestingly, hypoxia could revert the effect of radiation on OSCC phenotype. However, proteomics analyses suggested that LDH is one of the critical targets of RT even in hypoxia. Moreover, RT decreased HIF-1α, miR-210, and LDH even in hypoxia. The current study demonstrated that hypoxia could revert the effects of RT in the OSCC context. However, RT reduces the levels HIF-1α, miR-210 and LDH in vivo and in vitro. The consequences of RT in blood should be carefully investigated.
Subject(s)
Cell Hypoxia/radiation effects , Hypoxia-Inducible Factor 1, alpha Subunit/radiation effects , L-Lactate Dehydrogenase/radiation effects , MicroRNAs/radiation effects , Radiotherapy/adverse effects , Squamous Cell Carcinoma of Head and Neck/radiotherapy , Adolescent , Adult , Aged , Aged, 80 and over , Female , Humans , Hypoxia-Inducible Factor 1, alpha Subunit/blood , L-Lactate Dehydrogenase/blood , Male , MicroRNAs/blood , Middle Aged , Radiation Tolerance , Young AdultABSTRACT
OBJECTIVE: Malignant salivary gland tumors (MSGTs) present different phenotypic characteristics and various clinical outcomes, which proved to be a diagnostic challenge. Considering the heterogeneity of MSGT, this study aims to identify molecule related to the nature of MSGT. METHODS: For screening, proteomic analysis comparing MSGT with pleomorphic adenoma (PA) and salivary gland was performed. The MSGT-associated protein which presented in the higher number in the Gene Expression Omnibus (GEO) database was selected. To validate the data, immunohistochemistry (IHC) was performed in 14 patients with PA, 22 patients with MSGT, and 14 controls. RESULTS: 16 proteins were associated with MSGT. ANXA2 was the primary protein, according to GEO database analyses. ANXA2 was most expressed in the cell membrane. However, some ANXA2 staining was also observed in the cytoplasm and nucleus. ANXA2 was highly expressed in MSGT in comparison with control. Also, ANXA2 has a higher expression in adenocarcinoma not otherwise specified (ANOS) and myoepithelial carcinoma (MC) in comparison with PA. CONCLUSION: In conclusion, this study demonstrated that MSGT presented higher levels of ANXA2 in comparison with normal salivary glands. Also, ANXA2 might be interesting as a molecular marker of ANOS and MS.
Subject(s)
Adenoma, Pleomorphic/metabolism , Annexin A2/metabolism , Carcinoma, Adenoid Cystic/metabolism , Carcinoma, Mucoepidermoid/metabolism , Salivary Gland Neoplasms/metabolism , Adenoma, Pleomorphic/pathology , Biomarkers, Tumor/metabolism , Carcinoma, Adenoid Cystic/pathology , Carcinoma, Mucoepidermoid/pathology , Case-Control Studies , Humans , Proteome , Proteomics , Salivary Gland Neoplasms/pathologyABSTRACT
BACKGROUND: There is significant controversy in the literature regarding the relationship between hypoxia and salivary gland neoplasms (SGNs). OBJECTIVE: The current study aims to investigate levels of hypoxia markers in both benign and malignant salivary neoplasms. PATIENTS AND METHODS: The current study sample is comprised of a total of 62 samples. HIF-1α expression was evaluated by immunohistochemistry. Additionally, HIF-1α mRNA and miR-210 levels were assessed using qRT-PCR. RESULTS: No differences in HIF-1α expression were observed among the control group, benign and malignant SGNs. Similarly, HIF-1α mRNA levels were similar between benign and malignant SGNs. Also, there was no difference in miR-210 expression between case and control groups. CONCLUSION: The angiogenic markers, miR-210 and HIF-1α, do not appear to distinguish malignancy in salivary glands.
Subject(s)
Biomarkers, Tumor/biosynthesis , Gene Expression Regulation, Neoplastic , Hypoxia-Inducible Factor 1, alpha Subunit/biosynthesis , Neoplasm Proteins/biosynthesis , Neovascularization, Pathologic/metabolism , Salivary Gland Neoplasms , Cross-Sectional Studies , Female , Humans , Male , MicroRNAs/biosynthesis , Neovascularization, Pathologic/pathology , RNA, Neoplasm/biosynthesis , Retrospective Studies , Salivary Gland Neoplasms/blood supply , Salivary Gland Neoplasms/metabolism , Salivary Gland Neoplasms/pathologyABSTRACT
Leptin, one of the main hormones controlling energy homeostasis, has been associated with different cancer types. In oral cancer, its effect is not well understood. We investigated, through in vitro and in vivo assays, whether leptin can affect the neoplastic behavior of oral squamous cell carcinoma. Expression of genes possibly linked to the leptin pathway was assessed in leptin-treated oral squamous cell carcinoma cells and also in tissue samples of oral squamous cell carcinoma and oral mucosa, including leptin, leptin receptor, hypoxia-inducible factor 1-alpha, E-cadherin, matrix metalloproteinase-2, matrix metalloproteinase-9, Col1A1, Ki67, and mir-210. Leptin treatment favored higher rates of cell proliferation and migration, and reduced apoptosis. Accordingly, leptin-treated oral squamous cell carcinoma cells show decreased messenger RNA caspase-3 expression, and increased levels of E-cadherin, Col1A1, matrix metalloproteinase-2, matrix metalloproteinase-9, and mir-210. In tissue samples, hypoxia-inducible factor 1-alpha messenger RNA and protein expression of leptin and leptin receptor were high in oral squamous cell carcinoma cases. Serum leptin levels were increased in first clinical stages of the disease. In animal model, oral squamous cell carcinoma-induced mice show higher leptin receptor expression, and serum leptin level was increased in dysplasia group. Our findings suggest that leptin seems to exert an effect on oral squamous cell carcinoma cells behavior and also on molecular markers related to cell proliferation, migration, and tumor angiogenesis.
Subject(s)
Carcinoma, Squamous Cell/genetics , Hypoxia-Inducible Factor 1, alpha Subunit/biosynthesis , Leptin/genetics , Mouth Neoplasms/genetics , Receptors, Leptin/biosynthesis , Adult , Animals , Apoptosis/genetics , Carcinoma, Squamous Cell/pathology , Cell Hypoxia/genetics , Cell Line, Tumor , Cell Movement/genetics , Cell Proliferation/genetics , Female , Gene Expression Regulation, Neoplastic , Humans , Hypoxia-Inducible Factor 1, alpha Subunit/genetics , Leptin/administration & dosage , Leptin/biosynthesis , Male , Mice , Middle Aged , Mouth Neoplasms/pathology , Neoplasm Invasiveness , Neoplasm Staging , Neovascularization, Pathologic/genetics , Neovascularization, Pathologic/pathology , Receptors, Leptin/genetics , Xenograft Model Antitumor AssaysABSTRACT
INTRODUCTION: Chronic dental periapical lesions result from chronic inflammation of periapical tissues caused by continuous antigenic stimulation from infected root canals. Recent findings have suggested that T helper (Th) 1 and Th2-like cytokines are important in the pathogenesis of chronic periapical inflammatory diseases. However, the mechanisms regulating these immunoinflammatory pathways have not been fully elucidated. Thus, the aim of this study was to evaluate interleukin (IL)-4, IL-12, and interferon γ (IFN-γ) protein levels in human radicular cysts and periapical granulomas. METHODS: Archived samples of cysts (n = 52) and granulomas (n = 27) were sectioned and submitted to immunohistochemistry to evaluate the tissue expression of IL-4, IL-12, and IFN-γ. The data were analyzed using the Mann-Whitney U test (P < .05). RESULTS: An increased expression of IFN-γ was observed in radicular cysts. IL-4 expression was stronger in periapical granulomas than in radicular cysts. IL-12 was not detected in any of the samples. CONCLUSIONS: Our study showed that IFN-γ protein levels are increased in radicular cysts, whereas IL-4 expression is stronger in samples of periapical granulomas. Further studies are necessary to elucidate the signaling pathways mediated by these cytokines and to facilitate the development of more effective periapical disease management strategies.
Subject(s)
Interferon-gamma/metabolism , Interleukin-4/metabolism , Periapical Granuloma/immunology , Radicular Cyst/immunology , Th1-Th2 Balance , Adult , Cross-Sectional Studies , Female , Humans , Interleukin-12/metabolism , Male , Middle Aged , Statistics, Nonparametric , Young AdultABSTRACT
OBJECTIVE: The aim of this study is to assess whether C1772T and G1790A hypoxia-inducible factor-1 (HIF-1)α polymorphisms are associated with risk of oral lichen planus (OLP). MATERIAL AND METHODS: Restriction fragment length polymorphism analysis was used to investigate HIF-1α C1779T and G1790A polymorphisms in 32 OLP and 88 individuals without OLP. RESULTS: The frequency of the CC, TT, GA, and AA genotypes was higher in patients with OLP. Notably, individuals carrying the C and A, and T and A haplotypes showed a significant association OLP risk. CONCLUSIONS: Our study demonstrated that the C1772T and G1790A polymorphisms of HIF-1α gene increased the risk of OLP. C1772T and G1790A polymorphisms of HIF-1α gene had differing patterns of allelic imbalance in the normal samples and subsequent chronic lesions. Further studies are necessary to elucidate the HIF-1α pathway in OLP, which would facilitate the development of novel therapeutic strategies for the prevention and treatment of OLP. CLINICAL RELEVANCE: These results, in conjunction with previous studies, suggest that HIF-1α may play important roles in the chronicity of oral mucosa lesions of OLP patients. Taken together, we suggest that HIF-1α polymorphisms enhance its target genes, thereby altering the microenvironment and supporting sequential release of inflammatory mediators or cellular events in OLP. It appears unlikely that inhibition of a single proinflammatory mediator will prove useful in clinical practice, but several ways to reprogram mediators engaged in a wide array of roles simultaneously are encouraging.