Antimicrobial Sensitivity Profile in Psittacine Birds at an Avian Teaching Hospital: A Retrospective Study, 2015-2022.

Veterinary hospitals house patient populations with diverse infectious statuses, microbiota, and histories of prior antibiotic therapy. Choanal swabs are commonly used for assessing the upper respiratory tract of birds for bacterial disease, with the samples submitted for cytologic testing and/or culture and antimicrobial sensitivity testing. The aim of this retrospective study was to identify and quantify bacteria isolated from choanal swabs collected from psittacine patients at a veterinary teaching hospital in Mexico City, Mexico. Data regarding bacterial isolates from choanal swabs were obtained from the medical records of companion psittacines suspected of upper respiratory bacterial disease that presented between November 2015 and December 2022. A total of 47.8% (175 of 366) of the bacterial isolates were from specimens obtained from red-lored Amazons (Amazona autumnalis). Gram-negative bacteria predominated, with 27 different genera identified. Klebsiella, Staphylococcus, and Escherichia were the most frequently isolated genera. A total of 90.4% (331 of 366) of the isolates were resistant to at least 1 antibiotic tested in the sensitivity panel, and a single Klebsiella isolate was resistant to 13 different antibiotics. Gentamicin had a high percentage of efficacy (79.5%; 182 of 229) against the bacterial isolates, whereas isolates tested against sulfonamide-trimethoprim (46.7%, 98 of 210), streptomycin (43.8%; 88 of 201), and clindamycin (12.9%; 15 of 116) had susceptibilities <50%. This is the first study to report common bacterial isolates and their antimicrobial susceptibility patterns from choanal swab samples collected from companion psittacines suspected of upper respiratory disease in Mexico. Clinicians can use the information presented in this study as a guide for therapeutic decision-making when managing upper respiratory bacterial infections in companion psittacine patients.

The value of next-generation sequencing for the diagnosis of Streptococcus suis meningitis

SUMMARY OBJECTIVE: The aim of this study was to investigate the value of next-generation sequencing for the diagnosis of Streptococcus suis meningitis. METHODS: Patients with meningitis in the Department of Neurology of the Hainan General Hospital were recruited and divided into a next-generation sequencing group and a control group. In the next-generation sequencing group, we used the next-generation sequencing method to detect the specific pathogenic bacteria in the patients. In the control group, we used the cerebrospinal fluid bacterial culture method to detect the specific pathogenic bacteria in the patients. RESULTS: A total of 28 participants were recruited for this study, with 14 participants in each group. The results showed similarities in both the average age and average course of the disease between the two groups (p>0.05). The white blood cell count, percentage of neutrophils, and level of C-reactive protein in the next-generation sequencing group were significantly higher than those in the control group (p<0.05). There were similarities in both the temperature and intracranial pressure between the two groups (p>0.05). In the next-generation sequencing group, all patients (100%) were detected as having had the S. suis meningitis infection by next-generation sequencing, while only 6 (43%) patients in the control group had been detected as having the S. suis meningitis infection by cerebrospinal fluid bacterial culture. CONCLUSIONS: The positive detection rate of S. suis by the next-generation sequencing method was significantly higher compared with using a cerebrospinal fluid bacterial culture. Therefore, the next-generation sequencing method is valuable for the diagnosis of S. suis meningitis and is worthy of clinical application.

How microbiological tests reflect bacterial pathogenesis and host adaptation.

Historically, clinical microbiological laboratories have often relied on isolation of pure cultures and phenotypic testing to identify microorganisms. These clinical tests are often based on specific biochemical reactions, growth characteristics, colony morphology, and other physiological aspects. The features used for identification in clinical laboratories are highly conserved and specific for a given group of microbes. We speculate that these features might be the result of evolutionary selection and thus may reflect aspects of the life cycle of the organism and pathogenesis. Indeed, several of the metabolic pathways targeted by diagnostic tests in some cases may represent mechanisms for host colonization or pathogenesis. Examples include, but are not restricted to, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella enterica, Shigella spp., and enteroinvasive Escherichia coli (EIEC). Here, we provide an overview of how some common tests reflect molecular mechanisms of bacterial pathogenesis.

Expression, purification and biological effect of a novel single chain Fv antibody and protamine fusion protein for the targeted delivery of siRNAs to FGFR3 positive cancer cells

Background: Gain-of-function of fibroblast growth factor receptor 3 (FGFR3) is involved in the pathogenesis of many tumors. More and more studies have focused on the potential usage of therapeutic single-chain Fv (ScFv) antibodies against FGFR3. RNA interference (RNAi) has been considered as a promising therapeutic method against cancer. A tool which can deliver small interference RNAs (siRNAs) into FGFR3 positive cancer cells is very promising for anti-tumor therapy. Results: In this study, a novel fusion protein R3P, which consists of FGFR3-ScFv and protamine, was generated in Escherichia coli by inclusion body expression strategy and Ni-NTA chromatography. Its yield reached 10 mg per liter of bacterial culture and its purity was shown to be higher than 95%. 1 µg of R3P could efficiently bind to about 2.5 pmol siRNAs and deliver siRNAs into FGFR3 positive RT112 and K562 cells. Annexin V staining results showed that R3P can deliver the amplified breast cancer 1 (AIB1) siRNAs to induce RT112 cell apoptosis. Conclusion: These results indicated that R3P was a promising carrier tool to deliver siRNAs into FGFR3 positive cancer cells and to exert anti-tumor effect.

Indirect diagnostic tests for the detection of subclinical mastitis in dairy goats experimentally infected with Staphylococcus aureus / Testes diagnósticos indiretos na detecção da mastite subclínica em cabras leiteiras infectadas experimentalmente com Staphylococcus aureus

ABSTRACT: The aim of the present study was to assess two diagnostic techniques (California mastitis test (CMT) and the somatic cell count (SCC)) that can diagnose mastitis in dairy goats. Experimental infection was conducted using 20 mammary glands, a strain of Staphylococcus aureus, an infectious dose of 1.2x108CFU mL-1 and a volume of 1mL per mammary gland. The CMT and the SCC were used to detect subclinical mastitis. Bacterial culture (BC) was performed immediately after milk collection and was used as the gold standard. Four experimental time points were established (0, 24, 48 and 72 hours post-inoculation). Analysis of the ROC curve confirmed that the best combination of sensitivity and specificity were obtained with a cutoff point of 405.5, 6030.0 and 729.5x103 cells mL-1, respectively at M1, M2 and M3. Furthermore, considering the drop in sensitivity throughout the experimental time points, the use of serial bacterial cultures are recommended, particularly in herds with a high prevalence of S. aureus.

RESUMO: Neste trabalho, objetivou-se avaliar duas técnicas diagnósticas (California mastitis test (CMT) e a contagem de células somáticas (CCS)) disponíveis para o diagnóstico da mastite em cabras leiteiras. Realizou-se infecção experimental em 20 metades mamárias, utilizando-se cepa de S. aureus, em uma dose infectante de 1,2x108 UFC mL-1 e um volume de 1mL/metade mamária. Para detecção da mastite subclínica, foi utilizado o CMT e a CCS. A cultura bacteriológica (CB) foi empregada como padrão ouro, sendo realizada logo após a coleta do leite. Foram estabelecidos quatro momentos experimentais (0, 24, 48 e 72 horas pós-infecção). A análise da curva de ROC confirmou que a melhor combinação (sensibilidade e especificidade) foi obtida com ponto de corte de 405,5, 6030,0 e 729,5x103 cells mL-1, respectivamente, em M1, M2 and M3. Ademais, levando em consideração a queda da sensibilidade ao longo dos momentos experimentais, é relevante a realização da cultura bacteriológica seriada, principalmente em rebanhos com elevada prevalência de S. aureus.

Indirect diagnostic tests for the detection of subclinical mastitis in dairy goats experimentally infected with Staphylococcus aureus / Testes diagnósticos indiretos na detecção da mastite subclínica em cabras leiteiras infectadas experimentalmente com Staphylococcus aureus

The aim of the present study was to assess two diagnostic techniques (California mastitis test (CMT) and the somatic cell count (SCC)) that can diagnose mastitis in dairy goats. Experimental infection was conducted using 20 mammary glands, a strain of Staphylococcus aureus , an infectious dose of 1.2x108CFU mL-1 and a volume of 1mL per mammary gland. The CMT and the SCC were used to detect subclinical mastitis. Bacterial culture (BC) was performed immediately after milk collection and was used as the gold standard. Four experimental time points were established (0, 24, 48 and 72 hours post-inoculation). Analysis of the ROC curve confirmed that the best combination of sensitivity and specificity were obtained with a cutoff point of 405.5, 6030.0 and 729.5x103 cells mL-1, respectively at M1, M2 and M3. Furthermore, considering the drop in sensitivity throughout the experimental time points, the use of serial bacterial cultures are recommended, particularly in herds with a high prevalence of S. aureus.(AU)

Neste trabalho, objetivou-se avaliar duas técnicas diagnósticas (California mastitis test (CMT) e a contagem de células somáticas (CCS)) disponíveis para o diagnóstico da mastite em cabras leiteiras. Realizou-se infecção experimental em 20 metades mamárias, utilizando-se cepa de S. aureus , em uma dose infectante de 1,2x108 UFC mL-1 e um volume de 1mL/metade mamária. Para detecção da mastite subclínica, foi utilizado o CMT e a CCS. A cultura bacteriológica (CB) foi empregada como padrão ouro, sendo realizada logo após a coleta do leite. Foram estabelecidos quatro momentos experimentais (0, 24, 48 e 72 horas pós-infecção). A análise da curva de ROC confirmou que a melhor combinação (sensibilidade e especificidade) foi obtida com ponto de corte de 405,5, 6030,0 e 729,5x103 cells mL-1, respectivamente, em M1, M2 and M3. Ademais, levando em consideração a queda da sensibilidade ao longo dos momentos experimentais, é relevante a realização da cultura bacteriológica seriada, principalmente em rebanhos com elevada prevalência de S. aureus.(AU)

Bacterial ecology of abattoir wastewater treated by an anaerobic digestor

Abstract Wastewater from an anaerobic treatment plant at a slaughterhouse was analysed to determine the bacterial biodiversity present. Molecular analysis of the anaerobic sludge obtained from the treatment plant showed significant diversity, as 27 different phyla were identified. Firmicutes, Proteobacteria, Bacteroidetes, Thermotogae, Euryarchaeota (methanogens), and msbl6 (candidate division) were the dominant phyla of the anaerobic treatment plant and represented 21.7%, 18.5%, 11.5%, 9.4%, 8.9%, and 8.8% of the total bacteria identified, respectively. The dominant bacteria isolated were Clostridium, Bacteroides, Desulfobulbus, Desulfomicrobium, Desulfovibrio and Desulfotomaculum. Our results revealed the presence of new species, genera and families of microorganisms. The most interesting strains were characterised. Three new bacteria involved in anaerobic digestion of abattoir wastewater were published.

Bacterial ecology of abattoir wastewater treated by an anaerobic digestor.

Wastewater from an anaerobic treatment plant at a slaughterhouse was analysed to determine the bacterial biodiversity present. Molecular analysis of the anaerobic sludge obtained from the treatment plant showed significant diversity, as 27 different phyla were identified. Firmicutes, Proteobacteria, Bacteroidetes, Thermotogae, Euryarchaeota (methanogens), and msbl6 (candidate division) were the dominant phyla of the anaerobic treatment plant and represented 21.7%, 18.5%, 11.5%, 9.4%, 8.9%, and 8.8% of the total bacteria identified, respectively. The dominant bacteria isolated were Clostridium, Bacteroides, Desulfobulbus, Desulfomicrobium, Desulfovibrio and Desulfotomaculum. Our results revealed the presence of new species, genera and families of microorganisms. The most interesting strains were characterised. Three new bacteria involved in anaerobic digestion of abattoir wastewater were published.

Bacterial ecology of abattoir wastewater treated by an anaerobic digestor

Wastewater from an anaerobic treatment plant at a slaughterhouse was analysed to determine the bacterial biodiversity present. Molecular analysis of the anaerobic sludge obtained from the treatment plant showed significant diversity, as 27 different phyla were identified. Firmicutes, Proteobacteria, Bacteroidetes, Thermotogae, Euryarchaeota (methanogens), and msbl6 (candidate division) were the dominant phyla of the anaerobic treatment plant and represented 21.7%, 18.5%, 11.5%, 9.4%, 8.9%, and 8.8% of the total bacteria identified, respectively. The dominant bacteria isolated were Clostridium, Bacteroides, Desulfobulbus, Desulfomicrobium, Desulfovibrio and Desulfotomaculum. Our results revealed the presence of new species, genera and families of microorganisms. The most interesting strains were characterised. Three new bacteria involved in anaerobic digestion of abattoir wastewater were published. (AU)

Organización, mantenimiento y preservación de la Colección de Cultivos Bacterianos del Instituto de Ciencias Biológicas de la Universidad de Ciencias y Artes de Chiapas (UNICACH), México / Organization, maintenance, and preservation of the Bacterial Culture Collection of the Biological Sciences Institute, University of Science and Arts of Chiapas (UNICACH), Mexico

Los ceparios o colecciones de microorganismos son fuentes de recursos genéticos cuyo propósito es la preservación de la diversidad biológica, garantizando su disponibilidad para actividades de docencia, investigación y comerciales. En este trabajo se verificó la viabilidad, pureza y características biológicas de las bacterias que conforman el cepario del Instituto de Ciencias Biológicas de la Universidad de Ciencias y Artes de Chiapas, y se organizó y estructuró la información obtenida en un portal virtual, para propiciar la cooperación académica. El cepario cuenta con 33 microorganismos, la mayoría del género Streptococcus y Escherichia (45,1 y 21,2%, respectivamente). Del primer género, se confirmó la identificación de S. pyogenes (40%), exhibiendo la mayoría genes que codifican para DNAsas. Con respecto al segundo género, un 58,3% de las bacterias fueron confirmadas taxonómicamente como E. coli. De esta especie, la colección cuenta con las cepas prototipo causantes de diarrea y que han preservado sus rasgos genéticos por más de cinco años. Dicho acervo ha impulsado actividades de docencia e investigación, a nivel local e internacional. Es importante que los ceparios sean fuentes sustentables de recursos biológicos, para la adquisición y suministro de especies bacterianas, con la finalidad de fomentar la interacción con la comunidad académica.

Strain collections or bacterial culture collections are genetic resources whose purpose is the preservation of biological diversity, ensuring their availability for teaching, research and trade activities. In this work viability, purity and biological characteristics of bacteria from the bacterial collection of the Institute of Biological Sciences, University of Science and Arts of Chiapas were studied. Information was structured and organized in a virtual site, to promote academic cooperation. The strain bank includes 33 microorganisms, most of the genus Streptococcus and Escherichia (45.1 and 21.2%, respectively). For Streptococcus, the identification of S. pyogenes (40%) was confirmed, by determination of most DNAses encoding genes. For Escherichia 58.3% were taxonomically confirmed as E. coli. For this species, the collection includes typical strains that produce diarrhea and their genetic traits have been preserved for more than five years. This bacterial culture collection has stimulated teaching and research activities at local and international levels. Strain collections are important sources of biological material which can provide bacterial species, in order to encourage interaction with the academic community.

Effect of medium components and culture conditions in Bacillus subtilis EA-CB0575 spore production.

Bacillus subtilis spores have important biotechnological applications; however, achieving both, high spore cell densities and sporulation efficiencies in fermentation, is poorly reported. In this study, medium components and culture conditions were optimized with different statistical methods to increase spore production of the plant growth promoting rhizobacteria B. subtilis EA-CB0575. Key medium components were determined with Plackett-Burman (PB) design, and the optimum concentration levels of two components (glucose, MgSO4·7H2O) were optimized with a full factorial and central composite design, achieving 1.37 × 10(9) CFU/mL of spore cell density and 93.5 % of sporulation efficiency in shake flask. The optimized medium was used to determine the effect of culture conditions on spore production at bioreactor level, finding that maintaining pH control did not affect significantly spore production, while the interaction of agitation and aeration rates had a significant effect on spore cell density. The overall optimization generated a 17.2-fold increase in spore cell density (8.78 × 10(9) CFU/mL) and 1.9-fold increase in sporulation efficiency (94.2 %) compared to that of PB design. These results indicate the potential of B. subtilis EA-CB0575 to produce both, high spore cell densities and sporulation efficiencies, with very low nutrient requirements and short incubation period which can represent savings of process production.

Detection of mycobacteria in ornamental fish in Iran by culture and Ziehl-Neelsen staining methods / Detection of mycobacteria in ornamental fish in Iran by culture and Ziehl-Neelsen staining methods

Background: Mycobacterial infections in fish is largely chronic to subacute in nature and affects fishes in fresh water, brackish water and salt water. In addition to their known infectivity to fishes, aquatic mycobacteria pose significant zoonotic concerns. Due to the zoonotic character of the disease, increasing importance of aquariology, and lack of any clinical signs in early steps of mycobacteriosis, present study was undertaken to analyze the distribution of mycobacteria in diseased and apparently healthy ornamental fish from some local aquarium fish shops in four different cities in Iran by culture and Ziehl-Neelsen staining. Materials, Methods & Results: One hundred and one fresh water aquarium fish of 22 species from some local shops in four cities in Iran were examined. Before decontamination, smears of homogenized samples stained with Ziehl-Neelsen. For bacterial culture, samples were inoculated on Lowenstein-Jensen medium. Culture plates were examined daily for four weeks. The rate of growth at different temperature, colony morphology and pigmentation were evaluated for species identification. Among 79 moribund fish examined, 16 individuals were positive for acid fast rods at microscopic examination. Seven fish out of 22 apparently healthy individuals also gave positive microscopic results. Using the culture method, 29 and 10 Mycobacterium isolates were obtained

Background: Mycobacterial infections in fish is largely chronic to subacute in nature and affects fishes in fresh water, brackish water and salt water. In addition to their known infectivity to fishes, aquatic mycobacteria pose significant zoonotic concerns. Due to the zoonotic character of the disease, increasing importance of aquariology, and lack of any clinical signs in early steps of mycobacteriosis, present study was undertaken to analyze the distribution of mycobacteria in diseased and apparently healthy ornamental fish from some local aquarium fish shops in four different cities in Iran by culture and Ziehl-Neelsen staining. Materials, Methods & Results: One hundred and one fresh water aquarium fish of 22 species from some local shops in four cities in Iran were examined. Before decontamination, smears of homogenized samples stained with Ziehl-Neelsen. For bacterial culture, samples were inoculated on Lowenstein-Jensen medium. Culture plates were examined daily for four weeks. The rate of growth at different temperature, colony morphology and pigmentation were evaluated for species identification. Among 79 moribund fish examined, 16 individuals were positive for acid fast rods at microscopic examination. Seven fish out of 22 apparently healthy individuals also gave positive microscopic results. Using the culture method, 29 and 10 Mycobacterium isolates were obtained

Detection of mycobacteria in ornamental fish in Iran by culture and Ziehl-Neelsen staining methods

Background: Mycobacterial infections in fish is largely chronic to subacute in nature and affects fishes in fresh water, brackish water and salt water. In addition to their known infectivity to fishes, aquatic mycobacteria pose significant zoonotic concerns. Due to the zoonotic character of the disease, increasing importance of aquariology, and lack of any clinical signs in early steps of mycobacteriosis, present study was undertaken to analyze the distribution of mycobacteria in diseased and apparently healthy ornamental fish from some local aquarium fish shops in four different cities in Iran by culture and Ziehl-Neelsen staining. Materials, Methods & Results: One hundred and one fresh water aquarium fish of 22 species from some local shops in four cities in Iran were examined. Before decontamination, smears of homogenized samples stained with Ziehl-Neelsen. For bacterial culture, samples were inoculated on Lowenstein-Jensen medium. Culture plates were examined daily for four weeks. The rate of growth at different temperature, colony morphology and pigmentation were evaluated for species identification. Among 79 moribund fish examined, 16 individuals were positive for acid fast rods at microscopic examination. Seven fish out of 22 apparently healthy individuals also gave positive microscopic results. Using the culture method, 29 and 10 Mycobacterium isolates were obtained from moribund and healthy fish. The following Mycobacterium species were isolated from unhealthy fish: Mycobacterium fortuitum, M. marinum, and M. smegmatis. The number of different species of Mycobacterium from apparently healthy fish was: M. fortuitum (one fish), M. marinum (one fish), M. terrae (one fish) and M. flavescens (one fish). Discussion: Based on the results in both moribund and apparently healthy fish examined, culture examination showed more mycobacteria than Ziehl-Neelsen staining detection. Lower proportion of Ziehl-Neelsen positive results compared with culture method was reported in aquarium fish in Slovania. Using positive microscopic results, 13 isolates were obtained where as 29 samples gave positive culture results for mycobacteria. Similar result was also observed in clinically healthy ornamental fish and their aquarium environment. The identification of mycobacteria by Ziehl-Neelsen staining is a traditional method. However, acid-fast bacilli may not always be found through direct microscopy because the destruction of mycobacteria or their low number may sometimes happen. Culture examination is a more sensitive method than direct microscopy. However, killing of mycobacteria caused by host defense mechanisms, a low number of viable mycobacteria in the tissue, or by destruction of the mycobacteria during the preparation of the sample could result in negative cultivation results. Species of Mycobacterium identified in unhealthy fish were M. fortuitum, M. marinum and M. smegmatis. High frequency of identifying M. fortuitum and M. marinum (6 out of 7) in the samples provide more evidence that these species are common Mycobacterium species to be found in diseased aquarium fish. Numerous studies showed the common isolation of these two species from aquarium fish. M. marinum infection may be an occupational hazard for certain professionals such as pet shop workers. Many infections may also occur in fish fanciers who keep an aquarium at home. Less common than M. marinum, M. fortuitum is also capable of infecting human. In this study, the occurrence of M. marinum and M. fortuitum in both unhealthy and apparently healthy aquarium fish shows the importance of recognizing fish mycobacteriosis in order to prevent their transmission to human.

Detection of mycobacteria in ornamental fish in Iran by culture and Ziehl-Neelsen staining methods / Detection of mycobacteria in ornamental fish in Iran by culture and Ziehl-Neelsen staining methods

Background: Mycobacterial infections in fish is largely chronic to subacute in nature and affects fishes in fresh water, brackish water and salt water. In addition to their known infectivity to fishes, aquatic mycobacteria pose significant zoonotic concerns. Due to the zoonotic character of the disease, increasing importance of aquariology, and lack of any clinical signs in early steps of mycobacteriosis, present study was undertaken to analyze the distribution of mycobacteria in diseased and apparently healthy ornamental fish from some local aquarium fish shops in four different cities in Iran by culture and Ziehl-Neelsen staining. Materials, Methods & Results: One hundred and one fresh water aquarium fish of 22 species from some local shops in four cities in Iran were examined. Before decontamination, smears of homogenized samples stained with Ziehl-Neelsen. For bacterial culture, samples were inoculated on Lowenstein-Jensen medium. Culture plates were examined daily for four weeks. The rate of growth at different temperature, colony morphology and pigmentation were evaluated for species identification. Among 79 moribund fish examined, 16 individuals were positive for acid fast rods at microscopic examination. Seven fish out of 22 apparently healthy individuals also gave positive microscopic results. Using the culture method, 29 and 10 Mycobacterium isolates were obtained

Background: Mycobacterial infections in fish is largely chronic to subacute in nature and affects fishes in fresh water, brackish water and salt water. In addition to their known infectivity to fishes, aquatic mycobacteria pose significant zoonotic concerns. Due to the zoonotic character of the disease, increasing importance of aquariology, and lack of any clinical signs in early steps of mycobacteriosis, present study was undertaken to analyze the distribution of mycobacteria in diseased and apparently healthy ornamental fish from some local aquarium fish shops in four different cities in Iran by culture and Ziehl-Neelsen staining. Materials, Methods & Results: One hundred and one fresh water aquarium fish of 22 species from some local shops in four cities in Iran were examined. Before decontamination, smears of homogenized samples stained with Ziehl-Neelsen. For bacterial culture, samples were inoculated on Lowenstein-Jensen medium. Culture plates were examined daily for four weeks. The rate of growth at different temperature, colony morphology and pigmentation were evaluated for species identification. Among 79 moribund fish examined, 16 individuals were positive for acid fast rods at microscopic examination. Seven fish out of 22 apparently healthy individuals also gave positive microscopic results. Using the culture method, 29 and 10 Mycobacterium isolates were obtained

Estudo comparativo de sensibilidade das técnicas de cultura bacteriana e PCR para a detecção de Pasteurella pneumotropica em roedores / /Comparative sensivity for Pasteurella pneumotropica detection of rodents by bacterial culture and PCR techniques

Objetivo: Realizar uma comparação, em relação a sensibilidade, das técnicas de cultura bacteriana e PCR para detecção de Pasteurella pneumotropica, em colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss; ratos Wistar e Hamster Golden. Materiais e Métodos: 230 amostras de traquéia foram coletadas e divididas em partes iguais: uma parte foi encaminhada para a cultura bacteriana, onde foram realizadas provas bioquímicas manuais e semi-automatizadas. A outra parte foi submetida à reação de PCR, onde os oligonucleotídeos iniciadores foram F; 5’ ACCTACTCTTGACATCCAGA 3’ e R; 5’ CGCTCCACATCGCTGCTT 3’ que amplificam em 296 pb. Os produtos obtidos foram separados por eletroforese em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusão: Os resultados obtidos através da cultura bacteriana foram de 1,75% de casos positivos e 98,25% de negativos. Em relação ao PCR observamos o resultado de 63% de positivos e 37% de casos negativos. Concluindo, nossos resultados demonstram que a técnica de PCR oferece significativamente maior sensibilidade para detecção de P. pneumotropica quando comparado a cultura bacteriana. CEUA nº 251/11.

OBJECTIVE: To conduct a comparative study of the sensitivity by bacterial culture and PCR detection of Pasteurella pneumotropica in conventional colonies of inbred mice strains C57BL/6, BALB/c and Swiss outbred; Golden Hamster and Wistar rats. MATERIALS AND METHODS: 230 samples of the trachea were collected and divided into equal parts: one part was sent for culture, where biochemical tests were performed manually and semi-automated, after bacterial isolation. The other part was subjected to PCR, used primers F, 5 ‘ACCTACTCTTGACATCCAGA 3’ and R, 5 ‘CGCTCCACATCGCTGCTT 3’ which amplifies at 296 bp. The products obtained were separated by electrophoresis in agarose gel. Visualization and photodocumentation were performed under ultraviolet light. RESULTS AND CONCLUSION: The results obtained by bacterial culture were 1.75% of positive cases and negative in 98.25%; 63% and 37% of cases positive and negative, respectively, by PCR. These results point to the greater sensitivity of PCR (x2 = 0.10, 0.80 < p <0.50) when compared to bacterial culture. CEUA nº 251/11

Estudo comparativo de sensibilidade das técnicas de cultura bacteriana e PCR para a detecção de Pasteurella pneumotropica em roedores / /Comparative sensivity for Pasteurella pneumotropica detection of rodents by bacterial culture and PCR techniques

Objetivo: Realizar uma comparação, em relação a sensibilidade, das técnicas de cultura bacteriana e PCR para detecção de Pasteurella pneumotropica, em colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss; ratos Wistar e Hamster Golden. Materiais e Métodos: 230 amostras de traquéia foram coletadas e divididas em partes iguais: uma parte foi encaminhada para a cultura bacteriana, onde foram realizadas provas bioquímicas manuais e semi-automatizadas. A outra parte foi submetida à reação de PCR, onde os oligonucleotídeos iniciadores foram F; 5 ACCTACTCTTGACATCCAGA 3 e R; 5 CGCTCCACATCGCTGCTT 3 que amplificam em 296 pb. Os produtos obtidos foram separados por eletroforese em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusão: Os resultados obtidos através da cultura bacteriana foram de 1,75% de casos positivos e 98,25% de negativos. Em relação ao PCR observamos o resultado de 63% de positivos e 37% de casos negativos. Concluindo, nossos resultados demonstram que a técnica de PCR oferece significativamente maior sensibilidade para detecção de P. pneumotropica quando comparado a cultura bacteriana. CEUA nº 251/11.(AU)

OBJECTIVE: To conduct a comparative study of the sensitivity by bacterial culture and PCR detection of Pasteurella pneumotropica in conventional colonies of inbred mice strains C57BL/6, BALB/c and Swiss outbred; Golden Hamster and Wistar rats. MATERIALS AND METHODS: 230 samples of the trachea were collected and divided into equal parts: one part was sent for culture, where biochemical tests were performed manually and semi-automated, after bacterial isolation. The other part was subjected to PCR, used primers F, 5 ‘ACCTACTCTTGACATCCAGA 3 and R, 5 ‘CGCTCCACATCGCTGCTT 3 which amplifies at 296 bp. The products obtained were separated by electrophoresis in agarose gel. Visualization and photodocumentation were performed under ultraviolet light. RESULTS AND CONCLUSION: The results obtained by bacterial culture were 1.75% of positive cases and negative in 98.25%; 63% and 37% of cases positive and negative, respectively, by PCR. These results point to the greater sensitivity of PCR (x2 = 0.10, 0.80 < p <0.50) when compared to bacterial culture. CEUA nº 251/11(AU)

Identifi cation of Mycobacterium avium subspeciesparatuberculosis by PCR techniques and establishment ofcontrol programs for bovine paratuberculosis in dairy herds / Identificación de Mycobacterium avium subspecies paratuberculosis mediante pruebas dePCR y definición de programa de control de la paratuberculosis bovina en hatos lecheros / Identificação de Mycobacterium avium subespécie paratuberculosis por PCR edefinição do programa de controle da paratuberculose em rebanhos bovinos leiteiros

The aim of this study was to establish the protocol of conventional and real time PCR for amplificationof Mycobacterium avium subsp. paratuberculosis (MAP) genome from bovine fecal samples, as a wayto define strategies for establishing a prevention and control program in a dairy herd at the Universidadde Antioquia (Medellín, Colombia). Fecal samples were individually taken of clinical healthy cows orcows with diarrhea bred in a herd enzootic for Johne’s disease, were processed them for culture in liquidMiddlebrook 7H9 media supplemented with mycobactin under two different protocols: with or withoutinhibitors. Fecal samples from clinically healthy cows were used as negative control. Conventional andreal time PCR were performed with MAP DNA obtained of fecal or cultured samples. The MAP- specificIS900 segment was amplified by using the respective forward and reverse primers. DNA isolated from areference MAP strain was used as positive control of PCR. Data were analyzed by descriptive statisticsand simple regression analysis between PCR and culture results were performed. All samples culturedin media with or without mycobactin gave a positive result compatible with MAP growth. However, only13,3% of samples were positive by real time PCR. There was no relationship neither between PCR and culture results, nor between clinical condition of the cow and MAP positivity. These results support theneed combine culture of feces with PCR diagnosis for identification of MAP-excreting cows in a dairyherd. Finally, a strategy of prevention and control of bovine paratuberculosis is proposed for this enzooticherd and for dairy herds in Colombia.

El objetivo de este trabajo fue establecer un sistema de detección y amplificación del Mycobacteriumavium paratuberculosis (MAP) a partir de muestras de materia fecal bovina, mediante el uso de la técnicade PCR en tiempo real, como estrategia de apoyo para el establecimiento de un programa de prevencióndetección y control de la paratuberculosis bovina en el hato lechero de la Universidad de Antioquia. Muestrasde materia fecal fueron tomadas de bovinos provenientes de un hato enzoótico para la enfermedad de Johne,fueron cultivadas en medio de cultivo líquido Middlebrook 7H9 suplementado con micobactina, bajo dosprotocolos de aislamiento: con o sin inhibidores. Como control negativo fue utilizada muestras de materiafecal de bovinos clínicamente sanos. Adicionalmente, con el DNA de las muestras aisladas en cultivo yde las muestras de materia fecal, fueron hechas pruebas de PCR convencional y en tiempo real, para laamplificación del elemento de inserción IS900 del MAP, mediante el uso de cebadores específicos para esteelemento. Como control positivo se utilizó DNA de MAP de una cepa de referencia. Los resultados fueronevaluados mediante estadística descriptiva y la comparación entre el resultado del cultivo y de la pruebade PCR fue evaluado mediante regresión simple. Los resultados del cultivo bacteriológico, mostraron untotal de 15 muestras con crecimiento compatible con MAP, el cual fue verificado por prueba de PCR enel 13.3% de los casos. No hubo correlación entre el resultado de cultivo y la prueba de PCR ni entre elestado clínico y la positividad al MAP. Los resultados confirman la necesidad de combinar el diagnósticomolecular con el cultivo bacteriológico para identificar las vacas positivas en un hato. Finalmente, unaestrategia de prevención y control de la enfermedad aplicable a este hato enzoótico y a los hatos lecherosen Colombia es discutida.

O objetivo deste estudo foi estabelecer um sistema de detecção e amplificação do Mycobacterium aviumparatuberculosis (MAP) a partir de amostras fecais bovinas, utilizando a técnica de PCR em tempo real,como uma estratégia para apoiar o estabelecimento de um programa rastreio para a prevenção e controlede la paratuberculosis bovina no rebanho leiteiro da Universidade de Antioquia. Foram colhidas amostrasde fezes de gado bovino a partir de uma fazenda enzoótica para a doença de Johne, e foram cultivadasem meio de cultura líquida Middlebrook 7H9 suplementado com micobactina, sob dois protocolos deisolamento: com ou sem inibidores. Foram utilizadas como controle negativo amostras fecais de bovinossaudáveis. Além disso, as amostras de DNA isoladas e cultivadas a partir de amostras fecais foramrealizadas testes de PCR convencional e em tempo real, para amplificação elemento de inserção IS900 noMAP. Foi utilizado como controle positivo do teste DNA de uma estirpe de referencia. Os resultados foramavaliados por estatística descritiva e as comparações entre os resultados de cultura e teste PCR foramavaliadas por regressão simple. Os resultados de cultura bacteriológica mostraram 100% de crescimentoem amostras com MAP, que foi verificada por PCR em 13,3% dos casos. Não houve correlação entre oresultado do cultivo e teste PCR ou entre a clínica e a positividade para MAP. Os resultados confirmam anecessidade de combinar o diagnóstico molecular com cultura bacteriológica para identificação positivade vacas em um rebanho. Finalmente, uma estratégia de prevenção e controle da doença aplicável nesterebanho enzoótico e os rebanhos leiteiros e na Colômbia é discutida.

Detección de Mycobacterium avium subespecie paratuberculosis, por medio de PCR-anidada a partir de muestras de heces de ovinos / Detection of Mycobacterium avium subspecies paratuberculosis by nested-PCR of ovine fecal samples

Paratuberculosis is a chronic granulomatous enteritis caused by Mycobacterium avium subspecies paratuberculosis (Map), which affects wild and domestic ruminants. Map is shed in feces from infected animals. Transmission of the infection takes place by oral ingestion of the bacterium from contaminated food and water with feces. With the objective to establish a paratuberculosis diagnosis in ovine by nested-PCR from fecal samples, 204 fecal and serum ovine samples were studied. Feces were evaluated by nested-PCR and bacterial culture, serum samples were analyzed by agar gel immunodiffusion (AGID). Nested-PCR yielded a 210 bp amplification product that corresponds to Map-IS900, in 61 out of 204 samples. From these, 43 were from AGID positive animals and 18 from negative animals. Seventeen Map strains were isolated by bacterial culture and AGID detected 91 positive animals. Nested-PCR allowed to detect, sooner, greater number of animals shedding bacillus, even when they had resulted negative to the serological test. This result is considered important because generally these animals, while remaining in the farm, constitute the main source of infection for the herd. Nested-PCR should be considered as an alternative, when a prompt result is required to know the health status of the herd with respect to paratuberculosis.

La paratuberculosis es una enteritis granulomatosa de curso crónico ocasionada por Mycobacterium avium subespecie paratuberculosis (Map), afecta a rumiantes domésticos y silvestres. Map es excretada en las heces de animales que desarrollan la enfermedad, y la transmisión de la infección se da mediante la ingestión de alimentos y agua contaminados por heces de animales infectados. Con el objetivo de establecer el diagnóstico de paratuberculosis en ovinos por medio de la PCR-anidada a partir de muestras de heces, se trabajaron 204 muestras de heces y sueros de ovinos; las heces se evaluaron por PCR-anidada y cultivo bacteriológico, las muestras de sueros fueron analizadas por medio de inmunodifusión en agar gel (lDGA). Con la PCR-anidada se obtuvo un producto de amplificación 210 pb que corresponde a la IS900 de Map, en 61 de las 204 muestras. De éstas, 43 eran de animales positivos a IDGA y 18 negativos. Mediante cultivo bacteriológico se aislaron 17 cepas de Map; en este contexto, la IDGA detectó a 91 animales como positivos. La PCR-anidada permitió detectar en menor tiempo a mayor cantidad de animales que estaban eliminando al bacilo, aun cuando habían resultado negativos a la prueba serológica; este resultado se considera importante, ya que generalmente estos animales, al permanecer dentro de la granja, constituyen la principal fuente de infección para el rebaño. Se debe considerar a la PCR-anidada como alternativa, cuando se requiera el diagnóstico en breve tiempo, para conocer el estado sanitario del rebaño con respecto a paratuberculosis.