Synergistic toxic effects and mechanistic insights of beta-cypermethrin and pyraclostrobin exposure on hook snout carp (Opsariichthys bidens): A biochemical, transcriptional, and molecular approach.

The extensive utilization of pesticides results in their frequent detection in aquatic environments, often as complex mixtures, posing risks to aquatic organisms. The hook snout carp (Opsariichthys bidens) serves as a valuable bioindicator for evaluating the impacts of environmental pollutants in aquatic ecosystems. However, few studies examined the toxic effects of pesticides on O.bidens, let alone the characterization of the combined effects resulting from their mixtures. This study aims to elucidate the toxic effects of beta-cypermethrin and pyraclostrobin on O.bidens, individually and in combination, focusing on biochemical, transcriptional, and molecular responses. By organizing and analyzing the toxicogenomic databases, both pesticides were identified as a contributor to processes such as apoptosis, oxidative stress, and inflammatory responses. The acute toxicity test revealed comparable acute toxicity of beta-cypermethrin and pyraclostrobin on O.bidens, with LC50 being 0.019 and 0.027 mg/L, respectively, whereas the LC50 decreased to 0.0057 and 0.0079 mg/L under the combined exposure, indicating potential synergistic effects. The activities of enzymes involved in oxidative stress and detoxification were significantly altered after exposure, with superoxide dismutase (SOD) and catalase (CAT) increasing, while malondialdehyde (MDA) levels decreased. The activity of CYP450s was significantly changed. Likewise, the expression levels of genes (mn-sod, p53, esr, il-8) associated with oxidative stress, apoptosis, endocrine and immune systems were significantly increased. Combined exposure to the pesticides significantly exacerbated the aforementioned biological processes in O.bidens. Furthermore, both pesticides can modify protein activity by binding to the surface of SOD molecules and altering protein conformation, contributing to the elevated enzyme activity. Through the investigation of the synergistic toxic effects of pesticides and molecular mechanisms in O.bidens, our findings highlight the importance of assessing the combined effects of pesticide mixtures in aquatic environments.

The genomes of Dahlia pinnata, Cosmos bipinnatus, and Bidens alba in tribe Coreopsideae provide insights into polyploid evolution and inulin biosynthesis.

BACKGROUND: The Coreopsideae tribe, a subset of the Asteraceae family, encompasses economically vital genera like Dahlia, Cosmos, and Bidens, which are widely employed in medicine, horticulture, ecology, and food applications. Nevertheless, the lack of reference genomes hinders evolutionary and biological investigations in this tribe. RESULTS: Here, we present 3 haplotype-resolved chromosome-level reference genomes of the tribe Coreopsideae, including 2 popular flowering plants (Dahlia pinnata and Cosmos bipinnatus) and 1 invasive weed plant (Bidens alba), with assembled genome sizes 3.93 G, 1.02 G, and 1.87 G, respectively. We found that Gypsy transposable elements contribute mostly to the larger genome size of D. pinnata, and multiple chromosome rearrangements have occurred in tribe Coreopsideae. Besides the shared whole-genome duplication (WGD-2) in the Heliantheae alliance, our analyses showed that D. pinnata and B. alba each underwent an independent recent WGD-3 event: in D. pinnata, it is more likely to be a self-WGD, while in B. alba, it is from the hybridization of 2 ancestor species. Further, we identified key genes in the inulin metabolic pathway and found that the pseudogenization of 1-FEH1 and 1-FEH2 genes in D. pinnata and the deletion of 3 key residues of 1-FFT proteins in C. bipinnatus and B. alba may probably explain why D. pinnata produces much more inulin than the other 2 plants. CONCLUSIONS: Collectively, the genomic resources for the Coreopsideae tribe will promote phylogenomics in Asteraceae plants, facilitate ornamental molecular breeding improvements and inulin production, and help prevent invasive weeds.

Synthesis of magnetic MFe2O4 (M = Ni, Co, Zn, Fe) supported on porous carbons derived from Bidens pilosa weed and their adsorptive comparison of toxic dyes.

Bidens pilosa is classified as an invasive plant and has become a problematic weed to many agricultural crops. This species strongly germinates, grows and reproduces and competing for nutrients with local plants. To lessen the influence of Bidens pilosa, therefore, converting this harmful species into carbon materials as adsorbents in harm-to-wealth and valorization strategies is required. Here, we synthesized a series of magnetic composites based on MFe2O4 (M = Ni, Co, Zn, Fe) supported on porous carbon (MFOAC) derived from Bidens pilosa by a facile hydrothermal method. The Bidens pilosa carbon was initially activated by condensed H3PO4 to increase the surface chemistry. We observed that porous carbon loaded NiFe2O4 (NFOAC) reached the highest surface area (795.7 m2 g-1), followed by CoFe2O4/AC (449.1 m2 g-1), Fe3O4/AC (426.1 m2 g-1), ZnFe2O4/AC (409.5 m2 g-1). Morphological results showed nanoparticles were well-dispersed on the surface of carbon. RhB, MO, and MR dyes were used as adsorbate to test the adsorption by MFOAC. Effect of time (0-360 min), concentration (5-50 mg L-1), dosage (0.05-0.2 g L-1), and pH (3-9) on dyes adsorption onto MFOAC was investigated. It was found that NFOAC obtained the highest maximum adsorption capacity against dyes, RhB (107.96 mg g-1) < MO (148.05 mg g-1) < MR (153.1 mg g-1). Several mechanisms such as H bonding, π-π stacking, cation-π interaction, and electrostatic interaction were suggested. With sufficient stability and capacity, NFOAC can be used as potential adsorbent for real water treatment systems.

Optimization of hydrothermal synthesis conditions of Bidens pilosa-derived NiFe2O4@AC for dye adsorption using response surface methodology and Box-Behnken design.

The presence of stable and hazardous organic dyes in industrial effluents poses significant risks to both public health and the environment. Activated carbons and biochars are widely used adsorbents for removal of these pollutants, but they often have several disadvantages such as poor recoverability and inseparability from water in the post-adsorption process. Incorporating a magnetic component into activated carbons can address these drawbacks. This study aims to optimizing the production of NiFe2O4-loaded activated carbon (NiFe2O4@AC) derived from a Bidens pilosa biomass source through a hydrothermal method for the adsorption of Rhodamine B (RhB), methyl orange (MO), and methyl red (MR) dyes. Response surface methodology (RSM) and Box-Behnken design (BBD) were applied to analyze the key synthesis factors such as NiFe2O4 loading percentage (10-50%), hydrothermal temperature (120-180 °C), and reaction time (6-18 h). The optimized condition was found at a NiFe2O4 loading of 19.93%, a temperature of 135.55 °C, and a reaction time of 16.54 h. The optimum NiFe2O4@AC demonstrated excellent sorption efficiencies of higher than 92.98-97.10% against all three dyes. This adsorbent was characterized, exhibiting a well-developed porous structure with a high surface area of 973.5 m2 g-1. Kinetic and isotherm were studied with the best fit of pseudo-second-order, and Freundlich or Temkin. Qmax values were determined to be 204.07, 266.16, and 177.70 mg g-1 for RhB, MO, and MR, respectively. By selecting HCl as an elution, NiFe2O4@AC could be efficiently reused for at least 4 cycles. Thus, the Bidens pilosa-derived NiFe2O4@AC can be a promising material for effective and recyclable removal of dye pollutants from wastewater.

Investigation of alpha amylase inhibitors from Bidens pilosa L. by in silico and in vitro studies.

Bidens pilosa L. has been traditionally used as an anti-diabetic herbal medicine; however, its mechanism of action remains elusive. In this study, the potential role of B. pilosa compounds on alpha-amylase inhibition and regulation of multiple pathways was investigated via computational and experimental studies. The phytocompounds were retrieved from plant databases and published literature. The druggability profile of these compounds was predicted using MolSoft. The probable targets of these phytocompounds were predicted using BindingDB (similarity index ≥ 0.7). Further, compound-gene set-pathway and functional enrichment analysis were performed using STRING and KEGG pathway databases. The network between compound-protein-pathway was constructed using Cytoscape. Molecular docking was performed using AutoDock Vina, executed through the POAP pipeline. The stability of the best docked complex was subjected to all-atom molecular dynamics (MD) simulation for 100 ns to investigate their structural stabilities and intermolecular interactions using GROMACS software. Finally, B. pilosa hydroalcoholic extract was subjected to LC-MS and tested for dose- and time-dependent alpha-amylase inhibitory activity. Out of 31 bioactive compounds, 13 were predicted to modulate the human pancreatic alpha-amylase (AMY2A) and 12 pathways associated with diabetes mellitus. PI3K-Akt signaling pathway (hsa04151) scored the lowest false discovery rate by triggering 15 genes. Further intermolecular interaction analysis of the docked complex revealed that Brassidin had the highest active site interaction and lowest binding energy compared to standard acarbose, and MD reveals the formation of a stable complex throughout 100 ns production run. LC-MS analysis revealed the presence of 13 compounds (targeting AMY2A) in B. pilosa hydroalcoholic extract, which showed potent AMY2A inhibition by in vitro studies that corroborate in silico findings for its anti-diabetic activity. Based on these findings, enriched fractions/pure compounds inhibitory activity that can be performed in future for drug discovery. Supplementary Information: The online version contains supplementary material available at 10.1007/s40203-023-00187-9.

Effects of exogenous steroid hormones on growth, body color, and gonadal development in the Opsariichthys bidens.

To investigate the effects of exogenous steroid hormones on growth, body color, and gonadal development in the Opsariichthys bidens (O. bidens), synthetic methyltestosterone (MT) and 17ß-estradiol (E2) were used for 28 days' treatment of 4-month-old O. bidens before the breeding season. Our results suggested that MT had a significant growth-promoting effect (P < 0.05), whereas E2 played an inhibitory role. On the body surface, the females in the MT group showed gray stripes, and the fish in other groups showed no obvious stripes. The males with MT treatment displayed brighter blue-green stripes compared to the CK and E2 groups. The histological analysis showed that the MT significantly promoted testes development in males, blocked oocyte development, and caused massive apoptosis in females, whereas the E2 group promoted ovarian development and inhibited testes development. Based on qRT-PCR analysis, in females, the expression of igf-1, dmrt1, and cyp19a1a genes revealed that E2 treatment resulted in down-regulation of igf-1 expression and up-regulation of cyp19a1a expression. In males, igf-1 and dmrt1 were significantly up-regulated after MT treatment, and E2 treatment led to down-regulation of igf-1. Therefore, this study demonstrates that MT and E2 play an important role in reversing the morphological sex characteristics of females and males.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Evidence for Dicot Plants as Alternative Hosts of Banana Bunchy Top Virus and Its Alphasatellites in South-East Asia.

Banana bunchy top virus is a multicomponent circular ssDNA virus (family Nanoviridae) that causes one of the most devastating diseases of cultivated bananas and plantains (family Musaceae). It is transmitted by the aphids Pentalonia nigronervosa and P. caladii among host plants of Musaceae and some other families of monocots. Our Illumina sequencing reconstruction of virome components of BBTV-infected banana plants and their neighbor non-banana plants sampled in Vietnam and Laos revealed the monocot Commelina sp. (Commelinaceae) and the dicots Bidens pilosa and Chromolaena odorata (both Asteraceae) as hosts of BBTV and circular ssDNA alphasatellites (family Alphasatellitidae). Counting the proportions and relative abundances of Illumina reads representing BBTV genome components and alphasatellites suggested that Chromolaena and Commelina are poor hosts for BBTV and one to three alphasatellite species, whereas Bidens is a permissive host for BBTV and four alphasatellite species representing two genera of Alphasatellitidae. Our findings provide evidence for the dicot plants of family Asteraceae as alternative hosts of BBTV and its alphasatellites, which warrants further investigation of these and other dicots as a potential refuge and source of BBTV and multiple alphasatellites that become associated with this virus and likely affect its replication, transmission, and host range.

A Bidens pilosa L. Non-Polar Extract Modulates the Polarization of Human Macrophages and Dendritic Cells into an Anti-Inflammatory Phenotype.

Different communities around the world traditionally use Bidens pilosa L. for medicinal purposes, mainly for its anti-inflammatory, antinociceptive, and antioxidant properties; it is used as an ingredient in teas or herbal medicines for the treatment of pain, inflammation, and immunological disorders. Several studies have been conducted that prove the immunomodulatory properties of this plant; however, it is not known whether the immunomodulatory properties of B. pilosa are mediated by its ability to modulate antigen-presenting cells (APCs) such as macrophages (MØs) and dendritic cells (DCs) (through polarization or the maturation state, respectively). Different polar and non-polar extracts and fractions were prepared from the aerial part of B. pilosa. Their cytotoxic and immunomodulatory effects were first tested on human peripheral blood mononuclear cells (PBMCs) and phytohemagglutinin (PHA)-stimulated PBMCs, respectively, via an MTT assay. Then, the non-cytotoxic plant extracts and fractions that showed the highest immunomodulatory activity were selected to evaluate their effects on human MØ polarization and DC maturation (cell surface phenotype and cytokine secretion) through multiparametric flow cytometry. Finally, the chemical compounds of the B. pilosa extract that showed the most significant immunomodulatory effects on human APCs were identified using gas chromatography coupled with mass spectrometry. The petroleum ether extract and the ethyl acetate and hydroalcoholic fractions obtained from B. pilosa showed low cytotoxicity and modulated the PHA-stimulated proliferation of PBMCs. Furthermore, the B. pilosa petroleum ether extract induced M2 polarization or a hybrid M1/M2 phenotype in MØs and a semi-mature status in DCs, regardless of exposure to a maturation stimulus. The immunomodulatory activity of the non-polar (petroleum ether) extract of B. pilosa on human PBMC proliferation, M2 polarization of MØs, and semi-mature status in DCs might be attributed to the low-medium polarity components in the extract, such as phytosterol terpenes and fatty acid esters.

Phytoremediation of Heavy Metal Contaminated Soil Using Bidens pilosa: Effect of Varying Concentrations of Sophorolipids.

The current study investigates the impact of biosurfactant (sophorolipids, SL) concentrations (0.1 to 1 g kg-1) on the removal of cadmium (29 mg kg-1) from soil using Bidens pilosa. The results showed that increasing concentrations of SL increased the plant biomass. The dry weight of plants was 0.87 g, 0.77 g, 0.65 g, 0.85 g, 0.91 g, 0.92 g, 1.06 g in control, SL0 (No SL), SL1 (0.1 g kg-1), SL2 (0.25 g kg-1), SL3 (0.5 g kg-1), SL4 (0.75 g kg-1), and SL5 (1 g kg-1), respectively. It was observed that root length was higher in SL augmented soil in comparison to treatments without SL. It was also found that, with increasing the SL concentration, total chlorophyll and proline concentrations increased as well. The SL2 treatment had the highest Cd accumulation (76.33 µg pot-1) in the plant. Therefore, SL at 0.25 g kg-1 was considered the most effective concentration for the phytoextraction of Cd from soil. Soil enzyme activities, i.e., alkaline phosphatase, dehydrogenase, and urease activity, increased with the increase in SL concentration. The results of this study concluded that SL promotes the removal of Cd from soil and supports plant growth as well as enzymatic activities in soil.

Multigene Phylogenies of the Estuarine Sesarmid Parasesarma bidens Species Complex (Decapoda: Brachyura: Sesarmidae), with Description of Three New Species.

S Parasesarma bidens (De Haan, 1835) is a common intertidal sesarmid crab that inhabits the estuarine and mangrove regions of East Asia, as well as Vietnam and the Philippines. Previous studies have suggested that P. bidens is a species complex composed of several species. Our findings indicated that the P. bidens species complex is monophyletic with six clades, as shown by reconstructed phylogenies based on mitochondrial 16S rDNA and cytochrome c oxidase subunit I, as well as nuclear 28S rDNA. Specimens of each clade exhibited different characters, including the morphology of the cheliped, anterior carapace, male gonopod 1, and female vulvae, as well as the coloration. Three species in this complex have been previously described: P. bidens (De Haan, 1835), P. cricotum (Rahayu & Davie, 2002), and P. sanguimanus Li, Shih & Ng, 2019. Here, we describe three additional species: P. continentale n. sp., P. insulare n. sp., and P. chiahsiang n. sp. Biogeographically, the range of P. bidens includes the southern margin of Korea, the main islands of Japan, and the Ryukyus, with a comparatively northern distribution. P. continentale is widely distributed from the continental coasts of southeastern and southern China (including northern Hainan Island) to southern Vietnam and is occasionally found in Penghu, Taiwan. Parasesarma insulare is an insular species distributed from Taiwan main island, the central Philippines, to northern Borneo. Finally, P. chiahsiang is mainly limited to the Penghu Islands (Pescadores) but is also sometimes found in Taiwan main island and the offshore Gueishan Island.

Anti-Inflammatory Effects of Miyako Bidens pilosa in a Mouse Model of Amyotrophic Lateral Sclerosis and Lipopolysaccharide-Stimulated BV-2 Microglia.

Neuroinflammation is a fundamental feature in the pathogenesis of amyotrophic lateral sclerosis (ALS) and arises from the activation of astrocytes and microglial cells. Previously, we reported that Miyako Bidens pilosa extract (MBP) inhibited microglial activation and prolonged the life span in a human ALS-linked mutant superoxide dismutase-1 (SOD1G93A) transgenic mouse model of ALS (G93A mice). Herein, we evaluated the effect of MBP on microglial activation in the spinal cord of G93A mice and lipopolysaccharide-stimulated BV-2 microglial cells. The administration of MBP inhibited the upregulation of the M1-microglia/macrophage marker (interferon-γ receptor (IFN-γR)) and pro-inflammatory cytokines (tumor necrosis factor (TNF)-α, interleukin (IL)-1ß, and IL-6) in G93A mice. However, MBP did not affect the increase in the M2-microglia/macrophage marker (IL-13R) and anti-inflammatory cytokines (transforming growth factor (TGF)-ß and IL-10) in G93A mice. BV-2 cell exposure to MBP resulted in a decrease in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) reduction activity and bromodeoxyuridine incorporation, without an increase in the number of ethidium homodimer-1-stained dead cells. Moreover, MBP suppressed the production of lipopolysaccharide-induced pro-inflammatory cytokines (TNF-α, IL-1ß, and IL-6) in BV-2 cells. These results suggest that the selective suppression of M1-related pro-inflammatory cytokines is involved in the therapeutic potential of MBP in ALS model mice.

Combining the Peptide RWQWRWQWR and an Ethanolic Extract of Bidens pilosa Enhances the Activity against Sensitive and Resistant Candida albicans and C. auris Strains.

The antifungal activity of palindromic peptide RWQWRWQWR and its derivatives was evaluated against clinical isolates of Candida albicans and C. auris. Also, Bidens pilosa ethanolic extracts of leaves and stem were evaluated. Furthermore, combinations of peptide, extract, and/or fluconazole (FLC) were evaluated. The cytotoxicity of peptides and extracts in erythrocytes and fibroblasts was determined. The original palindromic peptide, some derivative peptides, and the ethanolic extract of leaves of B. pilosa exhibited the highest activity in some of the strains evaluated. Synergy was obtained between the peptide and the FLC against C. auris 435. The combination of the extract and the original palindromic peptide against C. albicans SC5314, C. auris 435, and C. auris 537 decreased the minimal inhibitory concentrations (MICs) by a factor of between 4 and 16. These mixtures induced changes in cell morphology, such as deformations on the cell surface. The results suggest that the combination of RWQWRWQWR and B. pilosa extract is an alternative for enhancing antifungal activity and decreasing cytotoxicity and costs and should be considered to be a promising strategy for treating diseases caused by Candida spp.

Analysis of the complete plastomes of Bidens pilosa L. 1753 (Asteraceae, Coreopsideae) from Beijing, China reveals high genetic diversity and possible misidentifications.

Bidens pilosa L. 1753 is a perennial herbaceous flowering plant, traditionally used in foods and medicines. In this study, we sequenced, assembled, and characterized the complete plastome of B. pilosa from Beijing, China. The plastome (MN385242) is circularized with a conservative quadripartite structure. Its length is 150,524 bp, including a large single-copy region (83,535 bp), a small single-copy region (17,627 bp), and a pair of inverted repeat regions (each 24,681 bp). The plastome consists of 128 genes, including 78 unique protein-coding, 28 unique tRNA, and 4 unique rRNA genes. Phylogenetic analyses showed all five B. pilosa plants couldn't form a monophyletic clade and were separated into three clades. The results of K2P distance and molecular markers were all consistent with those of phylogenetic analysis, revealing high genetic diversity and even possible misidentifications of the B. pilosa. Our results highlighted the importance of correct species identification of materials in medicinal products.

Immunomodulatory Properties of Natural Extracts and Compounds Derived from Bidens pilosa L.: Literature Review.

Bidens pilosa L. has been used in different parts of the world mainly to treat diseases associated with immune response disorders, such as autoimmunity, cancer, allergies, and infectious diseases. The medicinal properties of this plant are attributed to its chemical components. Nevertheless, there is little conclusive evidence that describes the immunomodulatory activity of this plant. In this review, a systematic search was carried out in the PubMed-NLM, EBSCO Host and BVS databases focused on the pre-clinical scientific evidence of the immunomodulatory properties of B. pilosa. A total of 314 articles were found and only 23 were selected. The results show that the compounds or extracts of Bidens modulate the immune cells. This activity was associated with the presence of phenolic compounds and flavonoids that control proliferation, oxidative stress, phagocytosis, and the production of cytokines of different cells. Most of the scientific information analyzed in this paper supports the potential use of B. pilosa mainly as an anti-inflammatory, antioxidant, antitumoral, antidiabetic, and antimicrobial immune response modulator. It is necessary that this biological activity be corroborated through the design of specialized clinical trials that demonstrate the effectiveness in the treatment of autoimmune diseases, chronic inflammation, and infectious diseases. Until now there has only been one clinical trial in phase I and II associated with the anti-inflammatory activity of Bidens in mucositis.

(E)-7-phenyl-2-heptene-4,6-diyn-1-ol from Bidens pilosa as a repellent against isopods.

The development of repellents as alternatives to insecticides has expanded in recent years. However, their use in isopod pest control is limited. To develop an isopod repellent, a plant extract library from wild plants native to the Kochi Prefecture was screened for repellent activity against pillbugs, and 82 samples (87%) exhibited repellent activity. Among them, (E)-7-phenyl-2-heptene-4,6-diyn-1-ol was isolated and identified as a repellent from the root of Bidens pilosa. It had a half-maximal effective concentration of 0.20 µm, with a strong repellency. A study of the structure-activity relationship to (E)-7-phenyl-2-heptene-4,6-diyn-1-ol revealed that the presence of a hydroxyl group and an aromatic at both ends of the length of the seven-carbon chain is important for the expression of repellency. These results can potentially lead to a new repellent of phenylalkyl alcohol.

Variation in pollinator visitation among garden cultivars of marigold, portulaca, and bidens.

Due to declines in pollinator populations, many people are now interested in learning about which annual flowers they can plant in their garden to better support pollinators. However, reports of experimental evaluation of cultivars of annual flowers for attraction to pollinators are scarce. We sampled pollinators visiting six cultivars of marigold (Tagetes erecta and T. patula), ten cultivars of bidens (Bidens ferulifolia and B. aurea), and eight cultivars of portulaca (Portulaca oleracea and P. grandiflora) for two years to compare pollinator visitation rates among cultivars within each flower type. Pollinators collected on flowers in research plots were categorized into four groups, honey bees (Apis mellifera), common eastern bumble bees (Bombus impatiens), wild bees, and syrphids, to show the proportion of different pollinator visitors to each cultivar. Pollinator visitation rates varied significantly among cultivars of marigold, bidens, and portulaca, with some cultivars having as much as 10-fold the visitation rate of other cultivars of the same flower type. In the second year we also evaluated nectar production and nectar quality of the most and least visited cultivars of portulaca and bidens. Our results show that pollinators have a strong preference for cultivars that produce the most nectar or nectar with the highest sugar content. This research will better inform entomologists, growers, educators, and plant breeders, about which cultivars of marigold, portulaca, and bidens are visited the most by pollinators, and how to accurately determine this at the cultivar level.

Comparative study on plant growth-promoting bacterial inoculation by irrigation and spraying for promoting Bidens pilosa L. phytoremediation of cadmium-contaminated soil.

A field study was conducted to compare FM-1 inoculation by irrigation and spraying for promoting Bidens pilosa L. phytoremediation of cadmium (Cd)-contaminated soil. Cascading relationships between bacterial inoculation by irrigation and spraying and soil properties, plant growth-promoting traits, plant biomass and Cd concentrations in Bidens pilosa L. were explored based on the partial least squares path model (PLS-PM). The results indicated that inoculation with FM-1 not only improved the rhizosphere soil environment of B. pilosa L. but also increased the Cd extracted from the soil. Moreover, Fe and P in leaves play vital roles in promoting plant growth when FM-1 is inoculated by irrigation, while Fe in leaves and stems plays a vital role in promoting plant growth when FM-1 is inoculated by spraying. In addition, FM-1 inoculation decreased the soil pH by affecting soil dehydrogenase and oxalic acid in cases with irrigation and Fe in roots in cases with spraying. Thus, the soil bioavailable Cd content increased and promoted Cd uptake by Bidens pilosa L. To address Cd-induced oxidative stress, Fe in leaves helped to convert GSH into PCs, which played a vital role in ROS scavenging when FM-1 was inoculated by irrigation. The soil urease content effectively increased the POD and APX activities in the leaves of Bidens pilosa L., which helped alleviate Cd-induced oxidative stress when FM-1 was inoculated by spraying. This study compares and illustrates the potential mechanism by which FM-1 inoculation can improve the phytoremediation of Cd-contaminated soil by Bidens pilosa L., suggesting that FM-1 inoculation by irrigation and spraying is useful in the phytoremediation of Cd-contaminated sites.

Influencing Factors of Bidens pilosa L. Hyperaccumulating Cadmium Explored by the Real-Time Uptake of Cd2+ Influx around Root Apexes under Different Exogenous Nutrient Ion Levels.

Though Bidens pilosa L. has been confirmed to be a potential Cd hyperaccumulator, the accumulation mechanism is not yet clear. The dynamic and real-time uptake of Cd2+ influx by B. pilosa root apexes was determined using non-invasive micro-test technology (NMT), which partly explored the influencing factors of the Cd hyperaccumulation mechanism under the conditions of different exogenous nutrient ions. The results indicated that Cd2+ influxes at 300 µm around the root tips decreased under Cd treatments with 16 mM Ca2+, 8 mM Mg2+, 0.5 mM Fe2+, 8 mM SO42- or 18 mM K+ compared to single Cd treatments. The Cd treatments with a high concentration of nutrient ions showed an antagonistic effect on Cd2+ uptake. However, Cd treatments with 1 mM Ca2+, 0.5 mM Mg2+, 0.5 mM SO42- or 2 mM K+ had no effect on the Cd2+ influxes as compared with single Cd treatments. It is worth noting that the Cd treatment with 0.05 mM Fe2+ markedly increased Cd2+ influxes. The addition of 0.05 mM Fe2+ exhibited a synergistic effect on Cd uptake, which could be low concentration Fe2+ rarely involved in blocking Cd2+ influx and often forming an oxide membrane on the root surface to help the Cd uptake by B. pilosa. The results also showed that Cd treatments with high concentration of nutrient ions significantly increased the concentrations of chlorophyll and carotenoid in leaves and the root vigor of B. pilosa relative to single Cd treatments. Our research provides novel perspectives with respect to Cd uptake dynamic characteristics by B. pilosa roots under different exogenous nutrient ion levels, and shows that the addition of 0.05 mM Fe2+ could promote the phytoremediation efficiency for B. pilosa.

Analysis of the chloroplast genome and phylogenetic evolution of Bidens pilosa.

Chloroplast genomes for 3 Bidens plants endemic to China (Bidens bipinnata Linn., Bidens pilosa Linn., and Bidens alba var. radiata) have been sequenced, assembled and annotated in this study to distinguish their molecular characterization and phylogenetic relationships. The chloroplast genomes are in typical quadripartite structure with two inverted repeat regions separating a large single copy region and a small single copy region, and ranged from 151,599 to 154,478 bp in length. Similar number of SSRs and long repeats were found in Bidens, wherein mononucleotide repeats (A/T), forward and palindromic repeats were the most in abundance. Gene loss of clpP and psbD, IR expansion and contraction were detected in these Bidens plants. It seems that ndhE, ndhF, ndhG, and rpl32 from the Bidens plants were under positive selection while the majority of chloroplast genes were under purifying selection. Phylogenetic analysis revealed that 3 Bidens plants clustered together and further formed molophyletic clade with other Bidens species, indicating Bidens plants might be under radiation adaptive selection to the changing environment world-widely. Moreover, mutation hotspot analysis and in silico PCR analysis indicated that inter-genic regions of ndhD-ccsA, ndhI-ndhG, ndhF-rpl32, trnL_UAG-rpl32, ndhE-psaC, matK-rps16, rps2-atpI, cemA-petA, petN-psbM were candidate markers of molecular identification for Bidens plants. This study may provide useful information for genetic diversity analysis and molecular identification for Bidens species.