ABSTRACT
Polydopamine nanoparticles (PDA NPs) are widely utilized in the field of biomedical science for surface functionalization because of their unique characteristics, such as simple and low-cost preparation methods, good adhesive properties, and ability to incorporate amine and oxygen-rich chemical groups. However, challenges in the application of PDA NPs as surface coatings on electrode surfaces and in conjugation with biomolecules for electrochemical sensors still exist. In this work, we aimed to develop an electrochemical interface based on PDA NPs conjugated with a DNA aptamer for the detection of glycated albumin (GA) and to study DNA aptamers on the surfaces of PDA NPs to understand the aptamer-PDA surface interactions using molecular dynamics (MD) simulation. PDA NPs were synthesized by the oxidation of dopamine in Tris buffer at pH 10.5, conjugated with DNA aptamers specific to GA at different concentrations (0.05, 0.5, and 5 µM), and deposited on screen-printed carbon electrodes (SPCEs). The charge transfer resistance of the PDA NP-coated SPCEs decreased, indicating that the PDA NP composite is a conductive bioorganic material. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) confirmed that the PDA NPs were spherical, and dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR), and Raman spectroscopy data indicated the successful conjugation of the aptamers on the PDA NPs. The as-prepared electrochemical interface was employed for the detection of GA. The detection limit was 0.17 µg/mL. For MD simulation, anti-GA aptamer through the 5'terminal end in a single-stranded DNA-aptamer structure and NH2 linker showed a stable structure with its axis perpendicular to the PDA surface. These findings provide insights into improved biosensor design and have demonstrated the potential for employing electrochemical PDA NP interfaces in point-of-care applications.
ABSTRACT
Postoperative peritoneal adhesion (PPA) is a prevalent complication of abdominal surgery, posing a significant hindrance to postsurgical recovery. Although several strategies have been developed to alleviate and prevent adhesions, their efficacy remains unsatisfactory. For the first time, we studied the therapeutic effect and mechanism of our recently developed thermally stable oligonucleotide-based mimetics of hepatocyte growth factor (HGF DNA aptamer) to prevent PPA. The HGF DNA aptamer effectively inhibited canonical TGF-ß1 signaling transduction, partially suppressing mesothelial mesenchymal transition. Additionally, the aptamer, respectively, upregulated and downregulated the expression of tissue plasminogen activator and plasminogen activator inhibitor 1, thereby enhancing fibrinolytic activity. As a pleiotropic factor, the HGF DNA aptamer also enhanced the migratory and proliferative capacities of mesothelial cells. Finally, the aptamer demonstrated a higher level of effectiveness in preventing PPAs than the commercially available antiperitoneal adhesion barrier, Seprafilm. Due to its therapeutic benefits, excellent stability, biosafety, cost-effectiveness, and versatility, the HGF DNA aptamer demonstrates promise for preventing PPA in future clinical settings.
Subject(s)
Aptamers, Nucleotide , Epithelial-Mesenchymal Transition , Fibrinolysis , Hepatocyte Growth Factor , Aptamers, Nucleotide/chemistry , Aptamers, Nucleotide/pharmacology , Hepatocyte Growth Factor/metabolism , Tissue Adhesions/prevention & control , Humans , Fibrinolysis/drug effects , Epithelial-Mesenchymal Transition/drug effects , Biocompatible Materials/chemistry , Biocompatible Materials/pharmacology , Materials Testing , Particle Size , Postoperative Complications/prevention & controlABSTRACT
DNA aptamers have emerged as novel molecular tools in disease theranostics owing to their high binding affinity and specificity for protein targets, which rely on their ability to fold into distinctive three-dimensional (3D) structures. However, delicate atomic interactions that shape the 3D structures are often ignored when designing and modeling aptamers, leading to inefficient functional optimization. Challenges persist in determining high-resolution aptamer-protein complex structures. Moreover, the experimentally determined 3D structures of DNA molecules with exquisite functions remain scarce. These factors impede our comprehension and optimization of some important DNA aptamers. Here, we performed a streamlined solution NMR-based structural investigation on the 41-nt sgc8c, a prominent DNA aptamer used to target membrane protein tyrosine kinase 7, for cancer theranostics. We show that sgc8c prefolds into an intricate three-way junction (3WJ) structure stabilized by long-range tertiary interactions and extensive base-base stackings. Delineated by NMR chemical shift perturbations, site-directed mutagenesis, and 3D structural information, we identified essential nucleotides constituting the key functional elements of sgc8c that are centralized at the core of 3WJ. Leveraging the well-established structure-function relationship, we efficiently engineered two sgc8c variants by modifying the apical loop and introducing L-DNA base pairs to simultaneously enhance thermostability, biostability, and binding affinity for both protein and cell targets, a feat not previously attained despite extensive efforts. This work showcases a simplified NMR-based approach to comprehend and optimize sgc8c without acquiring the complex structure, and offers principles for the sophisticated structure-function organization of DNA molecules.
Subject(s)
Aptamers, Nucleotide , Nucleic Acid Conformation , Receptor Protein-Tyrosine Kinases , Aptamers, Nucleotide/chemistry , Aptamers, Nucleotide/metabolism , Aptamers, Nucleotide/genetics , Humans , Receptor Protein-Tyrosine Kinases/metabolism , Receptor Protein-Tyrosine Kinases/chemistry , Receptor Protein-Tyrosine Kinases/genetics , Models, Molecular , Magnetic Resonance Spectroscopy/methods , Protein Binding , Cell Adhesion MoleculesABSTRACT
We developed an aptamer-based fluorescence resonance energy transfer (FRET) assay capable of recognizing therapeutic monoclonal antibody bevacizumab and rapidly quantifying its concentration with just one mixing step. In this assay, two fluorescent dyes (fluorescein and tetramethylrhodamine) labeled aptamers bind to two Fab regions on bevacizumab, and FRET fluorescence is observed when both dyes come into close proximity. We optimized this assay in three different formats, catering to a wide range of analytical needs. When applied to hybridoma culture samples in practical settings, this assay exhibited a signal response that was concentration-dependent, falling within the range of 50-2000 µg/mL. The coefficients of determination (r2) ranged from 0.998 to 0.999, and bias and precision results were within ±24.0 % and 20.3 %, respectively. Additionally, during thermal and UV stress testing, this assay demonstrated the ability to detect denatured samples in a manner comparable to conventional Size Exclusion Chromatography. Notably, it offers the added advantage of detecting decreases in binding activity without changes in molecular weight. In contrast to many existing process analytical technology tools, this assay not only identifies bevacizumab but also directly measures the quality attributes related to mAb efficacy, such as the binding activity. As a result, this assay holds great potential as a valuable platform for providing highly reliable quality attribute information in real-time. We consider this will make a significant contribution to the worldwide distribution of high-quality therapeutic mAbs in various aspects of antibody manufacturing, including production monitoring, quality control, commercial lot release, and stability testing.
Subject(s)
Aptamers, Nucleotide , Bevacizumab , Fluorescence Resonance Energy Transfer , Bevacizumab/analysis , Bevacizumab/chemistry , Fluorescence Resonance Energy Transfer/methods , Aptamers, Nucleotide/chemistry , Antibodies, Anti-Idiotypic/chemistry , Antibodies, Anti-Idiotypic/analysis , Humans , Fluorescent Dyes/chemistryABSTRACT
BACKGROUND: Yersinia pestis is a bacterium that causes the disease plague. It has caused the deaths of many people throughout history. The bacterium possesses several virulence factors (pPla, pFra, and PYV). PFra plasmid encodes fraction 1 (F1) capsular antigen. F1 protein protects the bacterium against host immune cells through phagocytosis process. This protein is specific for Y. pestis. Many diagnostic techniques are based on molecular and serological detection and quantification of F1 protein in different food and clinical samples. Aptamers are small nucleic acid sequences that can act as specific ligands for many targets.This study, aimed to isolate the high-affinity ssDNA aptamers against F1 protein. METHODS AND RESULTS: In this study, SELEX was used as the main strategy in screening aptamers. Moreover, enzyme-linked aptamer sorbent assay (ELASA) and surface plasmon resonance (SPR) were used to determine the affinity and specificity of obtained aptamers to F1 protein. The analysis showed that among the obtained aptamers, the three aptamers of Yer 21, Yer 24, and Yer 25 were selected with a KD value of 1.344E - 7, 2.004E - 8, and 1.68E - 8 M, respectively. The limit of detection (LoD) was found to be 0.05, 0.076, and 0.033 µg/ml for Yer 21, Yer 24, and Yer 25, respectively. CONCLUSION: This study demonstrated that the synthesized aptamers could serve as effective tools for detecting and analyzing the F1 protein, indicating their potential value in future diagnostic applications.
Subject(s)
Aptamers, Nucleotide , Bacterial Proteins , SELEX Aptamer Technique , Yersinia pestis , Yersinia pestis/genetics , SELEX Aptamer Technique/methods , Bacterial Proteins/genetics , Surface Plasmon Resonance/methods , Humans , Plague/diagnosis , Plague/microbiology , Antigens, BacterialABSTRACT
Type 2 diabetes mellitus (T2DM) is a risk factor for male infertility, but the underlying molecular mechanisms remain unclear. Advanced glycation end products (AGEs) are pathogenic molecules for diabetic vascular complications. Here, we investigated the effects of the DNA aptamer raised against AGEs (AGE-Apt) on testicular and sperm abnormalities in a T2DM mouse model. KK-Ay (DM) and wild-type (non-DM) 4- and 7-week-old male mice were sacrificed to collect the testes and spermatozoa for immunofluorescence, RT-PCR, and histological analyses. DM and non-DM 7-week-old mice were subcutaneously infused with the AGE-Apt or control-aptamer for 6 weeks and were then sacrificed. Plasma glucose, testicular AGEs, and Rage gene expression in 4-week-old DM mice and plasma glucose, testicular AGEs, oxidative stress, and pro-inflammatory gene expressions in 7-week-old DM mice were higher than those in age-matched non-DM mice, the latter of which was associated with seminiferous tubular dilation. AGE-Apt did not affect glycemic parameters, but it inhibited seminiferous tubular dilation, reduced the number of testicular macrophages and apoptotic cells, and restored the decrease in sperm concentration, motility, and viability of 13-week-old DM mice. Our findings suggest that AGEs-Apt may improve sperm abnormality by suppressing AGE-RAGE-induced oxidative stress and inflammation in the testes of DM mice.
Subject(s)
Aptamers, Nucleotide , Diabetes Mellitus, Experimental , Diabetes Mellitus, Type 2 , Glycation End Products, Advanced , Inflammation , Oxidative Stress , Receptor for Advanced Glycation End Products , Sperm Motility , Testis , Animals , Male , Oxidative Stress/drug effects , Glycation End Products, Advanced/metabolism , Mice , Aptamers, Nucleotide/pharmacology , Testis/metabolism , Testis/drug effects , Testis/pathology , Receptor for Advanced Glycation End Products/metabolism , Diabetes Mellitus, Experimental/metabolism , Sperm Motility/drug effects , Diabetes Mellitus, Type 2/metabolism , Diabetes Mellitus, Type 2/pathology , Inflammation/metabolism , Inflammation/pathology , Spermatozoa/metabolism , Spermatozoa/drug effects , Sperm CountABSTRACT
Single-chain fragment variables (scFvs), composed of variable heavy and light chains joined together by a peptide linker, can be produced using a cost-effective bacterial expression system, making them promising candidates for pharmaceutical applications. However, a versatile method for monitoring recombinant-protein production has not yet been developed. Herein, we report a novel anti-scFv aptamer-based biosensing system with high specificity and versatility. First, anti-scFv aptamers were screened using the competitive systematic evolution of ligands by exponential enrichment, focusing on a unique scFv-specific peptide linker. We selected two aptamers, P1-12 and P2-63, with KD = 2.1 µM or KD = 1.6 µM toward anti-human epidermal growth factor receptor (EGFR) scFv, respectively. These two aptamers can selectively bind to scFv but not to anti-EGFR Fv. Furthermore, the selected aptamers recognized various scFvs with different CDRs, such as anti-4-1BB and anti-hemoglobin scFv, indicating that they recognized a unique peptide linker region. An electrochemical sensor for anti-EGFR scFv was developed using anti-scFv aptamers based on square wave voltammetry. Thus, the constructed sensor could monitor anti-EGFR scFv concentrations in the range of 10-500 nM in a diluted medium for bacterial cultivation, which covered the expected concentration range for the recombinant production of scFvs. These achievements promise the realization of continuous monitoring sensors for pharmaceutical scFv, which will enable the real-time and versatile monitoring of large-scale scFv production.
Subject(s)
Aptamers, Nucleotide , Biosensing Techniques , ErbB Receptors , Single-Chain Antibodies , Aptamers, Nucleotide/chemistry , Biosensing Techniques/methods , Single-Chain Antibodies/chemistry , Single-Chain Antibodies/immunology , Humans , Recombinant Proteins/genetics , SELEX Aptamer Technique/methods , Electrochemical Techniques/methodsABSTRACT
Overactive or dysregulated cytokine expression is a hallmark of many acute and chronic inflammatory diseases. This is true for acute or chronic infections, neurodegenerative diseases, autoimmune diseases, cardiovascular diseases, cancer, and others. Cytokines such as interleukin-6 (IL-6) are known therapeutic targets and biomarkers for such inflammatory diseases. Platforms for cytokine detection are, therefore, desirable tools for both research and clinical applications. Single-walled carbon nanotubes (SWCNT) are versatile nanomaterials with near-infrared fluorescence that can serve as transducers for optical sensors. When functionalized with an analyte-specific recognition element, SWCNT emission may become sensitive and selective toward the desired target. SWCNT-aptamer sensors are easily assembled, inexpensive, and biocompatible. In this work, we introduced a nanosensor design based on SWCNT and a DNA aptamer specific to IL-6. We first evaluated several SWCNT-aptamer constructs based on this simple direct complexation method, wherein the aptamer both solubilizes the SWCNT and confers sensitivity to IL-6. The sensor limit of detection, 105 ng/mL, lies in the relevant range for pathological IL-6 levels. Upon investigation of sensor kinetics, we found rapid response within seconds of antigen addition which continued over the course of 3 h. We found that this sensor construct is stable and the aptamer is not displaced from the nanotube surface during IL-6 detection. Finally, we investigated the ability of this sensor construct to detect macrophage activation caused by bacterial lipopolysaccharides (LPS) in an in vitro model of disease, finding rapid and sensitive detection of macrophage-expressed IL-6. We are confident that further development of this sensor will have novel implications for diagnosis of acute and chronic inflammatory diseases, in addition to contributing to the understanding of the role of cytokines in these diseases.
Subject(s)
Aptamers, Nucleotide , Biosensing Techniques , Interleukin-6 , Macrophage Activation , Nanotubes, Carbon , Aptamers, Nucleotide/chemistry , Interleukin-6/analysis , Biosensing Techniques/methods , Nanotubes, Carbon/chemistry , Bacterial Toxins/immunology , Humans , Mice , Animals , Cytokines/analysis , Cytokines/metabolism , RAW 264.7 Cells , Limit of DetectionABSTRACT
Background: Oligomeric amyloid beta (oAß) is a toxic factor that acts in the early stage of Alzheimer's disease (AD) and may initiate the pathologic cascade. Therefore, detecting oAß has a crucial role in the early diagnosis, monitoring, and treatment of AD. Purpose: The purpose of this study was to evaluate MRI signal changes in different mouse models and the time-dependent signal changes using our novel gadolinium (Gd)-dodecane tetraacetic acid (DOTA)- ob5 aptamer contrast agent. Methods: We developed an MRI contrast agent by conjugating Gd-DOTA-DNA aptamer called ob5 to evaluate its ability to detect oAß deposits in the brain using MRI. A total of 10 control mice, 9 3xTg AD mice, and 11 APP/PS/Tau AD mice were included in this study, with the age of each model being 16 or 36 weeks. A T1-weighted image was acquired at the time points before (0 min) and after injection of the contrast agent at 5, 10, 15, 20, and 25 min. The analyses were performed to compare MRI signal differences among the three groups and the time-dependent signal differences in different mouse models. Results: Both 3xTg AD and APP/PS/Tau AD mouse models had higher signal enhancement than control mice at all scan-time points after injection of our contrast media, especially in bilateral hippocampal areas. In particular, all Tg AD mouse models aged 16 weeks showed a higher contrast enhancement than those aged 36 weeks. For 3xTg AD and APP/PS/Tau AD groups, the signal enhancement was significantly different among the five time points (0 min, 5 min, 10 min, 15 min, 20 min, and 25 min) in multiple ROI areas, typically in the bilateral hippocampus, left thalamus, and left amygdala. Conclusion: The findings of this study suggest that the expression of the contrast agent in different AD models demonstrates its translational flexibility across different species. The signal enhancement peaked around 15-20 min after injection of the contrast agent. Therefore, our novel contrast agent targeting oAß has the potential ability to diagnose early AD and monitor the progression of AD.
ABSTRACT
DNA aptamers can bind specifically to biomolecules to modify their function, potentially making them ideal oligonucleotide therapeutics. Herein, we screened for DNA aptamer of melanopsin (OPN4), a blue-light photopigment in the retina, which plays a key role using light signals to reset the phase of circadian rhythms in the central clock. Firstly, 15 DNA aptamers of melanopsin (Melapts) were identified following eight rounds of Cell-SELEX using cells expressing melanopsin on the cell membrane. Subsequent functional analysis of each Melapt was performed in a fibroblast cell line stably expressing both Period2:ELuc and melanopsin by determining the degree to which they reset the phase of mammalian circadian rhythms in response to blue-light stimulation. Period2 rhythmic expression over a 24-h period was monitored in Period2:ELuc stable cell line fibroblasts expressing melanopsin. At subjective dawn, four Melapts were observed to advance phase by >1.5 h, while seven Melapts delayed phase by >2 h. Some Melapts caused a phase shift of approximately 2 h, even in the absence of photostimulation, presumably because Melapts can only partially affect input signaling for phase shift. Additionally, some Melaps were able to induce phase shifts in Per1::luc transgenic (Tg) mice, suggesting that these DNA aptamers may have the capacity to affect melanopsin in vivo. In summary, Melapts can successfully regulate the input signal and shifting phase (both phase advance and phase delay) of mammalian circadian rhythms in vitro and in vivo.
ABSTRACT
The ongoing SARS-CoV-2 pandemic has underscored the urgent need for versatile and rapidly deployable antiviral strategies. While vaccines have been pivotal in controlling the spread of the virus, the emergence of new variants continues to pose significant challenges to global health. Here, our study focuses on a novel approach to antiviral therapy using DNA aptamers, short oligonucleotides with high specificity and affinity for their targets, as potential inhibitors against the spike protein of SARS-CoV-2 variants Omicron and JN.1. Our research utilizes steered molecular dynamics (SMD) simulations to elucidate the binding mechanisms of a specifically designed DNA aptamer, AM032-4, to the receptor-binding domain (RBD) of the aforementioned variants. The simulations reveal detailed molecular insights into the aptamer-RBD interaction, demonstrating the aptamer's potential to maintain effective binding in the face of rapid viral evolution. Our work not only demonstrates the dynamic interaction between aptamer-RBD for possible antiviral therapy but also introduces a computational method to study aptamer-protein interactions.
Subject(s)
Aptamers, Nucleotide , Molecular Dynamics Simulation , Protein Binding , SARS-CoV-2 , Spike Glycoprotein, Coronavirus , Aptamers, Nucleotide/chemistry , Aptamers, Nucleotide/metabolism , SARS-CoV-2/metabolism , Spike Glycoprotein, Coronavirus/metabolism , Spike Glycoprotein, Coronavirus/chemistry , Humans , Binding Sites , Antiviral Agents/chemistry , Antiviral Agents/pharmacology , Protein Domains , COVID-19/virology , COVID-19/metabolism , COVID-19 Drug TreatmentABSTRACT
Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.
Subject(s)
Aptamers, Nucleotide , Biosensing Techniques , Ciprofloxacin , Molecular Docking Simulation , Molecular Dynamics Simulation , Ciprofloxacin/chemistry , Ciprofloxacin/analysis , Aptamers, Nucleotide/chemistry , Biosensing Techniques/methods , Computer SimulationABSTRACT
Thrombosis leads to elevated mortality rates and substantial medical expenses worldwide. Human factor IXa (HFIXa) protease is pivotal in tissue factor (TF)-mediated thrombin generation, and represents a promising target for anticoagulant therapy. We herein isolated novel DNA aptamers that specifically bind to HFIXa through systematic evolution of ligands by exponential enrichment (SELEX) method. We identified two distinct aptamers, seq 5 and seq 11, which demonstrated high binding affinity to HFIXa (Kd = 74.07 ± 2.53 nM, and 4.93 ± 0.15 nM, respectively). Computer software was used for conformational simulation and kinetic analysis of DNA aptamers and HFIXa binding. These aptamers dose-dependently prolonged activated partial thromboplastin time (aPTT) in plasma. We further rationally optimized the aptamers by truncation and site-directed mutation, and generated the truncated forms (Seq 5-1t, Seq 11-1t) and truncated-mutated forms (Seq 5-2tm, Seq 11-2tm). They also showed good anticoagulant effects. The rationally and structurally designed antidotes (seq 5-2b and seq 11-2b) were competitively bound to the DNA aptamers and effectively reversed the anticoagulant effect. This strategy provides DNA aptamer drug-antidote pair with effective anticoagulation and rapid reversal, developing advanced therapies by safe, regulatable aptamer drug-antidote pair.
Subject(s)
Antidotes , Aptamers, Nucleotide , Factor IXa , Aptamers, Nucleotide/chemistry , Aptamers, Nucleotide/pharmacology , Humans , Factor IXa/antagonists & inhibitors , Factor IXa/metabolism , Antidotes/pharmacology , Antidotes/chemistry , Antidotes/chemical synthesis , Dose-Response Relationship, Drug , Anticoagulants/pharmacology , Anticoagulants/chemistry , Structure-Activity Relationship , Molecular Structure , SELEX Aptamer TechniqueABSTRACT
Interleukin (IL)-23 inhibitor monoclonal antibodies shown significant efficacy in treating autoimmune diseases. DNA or RNA aptamers exhibit comparable specificity to antibodies, are cost-effective, non-immunogenic, and do not have batch to batch variation. This study aimed to characterize a single-stranded DNA (ssDNA) aptamer targeting human IL-23. The alpha subunit of IL-23 (P19) and intact IL-23 were cloned, expressed, and the proteins finally were purified through Ni2+-iminodiacetic acid affinity chromatography. The selection and characterization of ssDNA aptamer against P19 were conducted using the protein-systematic evolution of ligands by exponential enrichment (SELEX). Dot blot assay was carried out to monitor binding of the aptamer output of SELEX rounds, to P19 protein. The dissociation constant (Kd) of aptamers with positive results in dot blot assay, determined based on their binding to IL-23 using an ELISA method. Recombinant P19 and IL-23 proteins were 26 and 72â¯kDa, respectively, observed on SDS-PAGE .12â¯%. The aptamers output from 7, 8, 9, 10, 11, and 12 rounds of the SELEX was monitored by dot blot assay, revealing that the aptamer from the round 8 has stronger luminescent signal and was selected for TA-cloning. After analyzing the biotinylated aptamers from clones, positive clones in dot blot assay and ELISA were sequenced. Finally, the Kd calculation revealed three aptamers with high affinity, named A23P3, A23P6, and A23P15 with Kd values of 1.37, 2.139, and 2.88â¯nM, respectively. Results of this study introduced three specific anti-IL-23 ssDNA aptamers with high affinity, which could be utilized for therapeutic and diagnostic purposes.
Subject(s)
Aptamers, Nucleotide , DNA, Single-Stranded , SELEX Aptamer Technique , Aptamers, Nucleotide/chemistry , SELEX Aptamer Technique/methods , Humans , Interleukin-23/antagonists & inhibitors , Recombinant Proteins , Interleukin-23 Subunit p19/antagonists & inhibitors , Chromatography, Affinity/methodsABSTRACT
Problems with breathing and lung function are caused by the development of various lung diseases associated with lifestyle, harmful environmental factors and genetic predisposition. Knowledge of the molecular mechanisms of the development of the pathological process will allow on time identification of the disease or the development of targeted therapy. The article provides an overview of modern methods that make it possible to most accurately reproduce the structural, functional and mechanical properties of the lung (organ-on-a-chip), to perform non-invasive molecular studies of biomarkers of bronchopulmonary pathology using saliva diagnostics, as well as using DNA and RNA aptamers, verify tumor markers in biological samples of human tissue. Analysis of alterations in the pattern of protein glycosylation using glycodiagnostic methods makes it possible to detect lung cancer in the early stages.
Subject(s)
Lung Neoplasms , Lung , Humans , Lung Neoplasms/diagnosis , Biomarkers, TumorABSTRACT
Detection of progression is of great importance to breast cancer treatment and can benefit patients. Limited by current detection technologies and biomarkers, early breast cancer progression diagnosis remains challenging. Researchers have found blood extracellular vesicles (EVs)-derived integrin α6ß4 directly facilitate progression in breast cancer, enabling cancer detection. However, EVs size and heterogeneity hinder protein detection, masked by abundant background EVs. Hence, novel tools for efficient detection of EVs with high selectivity and low interference are significantly desired. Here, a new silver-coated gold nanorods SERS probe, termed as Au@Ag@IDA-B/4MSTP, based on DNA aptamer was established for the detection of integrin α6ß4 derived from EVs. Validation of the Au@Ag@IDA-B/4MSTP probes using cell-culture-derived EVs revealed a LOD of 23 particles/µL for EVs detection. This tool was further confirmed to mimic the real state of cancer with subcutaneous tumor model and lung metastasis model in mice. With 10 µL of blood plasma and simple Raman analysis process, the test achieved 85.7 % sensitivity and 83.3 % specificity. Moreover, our method achieves a simplified approach that expedites the detection process. These results demonstrate the good detection performance of Au@Ag@IDA-B/4MSTP probes for EVs integrin α6ß4, and suggest that this non-invasive approach could be a promising tool for early detection of breast cancer progression.
Subject(s)
Breast Neoplasms , Extracellular Vesicles , Gold , Integrin alpha6beta4 , Spectrum Analysis, Raman , Spectrum Analysis, Raman/methods , Extracellular Vesicles/chemistry , Extracellular Vesicles/metabolism , Breast Neoplasms/pathology , Breast Neoplasms/metabolism , Animals , Female , Gold/chemistry , Humans , Mice , Integrin alpha6beta4/metabolism , Nanotubes/chemistry , Silver/chemistry , Aptamers, Nucleotide/chemistry , Disease Progression , Mice, Inbred BALB C , Surface PropertiesABSTRACT
Overactive or dysregulated cytokine expression is hallmark of many acute and chronic inflammatory diseases. This is true for acute or chronic infection, neurodegenerative diseases, autoimmune diseases, cardiovascular disease, cancer, and others. Cytokines such as interleukin-6 (IL-6) are known therapeutic targets and biomarkers for such inflammatory diseases. Platforms for cytokine detection are therefore desirable tools for both research and clinical applications. Single-walled carbon nanotubes (SWCNT) are versatile nanomaterials with near-infrared fluorescence that can serve as transducers for optical sensors. When functionalized with an analyte-specific recognition element, SWCNT emission may become sensitive and selective towards the desired target. SWCNT-aptamer sensors are easily assembled, inexpensive, and biocompatible. In this work, we introduced a nanosensor design based on SWCNT and a DNA aptamer specific to IL-6. We first evaluated several SWCNT-aptamer constructs based on this simple direct complexation method, wherein the aptamer both solubilizes the SWCNT and confers sensitivity to IL-6. The sensor limit of detection, 105 ng/mL, lies in the relevant range for pathological IL-6 levels. Upon investigation of sensor kinetics, we found rapid response within seconds of antigen addition which continued over the course of three hours. We found that this sensor construct is stable, and the aptamer is not displaced from the nanotube surface during IL-6 detection. Finally, we investigated the ability of this sensor construct to detect macrophage activation caused by bacterial lipopolysaccharides (LPS) in an in vitro model of disease, finding rapid and sensitive detection of macrophage-expressed IL-6. We are confident further development of this sensor will have novel implications for diagnosis of acute and chronic inflammatory diseases, in addition to contributing to the understanding of the role of cytokines in these diseases.
ABSTRACT
Multidrug resistance (MDR) is a major factor in the failure of many forms of tumor chemotherapy. Development of a specific ligand for MDR-reversal would enhance the intracellular accumulation of therapeutic agents and effectively improve the tumor treatments. Here, an aptamer was screened against a doxorubicin (DOX)-resistant human hepatocellular carcinoma cell line (HepG2/DOX) via cell-based systematic evolution of ligands by exponential enrichment. A 50 nt truncated sequence termed d3 was obtained with high affinity and specificity for HepG2/DOX cells. Multidrug resistance protein 1 (MDR1) is determined to be a possible recognition target of the selected aptamer. Aptamer d3 binding was revealed to block the MDR of the tumor cells and increase the accumulation of intracellular anticancer drugs, including DOX, vincristine, and paclitaxel, which led to a boost to the cell killing of the anticancer drugs and lowering their survival of the tumor cells. The aptamer d3-mediated MDR-reversal for effective chemotherapy was further verified in an in vivo animal model, and combination of aptamer d3 with DOX significantly improved the suppression of tumor growth by treating a xenograft HepG2/DOX tumor in vivo. This work demonstrates the feasibility of a therapeutic DNA aptamer as a tumor MDR-reversal agent, and combination of the selected aptamer with chemotherapeutic drugs shows great potential for liver cancer treatments.
Subject(s)
Antineoplastic Agents , Drug Resistance, Neoplasm , Animals , Humans , Antineoplastic Agents/pharmacology , Antineoplastic Agents/therapeutic use , Drug Resistance, Multiple , Doxorubicin/pharmacology , Doxorubicin/therapeutic use , Drug Therapy, Combination , Cell Line, TumorABSTRACT
Infections caused by yeasts of the genus Candida are likely to occur not only in immunocompromised patients but also in healthy individuals, leading to infections of the gastrointestinal tract, urinary tract, and respiratory tract. Due to the rapid increase in the frequency of reported Candidiasis cases in recent years, diagnostic research has become the subject of many studies, and therefore, we developed a polyclonal aptamer library-based fluorometric assay with high specificity and affinity towards Candida spec. to quantify the pathogens in clinical samples with high sensitivity. We recently obtained the specific aptamer library R10, which explicitly recognized Candida and evolved it by mimicking an early skin infection model caused by Candida using the FluCell-SELEX system. In the follow-up study presented here, we demonstrate that the aptamer library R10-based bioassay specifically recognizes invasive clinical Candida isolates, including not only C. albicans but also strains like C. tropcialis, C. krusei, or C. glabrata. The next-generation fluorometric bioassay presented here can reliably and easily detect an early Candida infection and could be used for further clinical research or could even be developed into a full in vitro diagnostic tool.
Subject(s)
Candida , Candidiasis , Humans , Follow-Up Studies , Candidiasis/diagnosis , Candidiasis/drug therapy , Candida glabrata , Antifungal Agents/therapeutic useABSTRACT
Recombinant human bone morphogenetic protein 2 (rhBMP-2) is an FDA-approved growth factor for bone regeneration and repair in medical practice. The therapeutic effects of rhBMP-2 may be enhanced through specific binding to extracellular matrix (ECM)-like scaffolds. Here, we report the selection of a novel rhBMP-2-specific DNA aptamer, functionalization of the aptamer in an ECM-like scaffold, and its application in a cellular context. A DNA aptamer BA1 was evolved and shown to have high affinity and specificity to rhBMP-2. A molecular docking model demonstrated that BA1 was probably bound to rhBMP-2 at its heparin-binding domain, as verified with experimental competitive binding assays. The BA1 aptamer was used to functionalize a type I collagen scaffold, and fraction ratios were optimized to mimic the natural ECM. Studies in the myoblast cell model C2C12 showed that the aptamer-enhanced scaffold could specifically augment the osteo-inductive function of rhBMP-2 in vitro. This aptamer-functionalized scaffold may have value in enhancing rhBMP-2-mediated bone regeneration.