Genetic and clinical characterization of familial renal glucosuria.

Background: Familial renal glucosuria (FRG) is a hereditary disorder caused by variants in SLC5A2 encoding sodium-glucose cotransporter 2 (SGLT2). In this study, we aimed to characterize proximal tubule solute transport, glucagon secretion and the genotype-phenotype relationship in FRG patients. Methods: We sequenced SLC5A2 and PDZK1IP1 in 21 FRG patients and measured the renal threshold of glucose (RTG) in 15 patients. We built an open-source online calculator of RTG, evaluated the proximal tubule transport of amino acid, uric acid and phosphate, and explored glucagon secretion after glucose ingestion in FRG patients. Results: We identified 12 novel SLC5A2 variants (G484D, R564W, A212S, c.574+1G>C, W649*, S592Cfs*6, Q579*, Y339*, V39F, G491E, A464E and G360D) in our cohort and yielded 111 SLC5A2 variants from literature review. RTG in our cohort ranged from 1.0 to 9.2 mmol/L. Patients with two SLC5A2 variants had lower RTG (3.9 vs 6.2 mmol/L) and higher 24-h urinary glucose excretion (24hUG) than single-variant carriers (291.0 vs 40.0 mmol/1.73 m2). Patients with homozygous missense or in-frame indels had mean 24hUG of 457.2 mmol/1.73 m2, comparable to those with homozygous truncating variants (445.0 mmol/1.73 m2) and significantly more than those with homozygous splicing variants (196.6 mmol/1.73 m2). Patients with homozygous missense variants involving conservative residues (582.0 mmol/1.73 m2) had more 24hUG than those with variants at non-conservative residues (257.6 mmol/1.73 m2). Four out of 14 tested patients had mild aminoaciduria. The RTG of FRG patients had no significant correlation to phosphate reabsorption but a potential negative correlation to the fractional excretion of uric acid. Postprandial suppression of glucagon secretion was absent in most FRG patients. Conclusions: We built a comprehensive map showing the impact of SLC5A2 variant type and variant location on glucosuria severity. Our results highlighted the role of key residues in maintaining the transport function of SGLT2 and the functional link between glucosuria and reabsorption of amino acid and uric acid in FRG patients.

Rare Genetic Kidney Diseases: Windows of Precision Nephrology / 罕见病研究

As an important category of rare diseases, rare genetic kidney diseases have many types. In recent years, their diagnosis, treatment, research and management strategies have made great progress. Continuously more new genes and mechanisms have been discovered, giving rise to new technologies and drugs for precision medicine and clinical applications. This article systematically analyzes rare diseases involving the urinary system listed in the catalog of rare diseases in China, gives examples to illustrate the research and management methods for the diagnosis and treatment of rare genetic kidney diseases, promotes clinical applications of new drugs by expanding physiological mechanisms, introduces the application of special blood purification in the field of critical rare diseases, and provides an outlook forward to the future prospects of precise diagnosis and treatment of rare kidney diseases in China.

Familial Renal Glucosuria Presenting as Paroxysmal Glucosuria and Hypercalciuria Due to a Novel SLC5A2 Heterozygous Variant.

Familial renal glucosuria (FRG) is a rare genetic disease characterised by isolated glucosuria in the absence of proximal tubular dysfunction. It usually occurs due to a mutation in the SLC5A2 gene encoding the sodium-glucose cotransporter-2 (SGLT2), responsible for most of the renal glucose reabsorption. We report on a case of a patient presenting with paroxysmal glucosuria and hypercalciuria due to a novel SLC5A2 heterozygous variant. LEARNING POINTS: FRG usually presents with glucosuria but may also be associated with hypercalciuria and aminoaciduria.The amount of glucosuria is variable and can be normal in the same FRG patient because it is influenced by different glycaemia levels. This raises the question of whether the definition of FRG should be broadened to paroxysmal glucosuria.Having glucosuria does not prevent the development of insulin resistance.

Case report: Identification of three novel compound heterozygous SGLT2 variants in three Chinese pediatric patients with familial renal glucosuria.

Familial renal glucosuria (FRG) is a rare genetic condition featured by isolated glucosuria without hyperglycemia or other kidney diseases. It is caused by pathogenic mutations of the SGLT2 (Sodium-Glucose Cotransporter 2) gene, whose protein product is responsible for reabsorbing the majority of glucose in the early proximal convoluted tubule. Hitherto, quite an array of variants of SGLT2 have been identified in patients of FRG. In this study, we performed whole exome sequencing on three Chinese pediatric patients with FRG and uncovered three compound heterozygous variants of SGLT2: c.1333C > T (p.Q445X) and c.1130-5 C > G; c.1438G > T (p.V480F) and c.346G > A (p.V116M); c.1175C > G (p.S392C) and c.1333C > T (p.Q445X). Among the total of five variants, c.1333C > T (p.Q445X), c.1438G > T (p.V480F) and c.1175C > G (p.S392C) represented novel variants that had not been reported in any genetic databases. All five variants had extremely low allele frequencies and the amino acids loci affected by missense variants were highly conserved in vertebrate species. Bioinformatic tools predicted that all five variants might disrupt the function of SGLT2, which were likely to be causal for FRG in these patients. Our findings expand the variant spectrum of SGLT2 associated with FRG and provide novel insights into mechanism of action of this transporter, which will aid in the development of novel SGLT2 inhibitors for treatment of type 2 diabetes and cardiovascular diseases.

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. CONCLUSION: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Clinical and genetic analysis in a family with familial renal glucosuria: Identification of an N101K mutation in the sodium-glucose cotransporter 2 encoded by a solute carrier family 5 member 2 gene.

We report the identification of a mutation in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium-glucose cotransporter 2, in a family with familial renal glucosuria. The proband was a 26-year-old Japanese man referred to the diabetes division with repeated glucosuria without hyperglycemia. His mother, uncle and grandfather also had a history of glucosuria. A heterozygous missense mutation (c.303T>A:p.N101K) in SLC5A2 was identified in the patient and his mother, but not in 200 chromosomes from 100 healthy and unrelated individuals, or in 3,408 Japanese individuals in the Tohoku Medical Megabank. Furthermore, bioinformatics software predicted that this lesion would be pathogenic. We infer that the mutation led to clinically relevant sodium-glucose cotransporter 2 dysfunction. The patient showed no symptoms of hypoglycemia, but continuous glucose monitoring confirmed asymptomatic hypoglycemia.

Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria.

BACKGROUND: Familial renal glucosuria (FRG) is a rare renal tubular disorder characterized by isolated persistent glucosuria without both abnormal glucose metabolism and any signs of proximal tubular dysfunction. SLC5A2 gene mutations are responsible for most FRG cases. METHODS: Quantitative test for 24-hour urine glucose and RTG were determined in 9 families (totaling 25 subjects). All coding regions, including intron-exon boundaries, were analyzed with PCR followed by direct sequence analysis. RESULTS: Ten novel mutations were identified (c.331 T > C, p.W111R; c.374T>C, p.M125T; c.394C>T, p.R132C; c.612G>C, p.Q204H; c.829C>T, p.P277S; c.880G>A, p.D294N; c.1129G>A, p.G377S; c.1194C>A, p.F398L; c.1540C > T, p.P514S and c.1573C>T, p.H525Y). c.886(-10_-31)del that is specific to Chinese population was found in 5 out of 9 families, with a mutation rate of 28% (5/18). The compound heterozygotes presented with much lower RTG values (1.28 ±â€¯0.10 mmol/L), compared with the carriers of heterozygous variants (5.14 ±â€¯0.77 mmol/L) (p<0.01); c.886(-10_-31)del heterozygotes had significant lower RTG values than others (4.43 ±â€¯0.37 vs 5.7 ±â€¯0.51 mmol/L; p<0.01). CONCLUSIONS: Ten novel SLC5A2 mutations are found and c.886(-10-31)del may be a hot spot mutation in Chinese population. Compound heterozygotes had much lower RTG values than simple heterozygotes. Mixed-meal tolerance test is a simple method for determining RTG in FRG patients.

Distribution of glucose transporters in renal diseases.

Kidneys play an important role in glucose homeostasis. Renal gluconeogenesis prevents hypoglycemia by releasing glucose into the blood stream. Glucose homeostasis is also due, in part, to reabsorption and excretion of hexose in the kidney.Lipid bilayer of plasma membrane is impermeable for glucose, which is hydrophilic and soluble in water. Therefore, transport of glucose across the plasma membrane depends on carrier proteins expressed in the plasma membrane. In humans, there are three families of glucose transporters: GLUT proteins, sodium-dependent glucose transporters (SGLTs) and SWEET. In kidney, only GLUTs and SGLTs protein are expressed. Mutations within genes that code these proteins lead to different renal disorders and diseases. However, diseases, not only renal, such as diabetes, may damage expression and function of renal glucose transporters.

Genetic analysis and literature review of Chinese patients with familial renal glucosuria: Identification of a novel SLC5A2 mutation.

BACKGROUND: Familial renal glucosuria (FRG) is an inherited renal tubular disorder characterized by persistent isolated glucosuria with normal blood glucose. SLC5A2 gene mutation was the causative of FRG. METHODS: Molecular genetic analysis of SLC5A2 gene by Sanger sequencing was conducted in two unrelated non-consanguineous Chinese families with isolated glucosuria. Extensive laboratory test and physical examination were performed. In silico algorithms were used to explore the potential effect of novel mutation on SGLT2 function. We also summarized the reported SLC5A2 mutations in the Chinese patients with FRG. RESULTS: A novel missense mutation (c.877A>T, p.Ser293Cys) in exon 3 was detected in proband 1 with weight loss accompanying by glucosuria and in her father with normal phenotype. In family 2, a previously reported compound heterozygous mutation (c.229G>C, p.Gly77Arg; c.1540C>T, p.Pro514Ser) was identified, and her healthy parents were heterozygous mutation carriers. The p.S293C mutation was predicted to be pathogenic. No hot spot mutation was found in reported Chinese patients with FRG. CONCLUSIONS: The novel pathogenic SLC5A2 mutation p.S293C was responsible for the onset of FRG. Our study further confirmed the co-dominant inheritance trait with variable penetrance and expanded the clinical and genetic spectrum of FRG.

Novel SLC5A2 mutation contributes to familial renal glucosuria: Abnormal expression in renal tissues.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, while other impairments of tubular function are absent. Mutations in the sodium-glucose co-transporter 2 (SLC5A2) gene have been found to be responsible for FRG. However, direct evidence for the presence of SLC5A2 mutant in renal tissues is very rare. In previous studies, a non-sense mutation (c.1320 G>A:p.W440X) that would cause premature termination of the protein was found. However, the effects in the renal tissues were not reported. In the current study, a patient with FRG and a urinary glucose excretion rate of 8.3 g/day is described, for whom a novel missense mutation (c.1319G>A:p.W440X) was revealed by sequencing. Furthermore, in the immunofluorescence examination of a renal biopsy specimen, SLC5A2 was detected in the apical side of the proximal convoluted tubule, discontinuously decreased in comparison with that in normal and disease controls. The results imply that both wild-type SLC5A2 and mutant SLC5A2 with abnormal distribution were expressed in the renal tissues, and that the reduction of SLC5A2 expression and function were due to the c.1319G>A:p.W440X mutation. The current study provides valuable clues regarding the SLC5A2 molecule from genotype to phenotype in families affected by FRG.

Decreased expression and function of sodium-glucose co-transporter 2 from a novel C-terminal mutation: a case report.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, and the absence of other impairments of tubular function. Mutations in the sodium-glucose co-transporter 2 (SGLT2) gene (SLC5A2) are causative of FRG the long-term outcome of which is well know. In the search for potential new drug targets for SGLT2 inhibitors with which to treat the diabetes, expressional and functional studies of SGLT2 have been the focus of attention, but reports of these are rare. Furthermore, it is well known that the alleles in the C-terminal are very important for the expression and function in some genes. However, little is known about the effect of mutation in SLC5A2 C- terminal. CASE PRESENTATION: Here, we identified a FRG patient with urine glucose excretion 7.56 g/day and a novel SLC5A2 missense mutation, c.1891G > A/p.(E631K), by DNA sequencing. Expression and function of the mutant SGLT2 (631 K) fused to green fluorescent protein (GFP) were verified by western blotting, confocal laser microscopy, and transport activity assays in cultured HEK293 cells. Although wild-type SGLT2-GFP and 631 K mutant-GFP fusion proteins were properly expressed in a punctate pattern in the cell membrane, and co-localized with the cell membrane marker DiIC18(3), the expression of the mutant fusion protein was obviously decreased (24 %). Moreover, the uptake activity of the mutant SGLT2 631 K-GFP fusion protein was significantly decreased compared with wild-type (3629 ± 1082 vs. 7926 ± 1153, P < 0.001). CONCLUSION: These results suggest that the SLC5A2 C-terminal is very important for protein expression. We speculate that the observed reduced expression of the mutant transporter led to a decrease in transport of the glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3- diazol-4-yl)amino)-2-deoxyglucose. The current study provides a starting point for further investigations of the SGLT2 molecular mechanism in FRG families, and offers functional insights into the development of anti-diabetes drugs.

Novel SLC5A2 variants contribute to renal glucosuria in Chinese families: abnormal expression and dysfunction of variant SLC5A2.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal serum glucose and the absence of overt tubular dysfunction. Variants in solute carrier family 5 (sodium-glucose cotransporter), member 2 (SLC5A2) have been reported in FRG patients. However, the functional and expression-related consequences of such variants have been scarcely investigated. In the current study, we studied five FRG families and identified six missense mutations, including four novel variants (c.1051T>C/.(C351R), c.1400T>C/p.(V467A), c.1420G>C/p.(A474P), c.1691G>A/p.(R564Q); RNA not analyzed) and two variants that had been previously reported (c.294C>A/p.(F98L), c.736C>T/p.(P246S); RNA not analyzed). The probands were either heterozygous or compound heterozygous for SLC5A2 variants and had glucosuria of 5.9%-19.6 g/day. Human 293 cells were transfected with plasmid constructs to study the expression and function of SLC5A2 variants in vitro. Western blotting revealed that the expression levels of SLC5A2-351R-GFP, SLC5A2-467A-GFP, SLC5A2-474P-GFP, and SLC5A2-564Q-GFP were significantly decreased compared with wild-type SLC5A2-GFP (37%-55%). Confocal microscopy revealed that three variants (c.1400T>C, c.1420G>C, c.1691G>A) resulted in a loss of the punctate membrane pattern typical of wild-type SLC5A2. All variants had a significantly lower transport capacity in than the wild-type control. The current study provides a starting point to further investigate the molecular mechanism of SLC5A2 in FRG families and provides functional clues for antidiabetes drugs.

Establishment of Na+-glucose cotransporter 2 heterologous expression system in HEK293 cells / 中华肾脏病杂志

Objective To establish heterologous expression system of Na+-glucose cotransporter 2 (SGLT2) gene.Methods Human SGLT2 cDNA from normal kidney, generated by RT-PCR,was subclonedintoPEXL-GFP vector andtransfectedinto HEK293cells. After 24hours of incubation, the expression of SGLT2-GFP fusion protein was detected by Western blotting and laser confocal microscopy.Transport activity of SGLT2-GFP fusion proteins in cultured human HEK293 cells was evaluated with the uptake test of glucose analogue.ResultsSGLT2-GFP fusion protein was expressed in cultured human HEK293 cells.Furthermore, confocal microscopy using green fluorescent protein(GFP) revealed a punctate membrane pattern of SGLT2.Glucose analogue uptake increased in HEK293 cells transfected with SGLT2-GFP at least by 3.5 folds compared with HEK293 cells transfected with GFP vector only(P＜0.01).Conclusion Heterologous expression of SGLT2 gene in HEK293 cells is successfully established, which provides valuable approach for the functional and pathological study of SGLT2 gene.