A myeloid leukemia factor homolog is involved in tolerance to stresses and stress-induced protein metabolism in Giardia lamblia.

BACKGROUND: The eukaryotic membrane vesicles contain specific sets of proteins that determine vesicle function and shuttle with specific destination. Giardia lamblia contains unknown cytosolic vesicles that are related to the identification of a homolog of human myeloid leukemia factor (MLF) named MLF vesicles (MLFVs). Previous studies suggest that MLF also colocalized with two autophagy machineries, FYVE and ATG8-like protein, and that MLFVs are stress-induced compartments for substrates of the proteasome or autophagy in response to rapamycin, MG132, and chloroquine treatment. A mutant protein of cyclin-dependent kinase 2, CDK2m3, was used to understand whether the aberrant proteins are targeted to degradative compratments. Interestingly, MLF was upregulated by CDK2m3 and they both colocalized within the same vesicles. Autophagy is a self-digestion process that is activated to remove damaged proteins for preventing cell death in response to various stresses. Because of the absence of some autophagy machineries, the mechanism of autophagy is unclear in G. lamblia. RESULTS: In this study, we tested the six autophagosome and stress inducers in mammalian cells, including MG132, rapamycin, chloroquine, nocodazole, DTT, and G418, and found that their treatment increased reactive oxygen species production and vesicle number and level of MLF, FYVE, and ATG8-like protein in G. lamblia. Five stress inducers also increased the CDK2m3 protein levels and vesicles. Using stress inducers and knockdown system for MLF, we identified that stress induction of CDK2m3 was positively regulated by MLF. An autophagosome-reducing agent, 3-methyl adenine, can reduce MLF and CDK2m3 vesicles and proteins. In addition, knockdown of MLF with CRISPR/Cas9 system reduced cell survival upon treatment with stress inducers. Our newly developed complementation system for CRISPR/Cas9 indicated that complementation of MLF restored cell survival in response to stress inducers. Furthermore, human MLF2, like Giardia MLF, can increase cyst wall protein expression and cyst formation in G. lamblia, and it can colocalize with MLFVs and interact with MLF. CONCLUSIONS: Our results suggest that MLF family proteins are functionally conserved in evolution. Our results also suggest an important role of MLF in survival in stress conditions and that MLFVs share similar stress-induced characteristics with autophagy compartments.

Evaluation of Pharmacological Rescue of Melanocortin-4 Receptor Nonsense Mutations by Aminoglycoside.

The melanocortin-4 receptor (MC4R) is critical for central satiety regulation, therefore presenting a potent target for pharmacological obesity treatment. Melanocortin-4 receptor mutations prevalently cause monogenetic obesity. A possibility of overcoming stop mutations is aminoglycoside-mediated translational readthrough. Promising results were achieved in COS-7 cells, but data for human cell systems are still missing, so uncertainty surrounds this potential treatment. In transfected HEK-293 cells, we tested whether translational readthrough by aminoglycoside Geneticin combined with high-affinity ligand setmelanotide, which is effective in proopiomelanocortin or leptin receptor deficiency patients, is a treatment option for affected patients. Five MC4R nonsense mutants (W16X, Y35X_D37V, E61X, W258X, Q307X) were investigated. Confocal microscopy and cell surface expression assays revealed the importance of the mutations' position within the MC4R. N-terminal mutants were marginally expressed independent of Geneticin treatment, whereas mutants with nonsense mutations in transmembrane helix 6 or helix 8 showed wild-type-like expression. For functional analysis, Gs and Gq/11 signaling were measured. N-terminal mutants (W16X, Y35X_D37V) showed no cAMP formation after challenge with alpha-MSH or setmelanotide, irrespective of Geneticin treatment. Similarly, Gs activation was almost impossible in W258X and Q307X with wild-type-like cell surface expression. Results for Gq/11 signaling were comparable. Based on our data, this approach improbably represents a therapeutic option.

Degron tagging of BleoR and other antibiotic-resistance genes selects for higher expression of linked transgenes and improved exosome engineering.

Five antibiotic resistance (AR) genes have been used to select for transgenic eukaryotic cell lines, with the BleoR, PuroR, HygR, NeoR, and BsdR cassettes conferring resistance to zeocin, puromycin, hygromycin, geneticin/G418, and blasticidin, respectively. We recently demonstrated that each AR gene establishes a distinct threshold of transgene expression below which no cell can survive, with BleoR selecting for the highest level of transgene expression, nearly ∼10-fold higher than in cells selected using the NeoR or BsdR markers. Here, we tested the hypothesis that there may be an inverse proportionality between AR protein function and the expression of linked, transgene-encoded, recombinant proteins. Specifically, we fused each AR protein to proteasome-targeting degron tags, used these to select for antibiotic-resistant cell lines, and then measured the expression of the linked, recombinant protein, mCherry, as a proxy marker of transgene expression. In each case, degron-tagged AR proteins selected for higher mCherry expression than their cognate WT AR proteins. ER50BleoR selected for the highest level of mCherry expression, greater than twofold higher than BleoR or any other AR gene. Interestingly, use of ER50BleoR as the selectable marker translated to an even higher, 3.5-fold increase in the exosomal loading of the exosomal cargo protein, CD63/Y235A. Although a putative CD63-binding peptide, CP05, has been used to decorate exosome membranes in a technology known as "exosome painting," we show here that CP05 binds equally well to CD63-/- cells, WT 293F cells, and CD63-overexpressing cells, indicating that CP05 may bind membranes nonspecifically. These results are of high significance for cell engineering and especially for exosome engineering.

Nonselective TRPC channel inhibition and suppression of aminoglycoside-induced premature termination codon readthrough by the small molecule AC1903.

Nonsense mutations, which occur in ∼11% of patients with genetic disorders, introduce premature termination codons (PTCs) that lead to truncated proteins and promote nonsense-mediated mRNA decay. Aminoglycosides such as G418 permit PTC readthrough and so may be used to address this problem. However, their effects are variable between patients, making clinical use of aminoglycosides challenging. In this study, we tested whether TRPC nonselective cation channels contribute to the variable PTC readthrough effect of aminoglycosides by controlling their cellular uptake. Indeed, a recently reported selective TRPC5 inhibitor, AC1903, consistently suppressed G418 uptake and G418-induced PTC readthrough in the DMS-114 cancer cell line and junctional epidermolysis bullosa (JEB) patient-derived keratinocytes. Interestingly, the effect of AC1903 in DMS-114 cells was mimicked by nonselective TRPC inhibitors, but not by well-characterized inhibitors of TRPC1/4/5 (Pico145, GFB-8438) or TRPC3/6/7 (SAR7334), suggesting that AC1903 may work through additional or undefined targets. Indeed, in our experiments, AC1903 inhibited multiple TRPC channels including TRPC3, TRPC4, TRPC5, TRPC6, TRPC4-C1, and TRPC5-C1, as well as endogenous TRPC1:C4 channels in A498 renal cancer cells, all with low micromolar IC50 values (1.8-18 µM). We also show that AC1903 inhibited TRPV4 channels, but had weak or no effects on TRPV1 and no effect on the nonselective cation channel PIEZO1. Our study reveals that AC1903 has previously unrecognized targets, which need to be considered when interpreting results from experiments with this compound. In addition, our data strengthen the hypothesis that nonselective calcium channels are involved in aminoglycoside uptake.

Construction of a Full-Length 3'UTR Reporter System for Identification of Cell-Cycle Regulating MicroRNAs.

Three prime untranslated region (3'UTR) reporter constructs are widely used by the scientific community to functionally link microRNAs (miRNAs) to suppression of mRNA expression. However, full-length 3'UTR vectors are rarely employed due to labor-intensive cloning work. Instead, 3'UTR fragments containing putative miRNA binding sites are commonly utilized to mechanistically validate miRNAs. Assaying truncated 3'UTRs may falsely validate miRNAs due to altered positioning of binding sites in respect to 3'UTR length and RNA secondary structure. Here we present a detailed protocol for the construction of full-length 3'UTR luciferase reporter constructs that was used to unveil miRNAs regulating multiple cell-cycle factors.

[S2k guidelines: status epilepticus in adulthood : Guidelines of the German Society for Neurology]. / S2k-Leitlinie: Status Epilepticus im Erwachsenenalter : Leitlinie der Deutschen Gesellschaft für Neurologie.

This S2k guideline on diagnosis and treatment of status epilepticus (SE) in adults is based on the last published version from 2021. New definitions and evidence were included in the guideline and the clinical pathway. A seizures lasting longer than 5 minutes (or ≥ 2 seizures over more than 5 mins without intermittend recovery to the preictal neurological state. Initial diagnosis should include a cCT or, if possible, an MRI. The EEG is highly relevant for diagnosis and treatment-monitoring of non-convulsive SE and for the exclusion or diagnosis of psychogenic non-epileptic seizures. As the increasing evidence supports the relevance of inflammatory comorbidities (e.g. pneumonia) related clinical chemistry should be obtained and repeated over the course of a SE treatment, and antibiotic therapy initiated if indicated.Treatment is applied on four levels: 1. Initial SE: An adequate dose of benzodiazepine is given i.v., i.m., or i.n.; 2. Benzodiazepine-refractory SE: I.v. drugs of 1st choice are levetiracetam or valproate; 3. Refractory SE (RSE) or 4. Super-refractory SE (SRSE): I.v. propofol or midazolam alone or in combination or thiopental in anaesthetic doses are given. In focal non-convulsive RSE the induction of a therapeutic coma depends on the circumstances and is not mandatory. In SRSE the ketogenic diet should be given. I.v. ketamine or inhalative isoflorane can be considered. In selected cased electroconvulsive therapy or, if a resectable epileptogenic zone can be defined epilepsy surgery can be applied. I.v. allopregnanolone or systemic hypothermia should not be used.

Ataluren and aminoglycosides stimulate read-through of nonsense codons by orthogonal mechanisms.

During protein synthesis, nonsense mutations, resulting in premature stop codons (PSCs), produce truncated, inactive protein products. Such defective gene products give rise to many diseases, including cystic fibrosis, Duchenne muscular dystrophy (DMD), and some cancers. Small molecule nonsense suppressors, known as TRIDs (translational read-through-inducing drugs), stimulate stop codon read-through. The best characterized TRIDs are ataluren, which has been approved by the European Medicines Agency for the treatment of DMD, and G418, a structurally dissimilar aminoglycoside. Previously [1], we applied a highly purified in vitro eukaryotic translation system to demonstrate that both aminoglycosides like G418 and more hydrophobic molecules like ataluren stimulate read-through by direct interaction with the cell's protein synthesis machinery. Our results suggested that they might do so by different mechanisms. Here, we pursue this suggestion through a more-detailed investigation of ataluren and G418 effects on read-through. We find that ataluren stimulation of read-through derives exclusively from its ability to inhibit release factor activity. In contrast, G418 increases functional near-cognate tRNA mispairing with a PSC, resulting from binding to its tight site on the ribosome, with little if any effect on release factor activity. The low toxicity of ataluren suggests that development of new TRIDs exclusively directed toward inhibiting termination should be a priority in combatting PSC diseases. Our results also provide rate measurements of some of the elementary steps during the eukaryotic translation elongation cycle, allowing us to determine how these rates are modified when cognate tRNA is replaced by near-cognate tRNA ± TRIDs.

Sialic acid sulfation is induced by the antibiotic treatment in mammalian cells.

Sialic acids (Sias) are an outermost-situated sugar of glycoproteins and glycolipids to play important roles in various biological phenomena. They are often modified by additional substituents, such as O-acetyl group, to display more than 50 different structures in nature. Of those modified Sia, nothing is known about the occurrence and biological functions of sulfated Sias (SiaSs) in mammals. To elucidate the significance of sialic acid sulfation, we investigated various mammalian-cultured cell lines for the expression of SiaS using the specific antibody 3G9. First, SiaS is expressed in a cell line-dependent and a cell density-dependent manner. Second, in CHO cells, the expression of SiaS is reversibly induced by treatment with the antibiotic G418. Taken together, the expression of SiaS is changed by intrinsic and extrinsic factors in mammalian cells. This is the first demonstration of regulated expression of SiaS.

Premature termination codon readthrough upregulates progranulin expression and improves lysosomal function in preclinical models of GRN deficiency.

BACKGROUND: Frontotemporal lobar degeneration (FTLD) is a devastating and progressive disorder, and a common cause of early onset dementia. Progranulin (PGRN) haploinsufficiency due to autosomal dominant mutations in the progranulin gene (GRN) is an important cause of FTLD (FTLD-GRN), and nearly a quarter of these genetic cases are due to a nonsense mutation. Premature termination codons (PTC) can be therapeutically targeted by compounds allowing readthrough, and aminoglycoside antibiotics are known to be potent PTC readthrough drugs. Restoring endogenous PGRN through PTC readthrough has not previously been explored as a therapeutic intervention in FTLD. METHODS: We studied whether the aminoglycoside G418 could increase PGRN expression in HEK293 and human induced pluripotent stem cell (hiPSC)-derived neurons bearing the heterozygous S116X, R418X, and R493X pathogenic GRN nonsense mutations. We further tested a novel substituted phthalimide PTC readthrough enhancer in combination with G418 in our cellular models. We next generated a homozygous R493X knock-in hiPSC isogenic line (R493X-/- KI), assessing whether combination treatment in hiPSC-derived neurons and astrocytes could increase PGRN and ameliorate lysosomal dysfunction relevant to FTLD-GRN. To provide in vivo proof-of-concept of our approach, we measured brain PGRN after intracerebroventricular administration of G418 in mice expressing the V5-tagged GRN nonsense mutation R493X. RESULTS: The R418X and R493X mutant GRN cell lines responded to PTC readthrough with G418, and treatments increased PGRN levels in R493X-/- KI hiPSC-derived neurons and astrocytes. Combining G418 with a PTC readthrough enhancer increased PGRN levels over G418 treatment alone in vitro. PGRN deficiency has been shown to impair lysosomal function, and the mature form of the lysosomal protease cathepsin D is overexpressed in R493X-/- KI neurons. Increasing PGRN through G418-mediated PTC readthrough normalized this abnormal lysosomal phenotype in R493X-/- KI neuronal cultures. A single intracerebroventricular injection of G418 induced GRN PTC readthrough in 6-week-old AAV-GRN-R493X-V5 mice. CONCLUSIONS: Taken together, our findings suggest that PTC readthrough may be a potential therapeutic strategy for FTLD caused by GRN nonsense mutations.

Two dominant selectable markers for genetic manipulation in Neurospora crassa.

Neurospora crassa is an excellent model fungus for studies on molecular genetics, biochemistry, physiology, and molecular cell biology. Along with the rapid progress of Neurospora research, new tools facilitating more efficient and accurate genetic analysis are in high demand. Here, we tested whether the dominant selective makers widely used in yeasts are applicable in N. crassa. Among them, we found that the strains of N. crassa are sensitive to the aminoglycoside antibiotics, G418 and nourseothricin. 1000 µg/mL of G418 or 50 µg/mL of nourseothricin is sufficient to inhibit Neurospora growth completely. When the neomycin phosphotransferase gene (neo) used in mammalian cells is expressed, N. crassa shows potent resistance to G418. This establishes G418-resistant marker as a dominant selectable marker to use in N. crassa. Similarly, when the nourseothricin acetyltransferase gene (nat) from Streptomyces noursei is induced by qa-2 promoter in the presence of quinic acid (QA), N. crassa shows potent resistance to nourseothricin. When nat is constitutively expressed by full-length or truncated versions of the promoter from the N. crassa cfp gene (NCU02193), or by the trpC promoter of Aspergillus nidulans, the growth of N. crassa in the presence of nourseothricin is proportional to the expression levels of Nat. Finally, these two markers are used to knock-out wc-2 or al-1 gene from the N. crassa genome. The successful development of these two markers in this study expands the toolbox for N. crassa and very likely for other filamentous fungi as well.

Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides.

Stop codon readthrough (SCR) occurs when the ribosome miscodes at a stop codon. Such readthrough events can be therapeutically desirable when a premature termination codon (PTC) is found in a critical gene. To study SCR in vivo in a genome-wide manner, we treated mammalian cells with aminoglycosides and performed ribosome profiling. We find that in addition to stimulating readthrough of PTCs, aminoglycosides stimulate readthrough of normal termination codons (NTCs) genome-wide. Stop codon identity, the nucleotide following the stop codon, and the surrounding mRNA sequence context all influence the likelihood of SCR. In comparison to NTCs, downstream stop codons in 3'UTRs are recognized less efficiently by ribosomes, suggesting that targeting of critical stop codons for readthrough may be achievable without general disruption of translation termination. Finally, we find that G418-induced miscoding alters gene expression with substantial effects on translation of histone genes, selenoprotein genes, and S-adenosylmethionine decarboxylase (AMD1).

Many genes provide a set of instructions needed to build a protein, which are read by structures called ribosomes through a process called translation. The genetic information contains a short, coded instruction called a stop codon which marks the end of the protein. When a ribosome finds a stop codon it should stop building and release the protein it has made. Ribosomes do not always stop at stop codons. Certain chemicals can actually prevent ribosomes from detecting stop codons correctly, and aminoglycosides are drugs that have exactly this effect. Aminoglycosides can be used as antibiotics at low doses because they interfere with ribosomes in bacteria, but at higher doses they can also prevent ribosomes from detecting stop codons in human cells. When ribosomes do not stop at a stop codon this is called readthrough. There are different types of stop codons and some are naturally more effective at stopping ribosomes than others. Wangen and Green have now examined the effect of an aminoglycoside called G418 on ribosomes in human cells grown in the laboratory. The results showed how ribosomes interacted with genetic information and revealed that certain stop codons are more affected by G418 than others. The stop codon and other genetic sequences around it affect the likelihood of readthrough. Wangen and Green also showed that sequences that encourage translation to stop are more common in the area around stop codons. These findings highlight an evolutionary pressure driving more genes to develop strong stop codons that resist readthrough. Despite this, some are still more affected by drugs like G418 than others. Some genetic conditions, like cystic fibrosis, result from incorrect stop codons in genes. Drugs that promote readthrough specifically in these genes could be useful new treatments.

An efficient shortened genetic transformation strategy for filamentous fungus Trichoderma reesei.

The filamentous fungus Trichoderma reesei is one of the most important fungi for the production of cellulases and xylanases, which can be used for biofuel production from lignocellulose. We aimed to develop an effective selection marker system for more extensive functional genomic studies in the fungus T. reesei, and to construct better industrial transformants for producing cellulases. Here, we present a novel effective G418 selection marker to use a codon-optimized neomycin phosphotransferase II gene nptII to transform T. reesei. We developed an effective and erasable selection marker, lcNG, and a combined genetic transformation system for gene manipulation in T. reesei using a two-Agrobacterium-mediated transformation method. This transformation strategy combines two steps in the transformation protocol, which saves 15-30-day's time. The system could be a useful tool for the genetic engineering of T. reesei.

Isolation of cancer stem cells by selection for miR-302 expressing cells.

BACKGROUND: Cancer stem cells are believed to be a major reason for long-term therapy failure because they are multi-drug resistant and able to rest mitotically inactive in the hypoxic center of tumors. Due to their variable number and their often low proliferation rate, cancer stem cells are difficult to purify in decent quantities and to grow in cell culture systems, where they are easily outcompeted by faster growing more 'differentiated', i.e., less stem cell-like tumor cells. METHODS: Here we present a proof of principle study based on the idea to select cancer stem cells by means of the expression of a stem cell-specific gene. A selectable egfp-neo coding sequence was inserted in the last exon of the non-coding murine miR-302 host gene. As a stem cell specific regulatory element, 2.1 kb of the genomic region immediately upstream of the miR-302 host gene transcription start site was used. Stable transgenic CJ7 embryonic stem cells were used to induce teratomas. RESULTS: After three weeks, tumors were removed for analysis and primary cultures were established. Stem cell-like cells were selected from these culture based on G418 selection. When the selection was removed, stem cell morphology and miR-302 expression were rapidly lost, indicating that it was not the original ES cells that had been isolated. CONCLUSIONS: We show the possibility to use drug resistance expressed from a regulatory sequence of a stem cell-specific marker, to isolate and propagate cancer stem cells that otherwise might be hidden in the majority of tumor cells.

G418 induces programmed cell death in Acanthamoeba through the elevation of intracellular calcium and cytochrome c translocation.

Acanthamoeba is a widely distributed opportunistic parasite which causes a vision-threatening keratitis and a life-threatening encephalitis. The cyst stage of this amoeba is especially resistant to currently used therapeutics and so alternative agents are urgently required. Growing evidence supports the existence of a programmed cell death system (PCD) in Acanthamoeba and while some features are shared by higher eukaryote cells, others differ. It is hoped that by understanding these differences we can exploit them as targets for novel drug intervention to activate PCD pathways in the amoebae but not the invaded human tissue. Here, we use the aminoglycoside G418 to activate PCD in Acanthamoeba. This drug caused a shape change in the treated amoebae. Cells rounded up and contracted, and after 6 h fragments of cells resembling the 'apoptotic bodies' of vertebrate cells were observed. G418 causes an increase in intracellular calcium from a resting level of 24 nM to 60 nM after 6 h of treatment. Mitochondrial function as assayed by the ΔΨm reporting dye JC-1 and CTC a redox dye becomes inhibited during treatment and we have found that cytochrome c is released from the mitochondria. Cells stained with Hoechst showed first an alteration in chromatin structure and then a vesiculation of the nucleus with G418 treatment, although we found no obvious breakdown in genomic DNA in the early stages of PCD.

Establishment of paired box gene 6/mouse embryonic stem cell line and its stem cell biological characteristics / 解剖学报

Objective: To investigate the overexpression of paired box gene 6(Pax6) gene in mouse embryonic stem cells and obtain cell line, which is the basis for further differentiation of Pax6/mouse embryonic stem cells (mESCs). Methods: mESCs were cultured in vitro, and the recombinant vector pEFla-Pax6-IRES-AcGFP and the empty vector pEFlot-IRES-AcGFP were transfected into mESCs by liposome method respectively. The cells were screened by G418 gradient and fluorescent protein. The expression of Pax6 was detected by RT-PCR, immunofluorescence and Western blotting and the proportion of Pax6/mESCs positive cells was detected by flow cytometry. The obtained cell line was detected by cell immunofluorescence for stem cell markers stage specific embryonic antigen 1 (SSEA1) and octamer binding transcription factor 4(0CT4), and the pluripotency was detected by alkaline phosphatase staining. Pax6/mESCs cells were subcutaneously transplanted, and the grafts were observed by HE staining to observe their differentiation ability. Results: Pax6 was successfully expressed in mESCs. After screening by G418, the cell line Pax6/mESCs was obtained, and the flow rate showed positive rate about 90%. Immunofluorescence showed that stem cell markers SSEA1 and 0CT4 were positively expressed and alkaline phosphatase stained cells were stained brownish black, and transplantation in vivo could differentiate into three germ layers. Conclusion: Pax6 is successfully expressed in mESCs. After screening by G418, the cell line Pax6/mESCs is obtained and shows the good stem cell characteristics.

[Construction and high-density fermentation of alkaline pectate lyase high-yield yeast].

Pectate lyase is widely applied in ramie degumming and fabric bioscouring in the textile industry. Compared to conventional processes that involve high alkaline and high temperature treatment, enzyme based treatments have significant advantages in fibers protectiveness, improved efficiency of refining, reduced energy consumption and pollution. Hence, it would be highly desirable to construct high-yield alkaline pectate lyase engineered strains and reduce the pectate lyase production cost. In the previous study, pectate lyase gene pel from Bacillus subtilis168 was expressed in Pichia pastoris GS115 after codon usage optimization based on the vector pHBM905A. To improve the expression level, the vector pHBM905BDM with optimized promoter and signal peptide was used to express the optimized gene pels in GS115. The transformant had increased activity from 68 U/mL to 100 U/mL with the improvement in the transcription level by 27% measured by qPCR. The transformants were further screened on pectin plates, where higher halo forming strains were picked for shake-flask fermentation and strain GS115-pHBM905BDM-pels4 showed the highest activity of 536 U/mL. Then plasmid pPIC9K-pels was constructed and electroporated into the GS115-pHBM905BDM-pels4 cells. Subsequently, high-copy transformant was screened by using the medium containing antibiotics G418, strain GS115-pHBM905BDMpPIC9K- pels1 was identified with increased activity of 770 U/mL and the copy number of pels was 7 confirmed by qPCR. Finally, the activity of pectate lyase produced by GS115-pHBM905BDM-pPIC9K-pels1reached to 2 271 U/mL in a 5-L fermentor. The activity of pectate lyase in our study reached the highest level of expression in P. pastoris, showing good application potential in the textile industry.

Transient and stable vector transfection: Pitfalls, off-target effects, artifacts.

Transient and stable vector transfections have played important roles in illustrating the function of specific genes/proteins. The general assumption is that such a platform could effectively link a given gene/protein to gained phenotypes, revealing the mechanism of how a gene works. However, in reality, increased studies have surprisingly noticed some unexpected results. In this review, we demonstrate that an assumption that empty vector-transfected cells preserve the cytogenetic and phenotypic characteristics, and represent the adequate control in transfection experiments is not universally valid. A DNA vector, a transfection reagent, expression of an antibiotic resistance (trans)gene, expression of a reporter (trans)gene, and selection by acute/chronic antibiotic treatment may evoke cellular responses that affect the biochemical processes under investigation. We exemplify a number of studies, which reported obvious genomic, transcriptomic and phenotypic changes of tumor cells after transient/stable transfection of an empty vector. To further address the common mechanisms of these unexpected findings, we will apply the genome theory of somatic evolution to explain stress-mediated system dynamics and the limitations of predicting the system behavior solely based on targeted genes. We conceptualize that the diverse experimental manipulations (e.g., transgene overexpression, gene knock out/down, chemical treatments, acute changes in culture conditions, etc.) may act as a system stress, promoting intensive genome-level alterations (chromosomal instability, CIN), epigenetic and phenotypic alterations, which are beyond the function of manipulated genes. Such analysis calls for more attention on the reduced specificities of gene-focused methodologies.

Inhibitor mechanisms in the S1 binding site of the dopamine transporter defined by multi-site molecular tethering of photoactive cocaine analogs.

Dopamine transporter (DAT) blockers like cocaine and many other abused and therapeutic drugs bind and stabilize an inactive form of the transporter inhibiting reuptake of extracellular dopamine (DA). The resulting increases in DA lead to the ability of these drugs to induce psychomotor alterations and addiction, but paradoxical findings in animal models indicate that not all DAT antagonists induce cocaine-like behavioral outcomes. How this occurs is not known, but one possibility is that uptake inhibitors may bind at multiple locations or in different poses to stabilize distinct conformational transporter states associated with differential neurochemical endpoints. Understanding the molecular mechanisms governing the pharmacological inhibition of DAT is therefore key for understanding the requisite interactions for behavioral modulation and addiction. Previously, we leveraged complementary computational docking, mutagenesis, peptide mapping, and substituted cysteine accessibility strategies to identify the specific adduction site and binding pose for the crosslinkable, photoactive cocaine analog, RTI 82, which contains a photoactive azide attached at the 2ß position of the tropane pharmacophore. Here, we utilize similar methodology with a different cocaine analog N-[4-(4-azido-3-I-iodophenyl)-butyl]-2-carbomethoxy-3-(4-chlorophenyl)tropane, MFZ 2-24, where the photoactive azide is attached to the tropane nitrogen. In contrast to RTI 82, which crosslinked into residue Phe319 of transmembrane domain (TM) 6, our findings show that MFZ 2-24 adducts to Leu80 in TM1 with modeling and biochemical data indicating that MFZ 2-24, like RTI 82, occupies the central S1 binding pocket with the (+)-charged tropane ring nitrogen coordinating with the (-)-charged carboxyl side chain of Asp79. The superimposition of the tropane ring in the three-dimensional binding poses of these two distinct ligands provides strong experimental evidence for cocaine binding to DAT in the S1 site and the importance of the tropane moiety in competitive mechanisms of DA uptake inhibition. These findings set a structure-function baseline for comparison of typical and atypical DAT inhibitors and how their interactions with DAT could lead to the loss of cocaine-like behaviors.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

Construction and high-density fermentation of alkaline pectate lyase high-yield yeast / 生物工程学报

Pectate lyase is widely applied in ramie degumming and fabric bioscouring in the textile industry. Compared to conventional processes that involve high alkaline and high temperature treatment, enzyme based treatments have significant advantages in fibers protectiveness, improved efficiency of refining, reduced energy consumption and pollution. Hence, it would be highly desirable to construct high-yield alkaline pectate lyase engineered strains and reduce the pectate lyase production cost. In the previous study, pectate lyase gene pel from Bacillus subtilis168 was expressed in Pichia pastoris GS115 after codon usage optimization based on the vector pHBM905A. To improve the expression level, the vector pHBM905BDM with optimized promoter and signal peptide was used to express the optimized gene pels in GS115. The transformant had increased activity from 68 U/mL to 100 U/mL with the improvement in the transcription level by 27% measured by qPCR. The transformants were further screened on pectin plates, where higher halo forming strains were picked for shake-flask fermentation and strain GS115-pHBM905BDM-pels4 showed the highest activity of 536 U/mL. Then plasmid pPIC9K-pels was constructed and electroporated into the GS115-pHBM905BDM-pels4 cells. Subsequently, high-copy transformant was screened by using the medium containing antibiotics G418, strain GS115-pHBM905BDMpPIC9K- pels1 was identified with increased activity of 770 U/mL and the copy number of pels was 7 confirmed by qPCR. Finally, the activity of pectate lyase produced by GS115-pHBM905BDM-pPIC9K-pels1reached to 2 271 U/mL in a 5-L fermentor. The activity of pectate lyase in our study reached the highest level of expression in P. pastoris, showing good application potential in the textile industry.