Methylation markers for anal cancer screening: A repeated cross-sectional analysis of people living with HIV, 2015-2016.

People living with HIV (PLWH) are at highest risk of anal cancer and will benefit from optimized screening for early disease detection. We compared host DNA methylation markers in high-grade squamous intraepithelial lesions (HSIL) versus samples negative for intraepithelial lesions (NILM) or low-grade intraepithelial lesions (LSIL) in PLWH. We recruited PLWH identifying as male aged ≥18 years undergoing high-resolution anoscopy (HRA) in Seattle, Washington, 2015-2016. Anal brush samples were collected for HPV detection, genotyping, and pyrosequencing methylation (host genes ASCL1, PAX1, FMN2, and ATP10A); clinical data were abstracted from medical records. We assessed associations between methylation and presence and extent of HSIL using generalized estimating equation logistic regression, adjusting for age, CD4 count and HIV viral load. Marker panels using HPV DNA and methylation were also evaluated to predict prevalent HSIL. We analyzed 125 samples from 85 participants (mean age 50.1; standard deviation 11.0 years). ASCL1 (adjusted odds ratio [aOR] per 1 unit increase mean percent methylation: 1.07, 95% CI: 1.01-1.13) and FMN2 (aOR per 1 unit increase mean percent methylation: 1.14, 95% CI: 1.08-1.20) methylation were significantly associated with HSIL versus NILM/LSIL. ASCL1 (aOR: 1.06, 95% CI: 1.01-1.11) and FMN2 (aOR: 1.13, 95% CI: 1.08-1.17) methylation were positively associated with increasing HSIL extent. A panel combining methylation (ASCL1 and FMN2) and HPV DNA (HPV16, HPV18, and HPV31) demonstrated best balance of sensitivity (78.2%) and specificity (73.9%) for HSIL detection compared with methylation or HPV alone. Increasing levels of DNA methylation of ASCL1 and FMN2 were positively associated with HSIL detection in PLWH. Host gene methylation testing shows promise for HSIL screening and triage.

Establishment and evaluation of detection methods for process-specific residual host cell protein and residual host cell DNA in biological preparation.

To establish accurate detection methods of process-specific Escherichia coli residual host cell protein (HCP) and residual host cell DNA (rcDNA) in recombinant biological preparations. Taking the purification process of GLP expressed by E. coli as a specific-process model, the HCP of empty E. coli was intercepted to immunize mice and rabbits. Using IgG from immunized rabbits as the coating antibody and mouse immune serum as the second sandwich antibody, a process-specific enzyme-linked immunosorbent assay (ELISA) for E. coli HCP was established. Targeting the 16S gene of E. coli, ddPCR was used to obtain the absolute copies of rcDNA in samples. Non-process-specific commercial ELISA kit and the process-specific ELISA established in this study were used to detect the HCP in GLP preparation. About 62% of HCPs, which should be process-specific HCPs, could not be detected by the non-process-specific commercial ELISA kit. The sensitivity of established ELISA can reach 338 pg/mL. The rcDNA could be absolutely quantitated by ddPCR, for the copies of rcDNA in three multiple diluted samples showed a reduced gradient. While the copies of rcDNA in three multiple diluted samples could not be distinguished by the qPCR. Process-specific ELISA has high sensitivity in detecting process-specific E. coli HCP. The absolutely quantitative ddPCR has much higher accuracy than the relatively quantitative qPCR, it is a nucleic acid quantitative method that is expected to replace qPCR in the future.

Comparison of two pretreatment methods for detection of free and mispackaged host cell DNA in recombinant adeno-associated virus / 中国生物制品学杂志

@#Objective To compare the application of two pretreatment methods,deoxyribonuclease(DNase)treatment and ligand affinity,in detecting the residual amount of free and mispackaged host cell DNA(HCDNA)in recombinant adenoassociated virus(rAAV).Methods Free and mispackaged HCDNA were isolated by DNase treatment and ligand affinity respectively,and then the nucleic acid was extracted and detected by qPCR. The accuracy and reproducibility of two pretreatment methods for detecting HCDNA residues were compared.Results Using DNase treatment,the result of nucleic acid quantitative detection in non-DNase-treated group was the total residual amount of HCDNA,that in DNase-treated group was the amount of mispackaged HCDNA,and the difference between them was the residual amount of free HCDNA. The recovery rates of both the untreated and treated groups were more than 75%,and the RSD of reproducibility was less than 30%. Using affinity extraction method,with the affinity ligand combined with rAAV,the result of recovery rate of mispackaged HCDNA was over 75%,and that of free HCDNA was only 36%.Conclusion DNase treatment method can effectively detect free and mispackaged HCDNA,laying a foundation for further research.

Quantitation of Residual Host Cell DNA in Recombinant Adeno-Associated Virus Using Droplet Digital Polymerase Chain Reaction.

Recombinant adeno-associated virus (rAAV) is a viral vector commonly used in gene therapy. Residual host cell DNA is an impurity that has been associated with the risk of infection and oncogenicity. Thus, it needs to be monitored for quality control. We aimed to develop a droplet digital polymerase chain reaction (ddPCR) method targeting 18S ribosomal RNA (rRNA) genes to quantitate residual host cell DNA. The copy number of the 18S rRNA gene was determined using two sets of primer pairs for 116- and 247-bp amplicons sharing the C-terminus. For conversion of the copy number of the 18S rRNA gene into the mass concentration of genomic DNA, the accurate copy number of 18S rRNA genes in HEK293 genomic DNA was determined by comparison with copy numbers of three reference genes (EIF5B, DCK, and HBB). Results showed that 88.6-97.9% of HEK293 genomic DNA spiked into rAAV preparations was recovered. The ddPCR-based assay was applied to rAAV preparations to quantitate residual host cell DNA as an impurity. Our findings indicate that the assay can be used for the quantitation and size distribution of residual host cell DNA in rAAV products.

FAM19A4/miR124-2 Methylation Testing and Human Papillomavirus (HPV) 16/18 Genotyping in HPV-Positive Women Under the Age of 30 Years.

BACKGROUND: High-grade squamous intraepithelial lesions (HSIL) or cervical intraepithelial neoplasia (CIN) grade 2/3 lesions in human papillomavirus (HPV)-positive women <30 years of age have high spontaneous regression rates. To reduce overtreatment, biomarkers are needed to delineate advanced CIN lesions that require treatment. We analyzed the FAM19A4/miR124-2 methylation test and HPV16/18 genotyping in HPV-positive women aged <30 years, aiming to identify CIN2/3 lesions in need of treatment. METHODS: A European multicenter retrospective study was designed evaluating the FAM19A4/miR124-2 methylation test and HPV16/18 genotyping in cervical scrapes of 1061 HPV-positive women aged 15-29 years (690 ≤CIN1, 166 CIN2, and 205 CIN3+). A subset of 62 CIN2 and 103 CIN3 were immunohistochemically characterized by HPV E4 expression, a marker for a productive HPV infection, and p16ink4a and Ki-67, markers indicative for a transforming infection. CIN2/3 lesions with low HPV E4 expression and high p16ink4a/Ki-67 expression were considered as nonproductive, transforming CIN, compatible with advanced CIN2/3 lesions in need of treatment. RESULTS: FAM19A4/miR124-2 methylation positivity increased significantly with CIN grade and age groups (<25, 25-29, and ≥30 years), while HPV16/18 positivity was comparable across age groups. FAM19A4/miR124-2 methylation positivity was HPV type independent. Methylation-positive CIN2/3 lesions had higher p16ink4a/Ki-67-immunoscores (P = .003) and expressed less HPV E4 (P = .033) compared with methylation-negative CIN2/3 lesions. These differences in HPV E4 and p16ink4a/Ki-67 expression were not found between HPV16/18-positive and non-16/18 HPV-positive lesions. CONCLUSIONS: Compared with HPV16/18 genotyping, the FAM19A4/miR124-2 methylation test detects nonproductive, transforming CIN2/3 lesions with high specificity in women aged <30 years, providing clinicians supportive information about the need for treatment of CIN2/3 in young HPV-positive women.

Validation of ASCL1 and LHX8 Methylation Analysis as Primary Cervical Cancer Screening Strategy in South African Women with Human Immunodeficiency Virus.

BACKGROUND: Compared with women who are human immunodeficiency virus (HIV) negative, women with human immunodeficiency virus (WWH) have a higher human papillomavirus (HPV) prevalence and increased cervical cancer risk, emphasizing the need for effective cervical cancer screening in this population. The present study aimed to validate methylation markers ASCL1 and LHX8 for primary screening in a South African cohort of WWH. METHODS: In this post hoc analysis within the DIAgnosis in Vaccine And Cervical Cancer Screen (DiaVACCS) study, a South African observational multicenter cohort study, cervical scrape samples from 411 HIV-positive women were analyzed for hypermethylation of ASCL1 and LHX8 genes, HPV DNA, and cytology. Sensitivities, specificities, and positive and negative predictive values of primary methylation-based, HPV-based and cytology-based screening were calculated for the detection of cervical intraepithelial neoplasia of grade 3 or higher. RESULTS: Single markers ASCL1 and LHX8 resulted in a good performance for the detection of cervical intraepithelial neoplasia of grade 3 or higher, with sensitivities of 85.9% (95% confidence interval [CI], 78.2%-93.6%) and 89.7% (83.0%-96.5%), respectively, and specificities of 72.9% (67.3%-78.5%) and 75.0% (69.5%-80.5%). Combining markers ASCL1 and LHX8 resulted in a lower sensitivity compared with HPV testing (84.6% vs 93.6%, respectively; ratio, 0.90 [95% CI, .82-.99]) and a higher specificity (86.7% vs 78.3%; ratio 1.11 [1.02-1.20]) and reduced the referral rate from 46.8% to 33.4%. ASCL1/LHX8 methylation had a significantly higher sensitivity than cytology (threshold, high-grade intraepithelial squamous lesion or worse), (84.6% vs 74.0%, respectively; ratio, 1.16 [95% CI, 1.01-1.32]) and similar specificity (86.7% vs 91.0%; ratio, 0.95 [.90-1.003]). CONCLUSIONS: Our results validate the accuracy of ASCL1/LHX8 methylation analysis for primary screening in WWH, which offers a full-molecular alternative to cytology- or HPV-based screening, without the need for additional triage testing.

Size distribution analysis of residual host cell DNA fragments in lentivirus by CGE-LIF.

During the production of cell and gene therapy products, residual host cell DNA (HCD) could cause safety risks of the biological products, and the longer the residual HCD fragment, the greater the risk to the human body. For this reason, it was necessary to develop an effective method for the size distribution analysis of residual HCD fragments with high accuracy and sensitivity. In this study, capillary gel electrophoresis with laser-induced fluorescence detector (CGE-LIF) was used to analyze the size distribution of residual HCD fragments in lentivirus products. The results confirmed that lentiviral RNA genome could interfere with the size distribution analysis of residual HCD fragments. By optimizing the amount of RNase I and digestion time in sample pretreatment process, the interfere of RNA genome could be avoided. The specificity, precision, accuracy, linear range, the detection of limit (LOD), and the quantification of limit (LOQ) of CGE-LIF method were also validated. The results showed that the CGE-LIF method had a good performance both in terms of specificity and reproducibility. The intra- and inter-day relative standard deviations of migration time and corrected peak area were all less than 1% and 2%, respectively. The 200 bp DNA marker had a good linearity between 50 and 1000 pg/ml. The LOD and LOQ of 200 bp DNA marker were 2.59 and 8.64 pg/ml, respectively. In addition, this method was successfully used to analyze the size distribution analysis of residual HCD fragments in lentivirus products with different production processes.

Development and verification of a quantitative real-time PCR method for determination of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells) / 中国生物制品学杂志

@#Objective To develop and verify a quantitative real-time PCR method for determination of the content of host cell DNA residues in severe acute respiratory symptom coronavirus 2(SARS-CoV-2) inactivated vaccine(Vero cells),in order to better control the safety of products.Methods DNA was extracted from inactivated SARS-CoV-2 vaccine(Vero cells) bulk by magnetic bead separation method,and the DNA residues of host cells were quantitatively analyzed by probetype PCR.The linear range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy of the developed method were verified,and the host cell DNA re sidues of 5 batches of inactivated SARS-CoV-2 vaccine(Vero cells)were determined by this method.Results DNA standard curve showed good linearity in the range of 300～0.003 pg/μL(each R~2> 0.99);Relative standard deviations(RSD) of repeatability and intermediate precision verification were less than 20%;The quantitative limit was 0.001 pg/μL;Sample dilution and purified liquid dilution had no interference to detection;The results of 60 min incubation at 53,55,57 ℃ and 56,60,64 min incubation at 55 ℃ showed no significant difference;The recoveries of accuracy verification were 79%～83%,RSD <5%.This method had good adaptability in detecting DNA residues in the bulk of inactivated SARS-CoV-2 vaccine(Vero cells).Conclusion The quantitative realtime PCR method for determination of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells) has been successfully developed,of which the linearity and range,repeatability,intermediate precision,quantitative limit,specificity,durability and accuracy meet the acceptable standards,and are suitable for the detection and quality control of host cell DNA residues in inactivated SARS-CoV-2 vaccine(Vero cells).

Ion Exchange Chromatographic Methods for Purification of Therapeutic Antibodies.

Ion Exchange Chromatography has been a critical unit operation for manufacturing of therapeutic antibodies. Cation and anion exchange chromatography are used extensively to remove process-related as well as product-related impurities to obtain the final product. In this chapter, we describe the methods for separating and purifying charge variants and aggregates for manufacturing of monoclonal antibodies. The methods related to removal of host cell impurities such as host cell DNA and host cell proteins are also described. With minimal modifications, the protocols described here can be employed to purify any monoclonal antibody.

Direct bisulphite conversion of cervical samples for DNA methylation analysis.

Sodium bisulphite conversion of DNA to separate methylated from unmethylated cytosines is a standard for methylation analysis. This study evaluated a direct cell conversion protocol on cervical samples as alternative to isolated genomic DNA as input.Clinician-collected cervical samples (n = 120) were subjected to a direct conversion protocol, or genomic DNA was isolated with a fixed amount used for subsequent bisulphite conversion. Converted samples were compared for ACTB control gene and methylation of FAM19A4 and miR124-2 genes using quantitative methylation-specific PCR (QIAsure Methylation Test).Direct conversion resulted in a high success rate, i.e., 119/120 (99.2%) samples reported a valid test result. ΔΔCq values of FAM19A4 and miR124-2 were significantly correlated between both protocols (Spearman Rho 0.708 and 0.763, respectively, all p-values = 0.000). Agreement between both the bisulphite protocols was demonstrated by Bland-Altman plots.A direct cell conversion protocol shows good technical and analytical performance and offers a streamlined workflow for methylation analysis.

Characterisation of anal intraepithelial neoplasia and anal cancer in HIV-positive men by immunohistochemical markers p16, Ki-67, HPV-E4 and DNA methylation markers.

Human papillomavirus (HPV)-induced anal intraepithelial neoplasia (AIN, graded 1-3) is highly prevalent in HIV-positive (HIV+) men who have sex with men (MSM), but only a minority of lesions progresses to cancer. Our study aimed to characterise comprehensively anal tissue samples from a cross-sectional series (n = 104) of HIV+ MSM and longitudinal series (n = 40) of AIN2/3 progressing to cancer using different biomarkers. The cross-sectional series consisted of 8 normal, 26 AIN1, 45 AIN2, 15 AIN3 and 10 anal squamous cell carcinoma. Tissue sections were immunohistochemically (IHC) stained for p16 (viral transformation marker), Ki-67 (cellular proliferation marker) and HPV-E4 (viral production marker). We evaluated the expression of IHC markers and compared it with DNA methylation, a marker for malignant transformation. E4 positivity decreased, whereas p16 and Ki-67 scores and methylation marker positivity increased (P values < .001) with increasing severity of anal lesions. Within AIN2, a heterogeneous biomarker pattern was observed concerning E4, p16 and methylation status, reflecting the biological heterogeneity of these lesions. In the longitudinal series, all AIN2/3 and carcinomas showed high p16 and Ki-67 expression, strong methylation positivity and occasional E4 positivity. We earlier showed that high methylation levels are associated with progression to cancer. The observed E4 expression in some AIN2/3 during the course of progression to cancer and absence of E4 in a considerable number of AIN1 lesions make the potential clinical significance of E4 expression difficult to interpret. Our data show that IHC biomarkers can help to characterise AIN; however, their prognostic value for cancer risk stratification, next to objective methylation analysis, appears to be limited.

DNA methylation markers have universal prognostic value for anal cancer risk in HIV-negative and HIV-positive individuals.

Anal cancer has increasing incidence and is preceded by high-grade anal intraepithelial neoplasia (HGAIN; AIN2-3). Previously, we identified and validated several methylation markers for accurate detection of anal cancer and HGAIN with cancer risk in HIV-positive (HIV+) men who have sex with men (MSM). This study aimed to evaluate these markers in HIV-negative risk groups. A cross-sectional series of 176 tissue samples of anal cancer, AIN3, AIN2, AIN1 and control biopsies obtained in HIV-negative women and men was tested for six methylation markers (ASCL1, LHX8, SST, WDR17, ZIC1 and ZNF582). Accuracy for detection of AIN3 and cancer (AIN3+) was determined by univariable and multivariable mixed-effect ordinal logistic regression. Methylation levels of all markers increased with increasing severity of disease (P < 0.0001) and were comparable to results in HIV+ MSM. All markers showed high accuracy for AIN3+ detection [area under the curve (AUC): 0.83-0.86]. The optimal marker panel (ASCL1 and ZIC1; AUC = 0.85 for AIN3+) detected 98% of cancers at 79% specificity. In conclusion, DNA methylation markers show a high diagnostic performance for AIN3+ detection in HIV+ and HIV-negative risk groups, justifying broad application of methylation analysis for anal cancer prevention programmes.

Cancer Risk Stratification of Anal Intraepithelial Neoplasia in Human Immunodeficiency Virus-Positive Men by Validated Methylation Markers Associated With Progression to Cancer.

BACKGROUND: High-grade anal intraepithelial neoplasia (HGAIN; AIN2-3) is highly prevalent in HIV+ men, but only a minority of these lesions progress towards cancer. Currently, cancer progression risk cannot be established; therefore, no consensus exists on whether HGAIN should be treated. This study aimed to validate previously identified host cell DNA methylation markers for detection and cancer risk stratification of HGAIN. METHODS: A large independent cross-sectional series of 345 anal cancer, AIN3, AIN2, AIN1, and normal control biopsies of HIV+ men was tested for DNA methylation of 6 genes using quantitative methylation-specific PCR. We determined accuracy for detection of AIN3 and cancer (AIN3+) by univariable and multivariable logistic regression analysis, followed by leave-one-out cross-validation. Methylation levels were assessed in a series of 10 anal cancer cases with preceding HGAIN at similar anatomic locations, and compared with the cross-sectional series. RESULTS: Methylation levels of all genes increased with increasing severity of disease (P < .05). HGAIN revealed a heterogeneous methylation pattern, with a subset resembling cancer. ZNF582 showed highest accuracy (AUC = 0.88) for AIN3+ detection, slightly improved by addition of ASCL1 and SST (AUC = 0.89), forming a marker panel. In the longitudinal series, HGAIN preceding cancer displayed high methylation levels similar to cancers. CONCLUSIONS: We validated the accuracy of 5 methylation markers for the detection of anal (pre-) cancer. High methylation levels in HGAIN were associated with progression to cancer. These markers provide a promising tool to identify HGAIN in need of treatment, preventing overtreatment of HGAIN with a low cancer progression risk.

A novel method for removing polyethyleneimine from biopharmaceutical samples: improving assay sensitivity of residual DNA qPCR.

Polyethyleneimine (PEI) is a flocculent that is widely used in the downstream purification of monoclonal antibodies. It is an in-process residual that is carried through the drug purification process and strongly inhibits residual DNA quantitation by real-time quantitative PCR assay. Very high sample dilutions (e.g., 1:10,000) can overcome the interference of PEI, but at the cost of DNA assay sensitivity. Diluting samples poses a significant risk to the assay sensitivity needed to satisfy regulatory requirements on the quantitation of residual genomic DNA present per dose (i.e., 10 ng/dose). Removing PEI while retaining DNA, by the use of sodium dodecyl sulfate, heparin and/or sarkosyl can overcome the interference of PEI and allow a more accurate quantitation of residual DNA.

Method validation of Q-PCR detection of host residual DNA in antibody drug based on protein A magnetic beads.

The residual DNA derived from host cells in antibody drugs have potential safety risks. In this paper, the antibody in the test sample was removed by magnetic bead separation method, and the residual DNA were quantitatively determined by Q-PCR method. The residual DNA in the sample was analyzed according to the standard curve. We validated the species specificity, accuracy, precision, quantitative restrictions, reproducibility of this method. The results showed the linearrange was of 1 × 10-1～1 × 102 pg/µL and the curve linear was good, this method can specifically detect CHO cell DNA. Compared with the method of extracting residual DNA by magnetic beads, the method has the advantages of simplicity, rapidity and low cost, and can be used for quantitative determination of the residual host cell DNA in antibody drugs producted by CHO cells.

A Digestion-free Method for Quantification of Residual Host Cell DNA in rAAV Gene Therapy Products.

Recombinant adeno-associated virus (rAAV) is a vector with increasing popularity in the field of gene therapy. Like other drug substances manufactured in cell lines, rAAV vectors are commonly contaminated with host cell DNA, and the levels must be carefully monitored. The current method for residual DNA quantification in rAAV was adapted from protein programs and required sample digestion by proteinase prior to qPCR analysis. While the method worked effectively, it was unclear if proteinase digestion was essential for releasing DNA from rAAV capsids and improving qPCR efficiency. In this study, we systematically investigated the role of each component and treatment with the goal to simplify and streamline the method. It was determined that the proteinase digestion step was dispensable, while the addition of Tween 20 to rAAV samples was essential for accurate quantification of residual DNA. Based on this finding, a digestion-free method has been established that requires only a one-step sample preparation-addition of Tween 20. The method has been tested extensively with an rAAV9-based drug substance and process intermediates and verified with other rAAV serotypes. This significantly simplified and faster assay can be easily automated for high-throughput applications.

Intra- and inter-laboratory agreement of the FAM19A4/mir124-2 methylation test: Results from an international study.

BACKGROUND: HPV-based cervical screening detects women at an increased risk of cervical cancer and precancer. To differentiate among HPV-positive women those with (pre)cancer, triage testing is necessary. The detection of cancer-associated host-cell DNA methylation (FAM19A4 and hsa-mir124-2) in cervical samples has shown valuable as triage test. This multicenter study from 6 collaborating European laboratories and one reference laboratory was set out to determine the intra- and inter-laboratory agreement of FAM19A4/mir124-2 DNA methylation analysis utilizing the QIAsure Methylation Test. METHODS: Agreement analysis for the QIAsure Methylation Test was assessed on high-risk HPV-positive cervical specimens (n = 1680) both at the level of the assay and at the full workflow, including bisulfite conversion. RESULTS: Intra- and inter-laboratory assay agreement were 91.4% (534/584; 95% CI 88.9-93.5; κ = 0.82) and 92.5% (369/399; 95% CI 90.0-94.7; κ = 0.83), respectively. The inter-laboratory workflow (bisulfite conversion and assay combined) agreement was 90.0% (627/697; 95% CI 87.5%-92.0%; κ = 0.76). CONCLUSION: These data show that the QIAsure Methylation Test performs robust and reproducible in different laboratory contexts. These results support the use of the QIAsure Methylation Test for full molecular screening for cervical cancer, including primary HPV testing and triage testing by methylation analysis.

Comparative analysis of the performance of residual host cell DNA assays for viral vaccines produced in Vero cells.

Residual host cell DNA (rcDNA) from continuous cell lines used for manufacturing of biological medicinal products has been considered as safety risk. Historically, several analytical methods have been used for rcDNA quantitation including hybridization assay, Threshold® assay and quantitative polymerase chain reaction (qPCR). Sanofi Pasteur has a wealth of experience in the development of methods quantifying rcDNA in vaccines. Here, we compared the performance of our in-house assays for quantifying rcDNA in viral vaccines produced in Vero cells. Vero alpha-satellite sequence qPCR was compared with the hybridization and Threshold® assays in terms of specificity, sensitivity and precision. The impact of viral inactivation with ß-propiolactone (BPL) on rcDNA, within the vaccine production process, was also assessed. We demonstrate that the quantity of rcDNA measured is influenced by the analytical method used. Vero cell DNA-specific qPCR assay was shown to be robust with a large dynamic range and no matrix interference on a range of products. The qPCR assay demonstrated greater sensitivity and specificity versus the hybridization and Threshold® methods. Vero alpha-satellite sequence qPCR is a specific and sensitive method for the assessment of the quantity of Vero rcDNA in the highly purified vaccines.

Validation of Quantitative PCR-Taqman Probe Method for Detection of Residual NS0 Host Cell DNA / 中国药学杂志

OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.