Biocontrol potential of endophytic fungi against phytopathogenic nematodes on potato (Solanum tuberosum L.).

Root-knot nematodes (RKNs) are a vital pest that causes significant yield losses and economic damage to potato plants. The use of chemical pesticides to control these nematodes has led to environmental concerns and the development of resistance in the nematode populations. Endophytic fungi offer an eco-friendly alternative to control these pests and produce secondary metabolites that have nematicidal activity against RKNs. The objective of this study is to assess the efficacy of Aspergillus flavus (ON146363), an entophyte fungus isolated from Trigonella foenum-graecum seeds, against Meloidogyne incognita in filtered culture broth using GC-MS analysis. Among them, various nematicidal secondary metabolites were produced: Gadoleic acid, Oleic acid di-ethanolamide, Oleic acid, and Palmitic acid. In addition, biochemical compounds such as Gallic acid, Catechin, Protocatechuic acid, Esculatin, Vanillic acid, Pyrocatechol, Coumarine, Cinnamic acid, 4, 3-indol butyl acetic acid and Naphthyl acetic acid by HPLC. The fungus was identified through morphological and molecular analysis, including ITS 1-4 regions of ribosomal DNA. In vitro experiments showed that culture filtrate of A. flavus had a variable effect on reducing the number of egg hatchings and larval mortality, with higher concentrations showing greater efficacy than Abamectin. The fungus inhibited the development and multiplication of M. incognita in potato plants, reducing the number of galls and eggs by 90% and 89%, respectively. A. flavus increased the activity of defense-related enzymes Chitinas, Catalyse, and Peroxidase after 15, 45, and 60 days. Leaching of the concentrated culture significantly reduced the second juveniles' stage to 97% /250 g soil and decreased the penetration of nematodes into the roots. A. flavus cultural filtrates via soil spraying improved seedling growth and reduced nematode propagation, resulting in systemic resistance to nematode infection. Therefore, A. flavus can be an effective biological control agent for root-knot nematodes in potato plants. This approach provides a sustainable solution for farmers and minimizes the environmental impact.

How the root bacterial community of Ficus tikoua responds to nematode infection: enrichments of nitrogen-fixing and nematode-antagonistic bacteria in the parasitized organs.

Plant-parasitic nematodes (PPNs) are among the most damaging pathogens to host plants. Plants can modulate their associated bacteria to cope with nematode infections. The tritrophic plant-nematode-microbe interactions are highly taxa-dependent, resulting in the effectiveness of nematode agents being variable among different host plants. Ficus tikoua is a versatile plant with high application potential for fruits or medicines. In recent years, a few farmers have attempted to cultivate this species in Sichuan, China, where parasitic nematodes are present. We used 16S rRNA genes to explore the effects of nematode parasitism on root-associated bacteria in this species. Our results revealed that nematode infection had effects on both endophytic bacterial communities and rhizosphere communities in F. tikoua roots, but on different levels. The species richness increased in the rhizosphere bacterial communities of infected individuals, but the community composition remained similar as compared with that of healthy individuals. Nematode infection induces a deterministic assembly process in the endophytic bacterial communities of parasitized organs. Significant taxonomic and functional changes were observed in the endophytic communities of root knots. These changes were characterized by the enrichment of nitrogen-fixing bacteria, including Bradyrhizobium, Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium, and nematode-antagonistic bacteria, such as Pseudonocardia, Pseudomonas, Steroidobacter, Rhizobacter, and Ferrovibrio. Our results would help the understanding of the tritrophic plant-nematode-bacterium interactions in host plants other than dominant crops and vegetables and would provide essential information for successful nematode management when F. tikoua were cultivated on large scales.

A case of larva migrans representing a pitfall in oral diagnosis.

The present work reports a case of a female patient complaining of itching and painful lesions affecting the oral mucosa for 7 months. Buccal and lip mucosa showed swelling and erythema, with serpiginous tracks. The patient was diagnosed with oral larva migrans, and the lesions resolved after ivermectin administration. At 18-month follow-up, no sign of recurrence was observed. Larva migrans can represent a pitfall in oral diagnosis and a stressful condition for the patient. Oral health care providers should be aware of this and keep this disease in mind as a possible differential diagnosis in oral mucosa lesions.

Nematode Galectin Inhibits Basophilic Leukaemia RBL-2H3 Cells Apoptosis in IgE-Mediated Activation.

Mast cells are essential immune cells involved in the host's defence against gastrointestinal nematodes. To evade the immune response, parasitic nematodes produce a variety of molecules. Galectin 1, produced by Teladorsagia circumcincta (Tci-gal-1), reduces mast cell degranulation and selectively regulates mediator production and release in an IgE-dependent manner. To uncover the activity of Tci-gal-1, we have examined the effect of the protein on gene expression, protein production, and apoptosis in activated basophilic leukaemia RBL-2H3 cells. Rat RBL-2H3 cells were activated with anti-DNP IgE and DNP-HSA, and then treated with Tci-gal-1. Microarray analysis was used to examine gene expression. The levels of several apoptosis-related molecules and cytokines were determined using antibody arrays and ELISA. Early and late apoptosis was evaluated cytometrically. Degranulation of cells was determined by a ß-hexosaminidase release assay. Treatment of activated RBL-2H3 cells with Tci-gal-1 resulted in inhibited apoptosis and decreased degranulation, although we did not detect significant changes in gene expression. The production of pro-apoptotic molecules, receptor for advanced glycation end products (RAGE) and Fas ligand (FasL), and the cytokines IL-9, IL-10, IL-13, TNF-α, and IL-2 was strongly inhibited. Tci-gal-1 modulates apoptosis, degranulation, and production of cytokines by activated RBL-2H3 cells without detectable influence on gene transcription. This parasite protein is crucial for modulation of the protective immune response and the inhibition of chronic inflammation driven by mast cell activity.

Inconsistency of in vitro exsheathment triggers for gastrointestinal nematode parasites of sheep, cattle and deer.

Exsheathment is crucial in the transition from free-living to parasitic phase for most strongyle nematode species. A greater understanding of this process could help in developing new parasitic control methods. This study aimed to identify commonalities in response to exsheathment triggers (heat acclimation, CO2 and pH) in a wide range of species (Haemonchus contortus, Trichostrongylus spp., Cooperia spp., Oesophagostomum spp., Chabertia ovina, and members of the subfamily Ostertagiinae) from sheep, cattle and farmed deer. The initial expectation of similarity in pH requirements amongst species residing within the same organ was not supported, with unexpected pH preferences for exsheathment of Trichostrongylus axei, Trichostrongylus vitrinus, Trichostrongylus colubriformis and Cooperia oncophora. We also found differences between species in their response to temperature acclimation, with higher exsheathment in response to heat shock observed for H. contortus, Ostertagia ostertagi, T. axei, T. vitrinus and Oesophagostomum sikae. Furthermore, some species showed poor exsheathment under all experimental conditions, such as Cooperia curticei and the large intestinal nematodes C. ovina and Oesophagostomum venulosum. Interestingly, there were some significant differences in response depending on the host from which the parasites were derived. The host species significantly impacted on the exsheathment response for H. contortus, Teladorsagia circumcincta, T. vitrinus and T. colubriformis. Overall, the data showed variability between nematode species in their response to these in vitro exsheathment triggers, highlighting the complexity of finding a common set of conditions for all species in order to develop a control method based on triggering the exsheathment process prematurely.

Counting nematodes made easy: leveraging AI-powered automation for enhanced efficiency and precision.

Counting nematodes is a labor-intensive and time-consuming task, yet it is a pivotal step in various quantitative nematological studies; preparation of initial population densities and final population densities in pot, micro-plot and field trials for different objectives related to management including sampling and location of nematode infestation foci. Nematologists have long battled with the complexities of nematode counting, leading to several research initiatives aimed at automating this process. However, these research endeavors have primarily focused on identifying single-class objects within individual images. To enhance the practicality of this technology, there's a pressing need for an algorithm that cannot only detect but also classify multiple classes of objects concurrently. This study endeavors to tackle this challenge by developing a user-friendly Graphical User Interface (GUI) that comprises multiple deep learning algorithms, allowing simultaneous recognition and categorization of nematode eggs and second stage juveniles of Meloidogyne spp. In total of 650 images for eggs and 1339 images for juveniles were generated using two distinct imaging systems, resulting in 8655 eggs and 4742 Meloidogyne juveniles annotated using bounding box and segmentation, respectively. The deep-learning models were developed by leveraging the Convolutional Neural Networks (CNNs) machine learning architecture known as YOLOv8x. Our results showed that the models correctly identified eggs as eggs and Meloidogyne juveniles as Meloidogyne juveniles in 94% and 93% of instances, respectively. The model demonstrated higher than 0.70 coefficient correlation between model predictions and observations on unseen images. Our study has showcased the potential utility of these models in practical applications for the future. The GUI is made freely available to the public through the author's GitHub repository (https://github.com/bresilla/nematode_counting). While this study currently focuses on one genus, there are plans to expand the GUI's capabilities to include other economically significant genera of plant parasitic nematodes. Achieving these objectives, including enhancing the models' accuracy on different imaging systems, may necessitate collaboration among multiple nematology teams and laboratories, rather than being the work of a single entity. With the increasing interest among nematologists in harnessing machine learning, the authors are confident in the potential development of a universal automated nematode counting system accessible to all. This paper aims to serve as a framework and catalyst for initiating global collaboration toward this important goal.

Current status and future trends of microbial and nematode-based biopesticides for biocontrol of crop pathogens.

The increasing public demand to avoid the use of synthetic pesticides and fertilizers in agricultural production systems, causing serious environmental damages, has challenged industry to develop new and effective solutions to manage and control phytopathogens. Biopesticides, particularly microbial-based biopesticides, are a promising new alternative with high biodegradability, specificity, suitability for incorporation into integrated pest management practices, low likelihood of resistance development, and practically no known human health risks. However: expensive production methods, narrow action spectra, susceptibility to environmental conditions, short shelf life, poor storage stability, legislation registry constraints, and general lack of knowledge are slowing down their adoption. In addition to regulatory framework revisions and improved training initiatives, improved preservation methods, thoughtfully designed formulations, and field test validations are needed to offer new microbial- and nematode-based biopesticides with improved efficacy and increased shelf-life. During the last several years, substantial advancements in biopesticide production have been developed. The novelty part of this review written in 2023 is to summarize (i) mechanisms of action of beneficial microorganisms used to increase crop performance and (ii) successful formulation including commercial products for the biological control of phytopathogens based on microorganisms, nematode and/or metabolites.

GENETIC AND TRAIT VARIABILITY OF GYRINICOLA REVEALS THE EXISTENCE OF AT LEAST FOUR SPECIES WITHIN THE UNITED STATES.

The tadpole-dwelling pinworm, Gyrinicola batrachiensis (Walton, 1929) Adamson, 1981 was recognized as the sole representative of the genus across Canada and the United States. However, evaluation of the morphology of these parasites across their range revealed considerable morphological variability that suggested diagnosable morphotypes. These morphotypes were associated with different species of anurans, several of which occurred in sympatry. Herein we use an extensive geographic sampling across the United States to obtain the morphotypes, screen their genetic diversity, and analyze this information using an integrative approach. We reconstructed their phylogeny using nuclear ribosomal partial genes 18S and 28S, ITS1, 5.8S, and ITS2, as well as 5 mitochondrial genes generated with Next-Generation sequencing technology. This phylogeny reveals 3 well-resolved lineages, which upon the use of a statistical approach (bPTP [Bayesian implementation of the Poisson tree processes]) supports the delimitation of 4 distinct groups equivalent to species. These putative species groups were tested using morphological characteristics paired with a MANOVA and canonical variate analysis. Results suggest that at least 4 species of Gyrinicola are present within North America, resulting in the resurrection of G. armatus (Walton, 1933) and the description of 2 new species.

Low microbial diversity, yeast prevalence, and nematode-trapping fungal presence in fungal colonization and leaf microbiome of Serjania erecta.

Medicinal plant microbiomes undergo selection due to secondary metabolite presence. Resident endophytic/epiphytic microorganisms directly influence plant's bioactive compound synthesis. Hypothesizing low microbial diversity in Serjania erecta leaves, we assessed leaf colonization by epiphytic and endophytic fungi. Given its traditional medicinal importance, we estimated diversity in the endophytic fungal microbiome. Analyses included scanning electron microscopy (SEM), isolation of cultivable species, and metagenomics. Epiphytic fungi interacted with S. erecta leaf tissues, horizontally transmitted via stomata/trichome bases, expressing traits for nematode trapping. Cultivable endophytic fungi, known for phytopathogenic habits, didn't induce dysbiosis symptoms. This study confirms low leaf microbiome diversity in S. erecta, with a tendency towards more fungal species, likely due to antibacterial secondary metabolite selection. The classification of Halicephalobus sp. sequence corroborated the presence of nematode eggs on the epidermal surface of S. erecta by SEM. In addition, we confirmed the presence of methanogenic archaea and a considerable number of methanotrophs of the genus Methylobacterium. The metagenomic study of endophytic fungi highlighted plant growth-promoting yeasts, mainly Malassezia, Leucosporidium, Meyerozyma, and Hannaella. Studying endophytic fungi and S. erecta microbiomes can elucidate their impact on beneficial bioactive compound production, on the other hand, it is possible that the bioactive compounds produced by this plant can recruit specific microorganisms, impacting the biological system.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

PmHs1pro-1 monitors Bsursaphelenchus xylophilus infection and activates defensive response in resistant Pinus massoniana.

Plant resistance (R) genes play a crucial role in the detection of effector proteins secreted by pathogens, either directly or indirectly, as well as in the subsequent activation of downstream defence mechanisms. However, little is known about how R genes regulate the defence responses of conifers, particularly Pinus massoniana, against the destructive pine wood nematode (PWN; Bursaphelenchus xylophilus). Here, we isolated and characterised PmHs1pro-1, a nematode-resistance gene of P. massoniana, using bioinformatics, molecular biology, histochemistry and transgenesis. Tissue-specific expressional pattern and localisation of PmHs1pro-1 suggested that it was a crucial positive regulator in response to PWN attack in resistant P. massoniana. Meanwhile, overexpression of PmHs1pro-1 was found to activate reactive oxygen species (ROS) metabolism-related enzymes and the expressional level of their key genes, including superoxide dismutase, peroxidase and catalase. In addition, we showed that PmHs1pro-1 directly recognised the effector protein BxSCD1of PWN, and induced the ROS burst responding to PWN invasion in resistant P. massoniana. Our findings illustrated the molecular framework of R genes directly recognising the effector protein of pathology in pine, which offered a novel insight into the plant-pathogen arms race.

Host vegetation connectivity is decisive for the natural spread of pine wilt disease.

BACKGROUND: Pine wilt disease has caused significant economic, ecological, and social losses in China, but there is a notable lack of research on the dynamic process of its propagation and diffusion over long timescales. This study revealed the spatial and temporal spread of the natural invasion of pine wilt disease through an analysis of long time series at macroscopic scales. We analysed and verified by simulations the driving mechanisms of host and wind fields in the natural spread of pine wilt disease. RESULTS: The research findings indicate that from 1982 to 2019, the number of counties affected by pine wilt disease in the Yangtze River Delta region of China exhibited a pattern of 'steady increase-fluctuation-outbreak'. The host forest played a decisive role in the natural spread of the disease, while the wind field played a supporting role. The study revealed specific contributions from various factors, where host forest landscape connectivity, host forest area share, mean wind speed, and wind frequency accounted for 31.8%, 28.7%, 22.6%, and 8.8%, respectively. The interaction of increased host forest area and increased wind speed can significantly increase the risk of pine wilt disease transmission. To validate these findings, vectorial metacellular automata simulations of pine nematode transmission in the Yangtze River Delta were conducted, yielding results with an accuracy of 0.803. CONCLUSION: By quantifying the contribution of host forest connectivity to the natural spread of pine wilt disease, this research offers a scientific foundation and innovative insights for preventing and controlling its dissemination. © 2024 Society of Chemical Industry.

Redundancy in microbiota-mediated suppression of the soybean cyst nematode.

BACKGROUND: Soybean cyst nematodes (SCN) as animal parasites of plants are not usually interested in killing the host but are rather focused on completing their life cycle to increase population, resulting in substantial yield losses. Remarkably, some agricultural soils after long-term crop monoculture show a significant decline in SCN densities and suppress disease in a sustainable and viable manner. However, relatively little is known about the microbes and mechanisms operating against SCN in such disease-suppressive soils. RESULTS: Greenhouse experiments showed that suppressive soils (S) collected from two provinces of China and transplantation soils (CS, created by mixing 10% S with 90% conducive soils) suppressed SCN. However, SCN suppressiveness was partially lost or completely abolished when S soils were treated with heat (80 °C) and formalin. Bacterial community analysis revealed that the specific suppression in S and CS was mainly associated with the bacterial phylum Bacteroidetes, specifically due to the enrichment of Chitinophaga spp. and Dyadobacter sp., in the cysts. SCN cysts colonized by Chitinophaga spp. showed dramatically reduced egg hatching, with unrecognizable internal body organization of juveniles inside the eggshell due to chitinase activity. Whereas, Dyadobacter sp. cells attached to the surface coat of J2s increased soybean resistance against SCN by triggering the expression of defence-associated genes. The disease-suppressive potential of these bacteria was validated by inoculating them into conducive soil. The Dyadobacter strain alone or in combination with Chitinophaga strains significantly decreased egg densities after one growing cycle of soybeans. In contrast, Chitinophaga strains alone required more than one growing cycle to significantly reduce SCN egg hatching and population density. CONCLUSION: This study revealed how soybean monoculture for decades induced microbiota homeostasis, leading to the formation of SCN-suppressive soil. The high relative abundance of antagonistic bacteria in the cyst suppressed the SCN population both directly and indirectly. Because uncontrolled proliferation will likely lead to quick demise due to host population collapse, obligate parasites like SCN may have evolved to modulate virulence/proliferation to balance these conflicting needs. Video Abstract.

[Microbiological and parasitological risk analysis of novel food sources obtained with the use of insects].

The problem of food safety being an important component of the country's food security, provides not only for continuous improvement of the methodology of hygienic standardization, but also for the formation of requirements for novel food, in particular, those obtained from non-traditional sources. The accumulated practical and theoretical competence in the food hygiene area, as well as knowledge of current trends of the food base broadening, allow us to analyze the risks associated with novel food obtained of insects. The purpose of the research was to analyze the microbiological and parasitological risk of novel food sources obtained with the use of insects, suggest the effective risk management measures. Material and methods. The analytical part of the work included literature search, collection of information and statistical materials published in domestic and foreign scientific editions. The search was carried out using the Google Academy retrieval system and electronic databases (PubMed, MEDLINE, EMBASE, Scopus, Web of Science, eLIBRARY), mainly in the last 25 years, using the keywords: Hermetia illucens, Tenebrio molitor, Acheta domesticus, insects, parasite, nematode, pathogen, cysts. Results. Based on the published materials' analysis, a systematization of microbiological and parasitological factors potentially capable of colonizing edible insects has been carried out. There were identified representatives of 24 groups of pathogenic and 18 opportunistic microorganisms and helminths related to microbial and parasitic pathogens, the spread of which is significantly influenced by inappropriate conditions of feeding and keeping insects. As there are currently no veterinary requirements for insect breeding and farming conditions, contamination of end products with infectious and parasitic pathogens can vary over a very wide range. Conclusion. The use of native insect biomass carries certain risks associated with its microbial and parasitic contamination, and the development of measures to prevent them requires significant resources. The possibility of deep processing of such raw materials can be considered as one of the solutions to mitigate these risks. For use in the food industry, insects should be subjected to processing similar to that currently used for soybean seeds, which includes separation of protein (entomoprotein), fat and chitin fractions, each of which would have an independent use. Thus, at present, insects should be considered as a source of novel food ingredients, first of all, complete protein of animal origin.

Prevalence and risk factors for gastrointestinal parasitosis in small ruminant farms in the Sahelian zone of Niger.

The general aim of this study is to analyse the risk factors for gastrointestinal parasitosis in small ruminants in order to contribute to the emergence of targeted treatment methods, at herd and agro-climatic zone levels, for the integrated and sustainable management of parasitic diseases in Sahelian livestock systems. The methodology was based on a questionnaire survey conducted in 37 villages and coprological analysis using the McMaster method on faecal samples from 968 small ruminants, including 555 goats and 413 sheep. Multiple logistic regression was used to highlight the risk factors associated with each type of parasitosis encountered. The results showed that the most widespread farming system remained 100% traditional, with feeding based essentially on natural grazing. Coprological results showed the prevalence of nematodosis (70.2%), Cestodosis (4.1%) and Coccidiosis (79.9%), with an average prevalence of coinfection of 56.9%. These parasite loads were significantly higher during the rainy season and in the more arid northern Sahelian zone, with a marked reduction at the end of the season. Average parasitic egg excretions were 1089 EPG of nematodes and 6864 EPG of coccidia. Parasite loads were higher in the wetter southern strip and varied significantly by breed. Of the five breeds of small ruminants studied, the ara-ara sheep had the highest parasitic loads and prevalences for nematodosis (78.6%), coccidiosis (89,3%) and coinfection (70.9%), appears to be the most susceptible to parasitosis. As for risk factors for severe parasite pressure, animals at the end of the rainy season, older animals and those with poor body condition were at risk of nematodiasis or coinfection. On the other hand, animals at the beginning of the rainy season, farms located in less arid southern Sahelian zones and male subjects were the groups at significant risk of coccidiosis. In these extensive Sahelian farming conditions, the control of these parasitoses by selective treatment of animals could be developed, targeting in particular the risk groups highlighted in this study.

The generation of stable transgenic lines in the human-infective nematode Strongyloides stercoralis.

The skin-penetrating gastrointestinal parasitic nematode Strongyloides stercoralis causes strongyloidiasis, which is a neglected tropical disease that is associated with severe chronic illness and fatalities. Unlike other human-infective nematodes, S. stercoralis cycles through a single free-living generation and thus serves as a genetically tractable model organism for understanding the mechanisms that enable parasitism. Techniques such as CRISPR/Cas9-mediated mutagenesis and transgenesis are now routinely performed in S. stercoralis by introducing exogenous DNA into free-living adults and then screening their F1 progeny for transgenic or mutant larvae. However, transgenesis in S. stercoralis has been severely hindered by the inability to establish stable transgenic lines that can be propagated for multiple generations through a host; to date, studies of transgenic S. stercoralis have been limited to heterogeneous populations of transgenic F1 larvae. Here, we develop an efficient pipeline for the generation of stable transgenic lines in S. stercoralis. We also show that this approach can be used to efficiently generate stable transgenic lines in the rat-infective nematode Strongyloides ratti. The ability to generate stable transgenic lines circumvents the limitations of working with heterogeneous F1 populations, such as variable transgene expression and the inability to generate transgenics of all life stages. Our transgenesis approach will enable novel lines of inquiry into parasite biology, such as transgene-based comparisons between free-living and parasitic generations.

Characterization of the Hepatic Transcriptome for Divergent Immune-Responding Sheep Following Natural Exposure to Gastrointestinal Nematodes.

Infections with gastrointestinal nematodes (GINs) reduce the economic efficiency of sheep operations and compromise animal welfare. Understanding the host's response to GIN infection can help producers identify animals that are naturally resistant to infection. The objective of this study was to characterize the hepatic transcriptome of sheep that had been naturally exposed to GIN parasites. The hepatic transcriptome was studied using RNA-Sequencing technology in animals characterized as high (n = 5) or medium (n = 6) based on their innate immune acute-phase (AP) response phenotype compared with uninfected controls (n = 4), and with biased antibody-mediated (AbMR, n = 5) or cell-mediated (CMR, n = 5) adaptive immune responsiveness compared to uninfected controls (n = 3). Following the assessment of sheep selected for innate responses, 0, 136, and 167 genes were differentially expressed (DE) between high- and medium-responding animals, high-responding and uninfected control animals, and medium-responding and uninfected control animals, respectively (false discovery rate (FDR) < 0.05, and fold change |FC| > 2). When adaptive immune responses were assessed, 0, 53, and 57 genes were DE between antibody- and cell-biased animals, antibody-biased and uninfected control animals, and cell-biased and uninfected control animals, respectively (FDR < 0.05, |FC| > 2). Functional analyses identified enriched gene ontology (GO) terms and metabolic pathways related to the innate immune response and energy metabolism. Six functional candidate genes were identified for further functional and validation studies to better understand the underlying biological mechanisms of host responses to GINs. These, in turn, can potentially help improve decision making and management practices to increase the overall host immune response to GIN infection.

Glycine max polygalacturonase inhibiting protein 11 (GmPGIP11) functions in the root to suppress Heterodera glycines parasitism.

Pathogen-secreted polygalacturonases (PGs) alter plant cell wall structure by cleaving the α-(1 â†’ 4) linkages between D-galacturonic acid residues in homogalacturonan (HG), macerating the cell wall, facilitating infection. Plant PG inhibiting proteins (PGIPs) disengage pathogen PGs, impairing infection. The soybean cyst nematode, Heterodera glycines, obligate root parasite produces secretions, generating a multinucleate nurse cell called a syncytium, a byproduct of the merged cytoplasm of 200-250 root cells, occurring through cell wall maceration. The common cytoplasmic pool, surrounded by an intact plasma membrane, provides a source from which H. glycines derives nourishment but without killing the parasitized cell during a susceptible reaction. The syncytium is also the site of a naturally-occurring defense response that happens in specific G. max genotypes. Transcriptomic analyses of RNA isolated from the syncytium undergoing the process of defense have identified that one of the 11 G. max PGIPs, GmPGIP11, is expressed during defense. Functional transgenic analyses show roots undergoing GmPGIP11 overexpression (OE) experience an increase in its relative transcript abundance (RTA) as compared to the ribosomal protein 21 (GmRPS21) control, leading to a decrease in H. glycines parasitism as compared to the overexpression control. The GmPGIP11 undergoing RNAi experiences a decrease in its RTA as compared to the GmRPS21 control with transgenic roots experiencing an increase in H. glycines parasitism as compared to the RNAi control. Pathogen associated molecular pattern (PAMP) triggered immunity (PTI) and effector triggered immunity (ETI) components are shown to influence GmPGIP11 expression while numerous agricultural crops are shown to have homologs.

Soil enzyme profile analysis for indicating decomposer micro-food web.

Highly diverse exoenzymes mediate the energy flow from substrates to the multitrophic microbiota within the soil decomposer micro-food web. Here, we used a "soil enzyme profile analysis" approach to establish a series of enzyme profile indices; those indices were hypothesized to reflect micro-food web features. We systematically evaluated the shifts in enzyme profile indices in relation to the micro-food web features in the restoration of an abandoned cropland to a natural area. We found that enzymatic C:N stoichiometry and decomposability index were significantly associated with substrate availability. Furthermore, the higher Shannon diversity index in the exoenzyme profile, especially for the C-degrading hydrolase, corresponded to a greater microbiota community diversity. The increased complexity and stability of the exoenzyme network reflected similar changes with the micro-food web networks. In addition, the gross activity of the enzyme profile as a parameter for soil multifunctionality, effectively predicted the substrate content, microbiota community size, diversity, and network complexity. Ultimately, the proposed enzymic channel index was closely associated with the traditional decomposition channel indices derived from microorganisms and nematodes. Our results showed that soil enzyme profile analysis reflected very well the decomposer food web features. Our study has important implications for projecting future climate change or anthropogenic disturbance impacts on soil decomposer micro-food web features by using soil enzyme profile analysis.

Surveillance of Ancylostoma caninum in naturally infected dogs in Quebec, Canada, and assessment of benzimidazole anthelmintics reveal a variable efficacy with the presence of a resistant isolate in imported dogs.

Ancylostoma caninum is a widely prevalent parasitic nematode in dogs across the world. There has been a notable increase in reports of anthelmintic resistance in A. caninum within the United States of America in recent years, which has led us to investigate the potential of this scenario in Canada. The study objectives were to assess the prevalence of A. caninum in two different groups, including a colony of rescued dogs in Canada and three imported Greyhound dogs from USA, and to evaluate the efficacy of two benzimidazole (BZ) anthelmintics against A. caninum, complemented with a molecular genetic analysis adapted to low prevalence. Fecal samples were collected at pre- and post-treatment with fenbendazole for the native shelters-origin group, and a combination of anthelmintic formulations, including the pro-BZ febantel for the USA-origin group. The coprology analyses found several genera of internal parasites. Canine ancylostomiasis was the most prevalent parasitosis with 30.77% in the native group and 100% in the USA group, but with overall low average of A. caninum eggs per gram. Through the fecal egg count reduction test (FECRT), applying a cut-off at 90% as baseline of egg reduction for successful efficacy, BZ showed variable efficacy. Furthermore, molecular analysis confirmed the presence of A. caninum in both groups of dogs and found differences in the genetics linked to BZ resistance on the A. caninum ß-tubulin isotype 1 gene. In the isolate from the native group, both codons 167 and 200 were homozygous without the presence of single nucleotide polymorphism (SNP). In contrast, the selected isolate from the USA group, showed a homozygous allele at position 200 and a heterozygous SNP at position 167. The latter was congruent with the low efficacy in FECRT and agrees with the recent findings of USA A. caninum isolate resistant phenotype to the BZ anthelmintics. The limitations of the study include an overall low eggs-per-gram in both canine groups, and the shortage of additional fecal samples from the USA group, restraining the molecular analysis only to one out of the three Greyhounds. This study provided some insights on the efficacy of BZs against A. caninum and revealed the presence of BZ resistant isolates in imported dogs in Quebec, Canada. All this information should be considered, for choosing the best strategy in the control of A. caninum using anthelmintic drugs.