Mixed infections with new emerging viruses associated with jujube mosaic disease / Infecciones mixtas con nuevos virus emergentes asociados con la enfermedad del mosaico de azufaifa

Background: Jujube is an economically important fruit tree and native to China. Viral disease is a new threat to jujube production, and several new viruses have been identified infecting jujube plants. During our field survey, jujube mosaic disease was widely distributed in Beijing, but the associated causal agents are still unknown. Methods: Small RNA deep sequencing was conducted to identify the candidate viruses associated with jujube mosaic. Further complete genome sequences of the viruses were cloned, and the genomic characterization of each virus was analyzed. The field distribution of these viruses was further explored with PCR/RT-PCR detection of field samples. Results: Mixed infection of four viruses was identified in a plant sample with the symptom of mosaic and leaf twisting, including the previously reported jujube yellow mottle-associated virus (JYMaV), persimmon ampelovirus (PAmpV), a new badnavirus tentatively named jujube-associated badnavirus (JaBV), and a new secovirus tentatively named jujube-associated secovirus (JaSV). PAmpV-jujube was 14,093 nt in length with seven putative open reading frames (ORFs) and shared highest (79.4%) nucleotide (nt) sequence identity with PAmpV PBs3. Recombination analysis showed that PAmpV-jujube was a recombinant originating from plum bark necrosis stem pitting-associated virus isolates nanjing (KC590347) and bark (EF546442). JaBV was 6449 bp in length with conserved genomic organization typical of badnaviruses. The conserved RT and RNAse H region shared highest 67.6% nt sequence identity with jujube mosaic-associated virus, which was below the 80% nt sequence identity value used as the species demarcation threshold in Badnavirus. The genome of JaSV composed of two RNA molecules of 5878 and 3337 nts in length, excluding the polyA tails. Each genome segment contained one large ORF that shared homology and phylogenetic identity with members of the family Secoviridae...(AU)

Mixed infections with new emerging viruses associated with jujube mosaic disease.

BACKGROUND: Jujube is an economically important fruit tree and native to China. Viral disease is a new threat to jujube production, and several new viruses have been identified infecting jujube plants. During our field survey, jujube mosaic disease was widely distributed in Beijing, but the associated causal agents are still unknown. METHODS: Small RNA deep sequencing was conducted to identify the candidate viruses associated with jujube mosaic. Further complete genome sequences of the viruses were cloned, and the genomic characterization of each virus was analyzed. The field distribution of these viruses was further explored with PCR/RT-PCR detection of field samples. RESULTS: Mixed infection of four viruses was identified in a plant sample with the symptom of mosaic and leaf twisting, including the previously reported jujube yellow mottle-associated virus (JYMaV), persimmon ampelovirus (PAmpV), a new badnavirus tentatively named jujube-associated badnavirus (JaBV), and a new secovirus tentatively named jujube-associated secovirus (JaSV). PAmpV-jujube was 14,093 nt in length with seven putative open reading frames (ORFs) and shared highest (79.4%) nucleotide (nt) sequence identity with PAmpV PBs3. Recombination analysis showed that PAmpV-jujube was a recombinant originating from plum bark necrosis stem pitting-associated virus isolates nanjing (KC590347) and bark (EF546442). JaBV was 6449 bp in length with conserved genomic organization typical of badnaviruses. The conserved RT and RNAse H region shared highest 67.6% nt sequence identity with jujube mosaic-associated virus, which was below the 80% nt sequence identity value used as the species demarcation threshold in Badnavirus. The genome of JaSV composed of two RNA molecules of 5878 and 3337 nts in length, excluding the polyA tails. Each genome segment contained one large ORF that shared homology and phylogenetic identity with members of the family Secoviridae. Field survey showed JYMaV and JaBV were widely distributed in jujube trees in Beijing. CONCLUSION: Two new viruses were identified from jujube plants, and mixed infections of JYMaV and JaBV were common in jujube in Beijing.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Contrasting the Practices of Virus Isolation and Characterization between the Early Period in History and Modern Times: The Case of Japanese Encephalitis Virus.

Japanese encephalitis is a serious disease transmitted by mosquitoes. With its recent spread beyond the traditional territory of endemicity in Asia, the magnitude of global threat has increased sharply. While much of the current research are largely focused on changing epidemiology, molecular genetics of virus, and vaccination, little attention has been paid to the early history of virus isolation and phenotypic characterization of this virus. In this review, using this piece of history as an example, I review the transition of the concept and practice of virus isolation and characterization from the early period of history to modern times. The spectacular development of molecular techniques in modern times has brought many changes in practices as well as enormous amount of new knowledge. However, many aspects of virus characterization, in particular, transmission mechanism and host relationship, remain unsolved. As molecular techniques are not perfect in all respects, beneficial accommodation of molecular and biologic data is critically important in many branches of research. Accordingly, I emphasize exercising caution in applying only these modern techniques, point out unrecognized communication problems, and stress that JE research history is a rich source of interesting works still valuable even today and waiting to be discovered.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Metagenomic Analysis of Marigold: Mixed Infection Including Two New Viruses.

Marigold plants with symptoms of mosaic, crinkle, leaf curl and necrosis were observed and small RNA and ribo-depleted total RNA deep sequencing were conducted to identify the associated viruses. Broad bean wilt virus 2, cucumber mosaic virus, turnip mosaic virus, a new potyvirus tentatively named marigold mosaic virus (MMV) and a new partitivirus named as marigold cryptic virus (MCV) were finally identified. Complete genome sequence analysis showed MMV was 9811 nt in length, encoding a large polyprotein with highest aa sequence identity (57%) with the putative potyvirus polygonatumkingianum virus 1. Phylogenetic analysis with the definite potyviruses based on the polyprotein sequence showed MMV clustered closest to plum pox virus. The complete genome of MCV comprised of dsRNA1 (1583 bp) and dsRNA2 (1459 bp), encoding the RNA-dependent RNA polymerase (RdRp), and coat protein (CP), respectively. MCV RdRp shared the highest (75.7%) aa sequence identity with the unclassified partitivirus ambrosia cryptic virus 2, and 59.0%, 57.1%, 56.1%, 54.5% and 33.7% with the corresponding region of the definite delta-partitiviruses, pepper cryptic virus 2, beet cryptic virus 3, beet cryptic virus 2, pepper cryptic virus 1 and fig cryptic virus, respectively. Phylogenetic analysis based on the RdRp aa sequence showed MCV clustered into the delta-partitivirus group. These findings enriched our knowledge of viruses infecting marigold, but the association of the observed symptom and the identified viruses and the biological characterization of the new viruses should be further investigated.

Is There a "Biological Desert" With the Discovery of New Plant Viruses? A Retrospective Analysis for New Fruit Tree Viruses.

High throughput sequencing technologies accelerated the pace of discovery and identification of new viral species. Nevertheless, biological characterization of a new virus is a complex and long process, which can hardly follow the current pace of virus discovery. This review has analyzed 78 publications of new viruses and viroids discovered from 32 fruit tree species since 2011. The scientific biological information useful for a pest risk assessment and published together with the discovery of a new fruit tree virus or viroid has been analyzed. In addition, the 933 publications citing at least one of these original publications were reviewed, focusing on the biology-related information provided. In the original publications, the scientific information provided was the development of a detection test (94%), whole-genome sequence including UTRs (92%), local and large-scale epidemiological surveys (68%), infectivity and indicators experiments (50%), association with symptoms (25%), host range infection (23%), and natural vector identification (8%). The publication of a new virus is cited 2.8 times per year on average. Only 18% of the citations reported information on the biology or geographical repartition of the new viruses. These citing publications improved the new virus characterization by identifying the virus in a new country or continent, determining a new host, developing a new diagnostic test, studying genome or gene diversity, or by studying the transmission. Based on the gathered scientific information on the virus biology, the fulfillment of a recently proposed framework has been evaluated. A baseline prioritization approach for publishing a new plant virus is proposed for proper assessment of the potential risks caused by a newly identified fruit tree virus.

Characterization of a New Monopartite Begomovirus with a Betasatellite Associated with Leaf Curl, Yellow Vein, and Vein Enation in Hibiscus rosa-sinensis.

A new begomovirus, tentatively named hibiscus yellow vein leaf curl virus (HYVLCV), was identified in Hibiscus rosa-sinensis plants showing symptoms of leaf curl, yellow vein, and vein enation on the undersides of the leaf in Taiwan. Sequence analysis of the full-length HYVLCV genome from the rolling cycle amplicon revealed a genome of 2,740 nucleotides that contains six open reading frames and a conserved sequence (5'-TAATATTAC-3') commonly found in geminiviral genomes. HYVLCV shares the highest nucleotide identity (88.8%) with cotton leaf curl Multan virus (CLCuMuV) genome, which is lower than the criteria (91%) set for species demarcation in the genus Begomovirus. No begomoviral DNA-B was detected; however, a begomovirus-associated DNA betasatellite (DNA-ß) was detected. The DNA-ß (1,355 nucleotides) shares the highest nucleotide identity (78.6%) with malvastrum yellow vein betasatellite (MaYVB). Because the identity is slightly higher than the criteria (78%) set for the species demarcation threshold for a distinct DNA-ß species, the DNA-ß of HYVLCV reported in this study is considered the same species of MaYVB and tentatively named MaYVB-Hib. An expected 1,498-bp fragment was amplified with two HYVLCV-specific primers from 10 of 11 field-collected samples. Four independent amplicons were sequenced, revealing 100% nucleotide identity with the HYVLCV genome. Agroinoculation of a dimer of the infectious monopartite genome alone to Nicotiana benthamiana resulted in mild symptoms at 28 days postinoculation (dpi); coagroinoculation with the DNA-ß satellite resulted in severe symptoms at 12 dpi. HYVLCV could be transmitted to healthy H. rosa-sinensis by grafting, resulting in yellow vein symptoms at 30 dpi.

A Negative-Stranded RNA Virus Infecting Citrus Trees: The Second Member of a New Genus Within the Order Bunyavirales.

A new RNA virus has been identified from a sweet orange tree in southern Italy. This virus, tentatively named citrus virus A (CiVA), has a bipartite genome composed of (i) a negative-stranded (ns) RNA1, encoding the viral RNA-dependent RNA polymerase (RdRp), and (ii) an ambisense RNA2, coding for the putative movement protein (MP) and nucleocapsid protein (NP), with the two open reading frames separated by a long AU-rich intergenic region (IR) adopting a hairpin conformation. CiVA genomic RNAs and the encoded proteins resemble those of the recently discovered citrus concave gum-associated virus (CCGaV). This CCGaV, a nsRNA virus associated with the ancient citrus concave gum disease, has been proposed as the representative member of a new genus tentatively named Coguvirus. Molecular and phylogenetic analyses presented here support the classification of CiVA, and likely of other two recently described nsRNA viruses infecting plants, in this new genus. By showing that the evolutionary origin of the MP of all the putative coguviruses likely differs from that of their respective RdRp and NP, this study also provides evidence of a likely modular genome evolution for these viruses. Moreover, phylogenetic data support the proposal that, during the evolutionary history of nsRNA viruses, the plant-infecting viruses most likely emerged from an invertebrate-infecting ancestor several times as independent events. CiVA was identified in a field sweet orange tree not showing any obvious symptom and was graft-transmitted to sweet orange, grapefruit, rough lemon and Dweet tangor indicator plants that did not developed symptoms. The capacity of infecting citrus hosts of several species was also confirmed by a preliminary survey that identified orange, mandarin, clementine and lemon trees as natural hosts of CiVA in several fields of southern Italy, again without any obvious association with specific symptoms.

High-Throughput Sequencing and the Viromic Study of Grapevine Leaves: From the Detection of Grapevine-Infecting Viruses to the Description of a New Environmental Tymovirales Member.

In the past decade, high-throughput sequencing (HTS) has had a major impact on virus diversity studies as well as on diagnosis, providing an unbiased and more comprehensive view of the virome of a wide range of organisms. Rather than the serological and molecular-based methods, with their more "reductionist" view focusing on one or a few known agents, HTS-based approaches are able to give a "holistic snapshot" of the complex phytobiome of a sample of interest. In grapevine for example, HTS is powerful enough to allow for the assembly of complete genomes of the various viral species or variants infecting a sample of known or novel virus species. In the present study, a total RNAseq-based approach was used to determine the full genome sequences of various grapevine fanleaf virus (GFLV) isolates and to analyze the eventual presence of other viral agents. From four RNAseq datasets, a few complete grapevine-infecting virus and viroid genomes were de-novo assembled: (a) three GFLV genomes, 11 grapevine rupestris stem-pitting associated virus (GRSPaV) and six viroids. In addition, a novel viral genome was detected in all four datasets, consisting of a single-stranded, positive-sense RNA molecule of 6033 nucleotides. This genome displays an organization similar to Tymoviridae family members in the Tymovirales order. Nonetheless, the new virus shows enough differences to be considered as a new species defining a new genus. Detection of this new agent in the original grapevines proved very erratic and was only consistent at the end of the growing season. This virus was never detected in the spring period, raising the possibility that it might not be a grapevine-infecting virus, but rather a virus infecting a grapevine-associated organism that may be transiently present on grapevine samples at some periods of the year. Indeed, the Tymoviridae family comprises isometric viruses infecting a wide range of hosts in different kingdoms (Plantae, Fungi, and Animalia). The present work highlights the fact that even though HTS technologies produce invaluable data for the description of the sanitary status of a plant, in-depth biological studies are necessary before assigning a new virus to a particular host in such metagenomic approaches.

Emerging infections-an increasingly important topic: review by the Emerging Infections Task Force.

OBJECTIVES: This paper review trends in emerging infections and the need for increased clinical and laboratory surveillance. METHODS: Factors that contributed to the emergence of recent outbreaks have been reviewed. Known, major outbreaks over the past two decades were reviewed. RESULTS: We identified at least four major drivers of emergent infections: (i) increasing density of the human population; (ii) stress from farmland expansion on the environment; (iii) globalization of the food market and manufacturing; (iv) environmental contamination. The factors creating new opportunities for emerging infections include: (i) population growth; (ii) spread in health care facilities; (iii) an ageing population; (iv) international travel; (v) changing and expanding vector habitats. CONCLUSIONS: Emerging infections are unpredictable. In this review we argue that to discover new trends in infectious diseases, the clinicians have to look for the unusual and unexpected and ensure proper diagnostics and that syndromic surveillance must be supported by highly specialized laboratory services. Mathematical modeling has not been able to predict outbreaks More emphasis on the biology of evolution is needed. EID rarely stands out as unusual, and the continuous pressure on health care budgets forces clinicians and laboratories to prioritize their diagnostic work-up to common and treatable conditions. The European Society for Infectious Diseases and Clinical Microbiology, ESCMID, has established an Emerging Infections Task Force, EITaF, to strengthen the activities of the society on emerging infections and ensure that emerging infections is included in differential diagnostic considerations in everyday clinical practice.