PmHs1pro-1 monitors Bsursaphelenchus xylophilus infection and activates defensive response in resistant Pinus massoniana.

Plant resistance (R) genes play a crucial role in the detection of effector proteins secreted by pathogens, either directly or indirectly, as well as in the subsequent activation of downstream defence mechanisms. However, little is known about how R genes regulate the defence responses of conifers, particularly Pinus massoniana, against the destructive pine wood nematode (PWN; Bursaphelenchus xylophilus). Here, we isolated and characterised PmHs1pro-1, a nematode-resistance gene of P. massoniana, using bioinformatics, molecular biology, histochemistry and transgenesis. Tissue-specific expressional pattern and localisation of PmHs1pro-1 suggested that it was a crucial positive regulator in response to PWN attack in resistant P. massoniana. Meanwhile, overexpression of PmHs1pro-1 was found to activate reactive oxygen species (ROS) metabolism-related enzymes and the expressional level of their key genes, including superoxide dismutase, peroxidase and catalase. In addition, we showed that PmHs1pro-1 directly recognised the effector protein BxSCD1of PWN, and induced the ROS burst responding to PWN invasion in resistant P. massoniana. Our findings illustrated the molecular framework of R genes directly recognising the effector protein of pathology in pine, which offered a novel insight into the plant-pathogen arms race.

Low microbial diversity, yeast prevalence, and nematode-trapping fungal presence in fungal colonization and leaf microbiome of Serjania erecta.

Medicinal plant microbiomes undergo selection due to secondary metabolite presence. Resident endophytic/epiphytic microorganisms directly influence plant's bioactive compound synthesis. Hypothesizing low microbial diversity in Serjania erecta leaves, we assessed leaf colonization by epiphytic and endophytic fungi. Given its traditional medicinal importance, we estimated diversity in the endophytic fungal microbiome. Analyses included scanning electron microscopy (SEM), isolation of cultivable species, and metagenomics. Epiphytic fungi interacted with S. erecta leaf tissues, horizontally transmitted via stomata/trichome bases, expressing traits for nematode trapping. Cultivable endophytic fungi, known for phytopathogenic habits, didn't induce dysbiosis symptoms. This study confirms low leaf microbiome diversity in S. erecta, with a tendency towards more fungal species, likely due to antibacterial secondary metabolite selection. The classification of Halicephalobus sp. sequence corroborated the presence of nematode eggs on the epidermal surface of S. erecta by SEM. In addition, we confirmed the presence of methanogenic archaea and a considerable number of methanotrophs of the genus Methylobacterium. The metagenomic study of endophytic fungi highlighted plant growth-promoting yeasts, mainly Malassezia, Leucosporidium, Meyerozyma, and Hannaella. Studying endophytic fungi and S. erecta microbiomes can elucidate their impact on beneficial bioactive compound production, on the other hand, it is possible that the bioactive compounds produced by this plant can recruit specific microorganisms, impacting the biological system.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Current status and future trends of microbial and nematode-based biopesticides for biocontrol of crop pathogens.

The increasing public demand to avoid the use of synthetic pesticides and fertilizers in agricultural production systems, causing serious environmental damages, has challenged industry to develop new and effective solutions to manage and control phytopathogens. Biopesticides, particularly microbial-based biopesticides, are a promising new alternative with high biodegradability, specificity, suitability for incorporation into integrated pest management practices, low likelihood of resistance development, and practically no known human health risks. However: expensive production methods, narrow action spectra, susceptibility to environmental conditions, short shelf life, poor storage stability, legislation registry constraints, and general lack of knowledge are slowing down their adoption. In addition to regulatory framework revisions and improved training initiatives, improved preservation methods, thoughtfully designed formulations, and field test validations are needed to offer new microbial- and nematode-based biopesticides with improved efficacy and increased shelf-life. During the last several years, substantial advancements in biopesticide production have been developed. The novelty part of this review written in 2023 is to summarize (i) mechanisms of action of beneficial microorganisms used to increase crop performance and (ii) successful formulation including commercial products for the biological control of phytopathogens based on microorganisms, nematode and/or metabolites.

Inconsistency of in vitro exsheathment triggers for gastrointestinal nematode parasites of sheep, cattle and deer.

Exsheathment is crucial in the transition from free-living to parasitic phase for most strongyle nematode species. A greater understanding of this process could help in developing new parasitic control methods. This study aimed to identify commonalities in response to exsheathment triggers (heat acclimation, CO2 and pH) in a wide range of species (Haemonchus contortus, Trichostrongylus spp., Cooperia spp., Oesophagostomum spp., Chabertia ovina, and members of the subfamily Ostertagiinae) from sheep, cattle and farmed deer. The initial expectation of similarity in pH requirements amongst species residing within the same organ was not supported, with unexpected pH preferences for exsheathment of Trichostrongylus axei, Trichostrongylus vitrinus, Trichostrongylus colubriformis and Cooperia oncophora. We also found differences between species in their response to temperature acclimation, with higher exsheathment in response to heat shock observed for H. contortus, Ostertagia ostertagi, T. axei, T. vitrinus and Oesophagostomum sikae. Furthermore, some species showed poor exsheathment under all experimental conditions, such as Cooperia curticei and the large intestinal nematodes C. ovina and Oesophagostomum venulosum. Interestingly, there were some significant differences in response depending on the host from which the parasites were derived. The host species significantly impacted on the exsheathment response for H. contortus, Teladorsagia circumcincta, T. vitrinus and T. colubriformis. Overall, the data showed variability between nematode species in their response to these in vitro exsheathment triggers, highlighting the complexity of finding a common set of conditions for all species in order to develop a control method based on triggering the exsheathment process prematurely.

Counting nematodes made easy: leveraging AI-powered automation for enhanced efficiency and precision.

Counting nematodes is a labor-intensive and time-consuming task, yet it is a pivotal step in various quantitative nematological studies; preparation of initial population densities and final population densities in pot, micro-plot and field trials for different objectives related to management including sampling and location of nematode infestation foci. Nematologists have long battled with the complexities of nematode counting, leading to several research initiatives aimed at automating this process. However, these research endeavors have primarily focused on identifying single-class objects within individual images. To enhance the practicality of this technology, there's a pressing need for an algorithm that cannot only detect but also classify multiple classes of objects concurrently. This study endeavors to tackle this challenge by developing a user-friendly Graphical User Interface (GUI) that comprises multiple deep learning algorithms, allowing simultaneous recognition and categorization of nematode eggs and second stage juveniles of Meloidogyne spp. In total of 650 images for eggs and 1339 images for juveniles were generated using two distinct imaging systems, resulting in 8655 eggs and 4742 Meloidogyne juveniles annotated using bounding box and segmentation, respectively. The deep-learning models were developed by leveraging the Convolutional Neural Networks (CNNs) machine learning architecture known as YOLOv8x. Our results showed that the models correctly identified eggs as eggs and Meloidogyne juveniles as Meloidogyne juveniles in 94% and 93% of instances, respectively. The model demonstrated higher than 0.70 coefficient correlation between model predictions and observations on unseen images. Our study has showcased the potential utility of these models in practical applications for the future. The GUI is made freely available to the public through the author's GitHub repository (https://github.com/bresilla/nematode_counting). While this study currently focuses on one genus, there are plans to expand the GUI's capabilities to include other economically significant genera of plant parasitic nematodes. Achieving these objectives, including enhancing the models' accuracy on different imaging systems, may necessitate collaboration among multiple nematology teams and laboratories, rather than being the work of a single entity. With the increasing interest among nematologists in harnessing machine learning, the authors are confident in the potential development of a universal automated nematode counting system accessible to all. This paper aims to serve as a framework and catalyst for initiating global collaboration toward this important goal.

Biocontrol potential of endophytic fungi against phytopathogenic nematodes on potato (Solanum tuberosum L.).

Root-knot nematodes (RKNs) are a vital pest that causes significant yield losses and economic damage to potato plants. The use of chemical pesticides to control these nematodes has led to environmental concerns and the development of resistance in the nematode populations. Endophytic fungi offer an eco-friendly alternative to control these pests and produce secondary metabolites that have nematicidal activity against RKNs. The objective of this study is to assess the efficacy of Aspergillus flavus (ON146363), an entophyte fungus isolated from Trigonella foenum-graecum seeds, against Meloidogyne incognita in filtered culture broth using GC-MS analysis. Among them, various nematicidal secondary metabolites were produced: Gadoleic acid, Oleic acid di-ethanolamide, Oleic acid, and Palmitic acid. In addition, biochemical compounds such as Gallic acid, Catechin, Protocatechuic acid, Esculatin, Vanillic acid, Pyrocatechol, Coumarine, Cinnamic acid, 4, 3-indol butyl acetic acid and Naphthyl acetic acid by HPLC. The fungus was identified through morphological and molecular analysis, including ITS 1-4 regions of ribosomal DNA. In vitro experiments showed that culture filtrate of A. flavus had a variable effect on reducing the number of egg hatchings and larval mortality, with higher concentrations showing greater efficacy than Abamectin. The fungus inhibited the development and multiplication of M. incognita in potato plants, reducing the number of galls and eggs by 90% and 89%, respectively. A. flavus increased the activity of defense-related enzymes Chitinas, Catalyse, and Peroxidase after 15, 45, and 60 days. Leaching of the concentrated culture significantly reduced the second juveniles' stage to 97% /250 g soil and decreased the penetration of nematodes into the roots. A. flavus cultural filtrates via soil spraying improved seedling growth and reduced nematode propagation, resulting in systemic resistance to nematode infection. Therefore, A. flavus can be an effective biological control agent for root-knot nematodes in potato plants. This approach provides a sustainable solution for farmers and minimizes the environmental impact.

Surveillance of Ancylostoma caninum in naturally infected dogs in Quebec, Canada, and assessment of benzimidazole anthelmintics reveal a variable efficacy with the presence of a resistant isolate in imported dogs.

Ancylostoma caninum is a widely prevalent parasitic nematode in dogs across the world. There has been a notable increase in reports of anthelmintic resistance in A. caninum within the United States of America in recent years, which has led us to investigate the potential of this scenario in Canada. The study objectives were to assess the prevalence of A. caninum in two different groups, including a colony of rescued dogs in Canada and three imported Greyhound dogs from USA, and to evaluate the efficacy of two benzimidazole (BZ) anthelmintics against A. caninum, complemented with a molecular genetic analysis adapted to low prevalence. Fecal samples were collected at pre- and post-treatment with fenbendazole for the native shelters-origin group, and a combination of anthelmintic formulations, including the pro-BZ febantel for the USA-origin group. The coprology analyses found several genera of internal parasites. Canine ancylostomiasis was the most prevalent parasitosis with 30.77% in the native group and 100% in the USA group, but with overall low average of A. caninum eggs per gram. Through the fecal egg count reduction test (FECRT), applying a cut-off at 90% as baseline of egg reduction for successful efficacy, BZ showed variable efficacy. Furthermore, molecular analysis confirmed the presence of A. caninum in both groups of dogs and found differences in the genetics linked to BZ resistance on the A. caninum ß-tubulin isotype 1 gene. In the isolate from the native group, both codons 167 and 200 were homozygous without the presence of single nucleotide polymorphism (SNP). In contrast, the selected isolate from the USA group, showed a homozygous allele at position 200 and a heterozygous SNP at position 167. The latter was congruent with the low efficacy in FECRT and agrees with the recent findings of USA A. caninum isolate resistant phenotype to the BZ anthelmintics. The limitations of the study include an overall low eggs-per-gram in both canine groups, and the shortage of additional fecal samples from the USA group, restraining the molecular analysis only to one out of the three Greyhounds. This study provided some insights on the efficacy of BZs against A. caninum and revealed the presence of BZ resistant isolates in imported dogs in Quebec, Canada. All this information should be considered, for choosing the best strategy in the control of A. caninum using anthelmintic drugs.

Technologies to Study Genetics and Molecular Pathways.

Over the last few decades, the study of congenital heart disease (CHD) has benefited from various model systems and the development of molecular biological techniques enabling the analysis of single gene as well as global effects. In this chapter, we first describe different models including CHD patients and their families, animal models ranging from invertebrates to mammals, and various cell culture systems. Moreover, techniques to experimentally manipulate these models are discussed. Second, we introduce cardiac phenotyping technologies comprising the analysis of mouse and cell culture models, live imaging of cardiogenesis, and histological methods for fixed hearts. Finally, the most important and latest molecular biotechniques are described. These include genotyping technologies, different applications of next-generation sequencing, and the analysis of transcriptome, epigenome, proteome, and metabolome. In summary, the models and technologies presented in this chapter are essential to study the function and development of the heart and to understand the molecular pathways underlying CHD.

Soil enzyme profile analysis for indicating decomposer micro-food web.

Highly diverse exoenzymes mediate the energy flow from substrates to the multitrophic microbiota within the soil decomposer micro-food web. Here, we used a "soil enzyme profile analysis" approach to establish a series of enzyme profile indices; those indices were hypothesized to reflect micro-food web features. We systematically evaluated the shifts in enzyme profile indices in relation to the micro-food web features in the restoration of an abandoned cropland to a natural area. We found that enzymatic C:N stoichiometry and decomposability index were significantly associated with substrate availability. Furthermore, the higher Shannon diversity index in the exoenzyme profile, especially for the C-degrading hydrolase, corresponded to a greater microbiota community diversity. The increased complexity and stability of the exoenzyme network reflected similar changes with the micro-food web networks. In addition, the gross activity of the enzyme profile as a parameter for soil multifunctionality, effectively predicted the substrate content, microbiota community size, diversity, and network complexity. Ultimately, the proposed enzymic channel index was closely associated with the traditional decomposition channel indices derived from microorganisms and nematodes. Our results showed that soil enzyme profile analysis reflected very well the decomposer food web features. Our study has important implications for projecting future climate change or anthropogenic disturbance impacts on soil decomposer micro-food web features by using soil enzyme profile analysis.

Molecular detection of Setaria tundra (Issaitshikoff & Rajewskaya, 1928) and Setaria cervi (Rudolphi, 1819) in red deer in Slovakia.

Filaroid nematodes Setaria tundra (Issaitshikoff & Rajewskaya, 1928) and Setaria cervi (Rudolphi, 1819) are internal parasites from family Onchocercidae with occurrence in the northern hemisphere. They have a considerably wide range of final host, including many species of family Cervidae. Intermediate hosts and vectors at the same time, are represented by the several mosquito species, mostly of genus Aedes. Infection of Setaria is relatively harmless and especially in wild cervids usually pass unnoticed. Although in some cases it can induce peritonitis which might be a life threatening condition.This study was determined to reveal the presence of helminths Setaria tundra and Setaria cervi in red deer (Cervus elaphus) in Slovakia. The parasites were identified morphologically and genetically, based on the sequences of a fragment of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. For this purpose we used partial results of our longer parasitological monitoring realized in one particular hunting area located in eastern Slovakia, near the city of Kosice. A total of 60 red deer individuals were tested, of which one was found to be infected with Setaria tundra (prevalence of 1.7%) and four were detected to be infected with Setaria cervi (prevalence 6.7%). The intensity of infection was very low, only one specimen of Setaria spp. in each positive animal.

Nematode-resistance loci in Upland cotton genomes are associated with structural differences.

Reniform and root-knot nematode are two of the most destructive pests of conventional upland cotton, Gossypium hirsutum, L. and continue to be a major threat to cotton fiber production in semi-arid regions of the southern United States and Central America. Fortunately, naturally occurring tolerance to these nematodes has been identified in the Pima cotton species (G. barbadense) and several upland cotton varieties (G. hirsutum), which has led to a robust breeding program that has successfully introgressed and stacked these independent resistant traits into several upland cotton lineages with superior agronomic traits, e.g. BAR 32-30 and BARBREN-713. This work identifies the genomic variations of these nematode tolerant accessions by comparing their respective genomes to the susceptible, high-quality fiber producing parental line of this lineage: Phytogen 355 (PSC355). We discover several large genomic differences within marker regions that harbor putative resistance genes as well as expression mechanisms shared by the two resistant lines, with respect to the susceptible PSC355 parental line. This work emphasizes the utility of whole genome comparisons as a means of elucidating large and small nuclear differences by lineage and phenotype.  .

A Quantitative Trait Locus with a Major Effect on Root-Lesion Nematode Resistance in Barley.

Although the root-lesion nematode Pratylenchus thornei is known to affect barley (Hordeum vulgare L.), there have been no reports on the genetic control of P. thornei resistance in barley. In this research, P. thornei resistance was assessed for a panel of 46 barley mapping parents and for two mapping populations (Arapiles/Franklin and Denar/Baudin). With both populations, a highly significant quantitative trait locus (QTL) was mapped at the same position on the long arm of chromosome 7H. Single-nucleotide polymorphisms (SNPs) in this region were anchored to an RGT Planet pan-genome assembly and assayed on the mapping parents and other barley varieties. The results indicate that Arapiles, Denar, RGT Planet and several other varieties likely have the same resistance gene on chromosome 7H. Marker assays reported here could be used to select for P. thornei resistance in barley breeding. Analysis of existing barley pan-genomic and pan-transcriptomic data provided a list of candidate genes along with information on the expression and differential expression of some of those genes in barley root tissue. Further research is required to identify a specific barley gene that affects root-lesion nematode resistance.

Introduction to Strongyloides stercoralis Anatomy.

Strongyloides stercoralis, commonly known as the human threadworm, is a skin-penetrating gastrointestinal parasitic nematode that infects hundreds of millions of people worldwide. Like other Strongyloides species, S. stercoralis is capable of cycling through a single free-living generation. Although S. stercoralis and the free-living nematode Caenorhabditis elegans are evolutionarily distant, the free-living adults of S. stercoralis are similar enough in size and morphology to C. elegans adults that techniques for generating transgenics and knockouts in C. elegans have been successfully adapted for use in S. stercoralis. High-quality genomic and transcriptomic data are also available for S. stercoralis. Thus, one can use a burgeoning array of functional genomic tools in S. stercoralis to probe questions about parasitic nematode development, physiology, and behavior. Knowledge gained from S. stercoralis will inform studies of other parasitic nematodes such as hookworms that are not yet amenable to genetic manipulation. This review describes the basic anatomy of S. stercoralis.

Transgenerational Response of Germline Nuclear Hormone Receptor Genes to Nanoplastics at Predicted Environmental Doses in Caenorhabditis elegans.

Transgenerational nanoplastic toxicity could be detected in Caenorhabditis elegans after exposure at the parental generation (P0-G); however, the underlying mechanisms remain largely unclear. We aimed to examine the role of germline nuclear hormone receptors (NHRs) in controlling the transgenerational toxicity of polystyrene nanoparticles (PS-NPs) based on gene expression screening and functional analysis. Among germline NHR genes, daf-12, nhr-14, and nhr-47 expressions were increased and nhr-12 expression was decreased by PS-NPs (1 and 10 µg/L). Transgenerational alterations in expressions of these four NHR genes were also induced by PS-NPs (1 and 10 µg/L). RNAi of daf-12, nhr-14, and nhr-47 caused resistance, whereas RNAi of nhr-12 conferred susceptibility to transgenerational PS-NP toxicity. After PS-NP exposure, expressions of ins-3, daf-28, and ins-39 encoding insulin ligands, efn-3 encoding Ephrin ligand, and lin-44 encoding Wnt ligand, as well as expressions of their receptor genes (daf-2, vab-1, and/or mig-1), were dysregulated by the RNAi of daf-12, nhr-14, nhr-47, and nhr-12. Therefore, alteration in certain germline NHRs could mediate the induction of transgenerational nanoplastic toxicity by affecting secreted ligands and their receptors in the offspring of exposed organisms.

Characterization of the Hepatic Transcriptome for Divergent Immune-Responding Sheep Following Natural Exposure to Gastrointestinal Nematodes.

Infections with gastrointestinal nematodes (GINs) reduce the economic efficiency of sheep operations and compromise animal welfare. Understanding the host's response to GIN infection can help producers identify animals that are naturally resistant to infection. The objective of this study was to characterize the hepatic transcriptome of sheep that had been naturally exposed to GIN parasites. The hepatic transcriptome was studied using RNA-Sequencing technology in animals characterized as high (n = 5) or medium (n = 6) based on their innate immune acute-phase (AP) response phenotype compared with uninfected controls (n = 4), and with biased antibody-mediated (AbMR, n = 5) or cell-mediated (CMR, n = 5) adaptive immune responsiveness compared to uninfected controls (n = 3). Following the assessment of sheep selected for innate responses, 0, 136, and 167 genes were differentially expressed (DE) between high- and medium-responding animals, high-responding and uninfected control animals, and medium-responding and uninfected control animals, respectively (false discovery rate (FDR) < 0.05, and fold change |FC| > 2). When adaptive immune responses were assessed, 0, 53, and 57 genes were DE between antibody- and cell-biased animals, antibody-biased and uninfected control animals, and cell-biased and uninfected control animals, respectively (FDR < 0.05, |FC| > 2). Functional analyses identified enriched gene ontology (GO) terms and metabolic pathways related to the innate immune response and energy metabolism. Six functional candidate genes were identified for further functional and validation studies to better understand the underlying biological mechanisms of host responses to GINs. These, in turn, can potentially help improve decision making and management practices to increase the overall host immune response to GIN infection.

Upgrading Strategies for Managing Nematode Pests on Profitable Crops.

Plant-parasitic nematodes (PPNs) reduce the high profitability of many crops and degrade their quantitative and qualitative yields globally. Traditional nematicides and other nematode control methods are being used against PPNs. However, stakeholders are searching for more sustainable and effective alternatives with limited side effects on the environment and mankind to face increased food demand, unfavorable climate change, and using unhealthy nematicides. This review focuses on upgrading the pre-procedures of PPN control as well as novel measures for their effective and durable management strategies on economically important crops. Sound and effective sampling, extraction, identification, and counting methods of PPNs and their related microorganisms, in addition to perfecting designation of nematode-host susceptibility/resistance, form the bases for these strategies. Therefore, their related frontiers should be expanded to synthesize innovative integrated solutions for these strategies. The latter involve supplanting unsafe nematicides with a new generation of safe and reliable chemical nematicidal and bionematicidal alternatives. For better efficacy, nematicidal materials and techniques should be further developed via computer-aided nematicide design. Bioinformatics devices can reinforce the potential of safe and effective biocontrol agents (BCAs) and their active components. They can delineate the interactions of bionematicides with their targeted PPN species and tackle complex diseases. Also, the functional plan of nematicides based on a blueprint of the intended goals should be further explored. Such goals can currently engage succinate dehydrogenase, acetylcholinesterase, and chitin deacetylase. Nonetheless, other biochemical compounds as novel targets for nematicides should be earnestly sought. Commonly used nematicides should be further tested for synergistic or additive function and be optimized via novel sequential, dual-purpose, and co-application of agricultural inputs, especially in integrated pest management schemes. Future directions and research priorities should address this novelty. Meanwhile, emerging bioactivated nematicides that offer reliability and nematode selectivity should be advanced for their favorable large-scale synthesis. Recent technological means should intervene to prevail over nematicide-related limitations. Nanoencapsulation can challenge production costs, effectiveness, and manufacturing defects of some nematicides. Recent progress in studying molecular plant-nematode interaction mechanisms can be further exploited for novel PPN control given related topics such as interfering RNA techniques, RNA-Seq in BCA development, and targeted genome editing. A few recent materials/techniques for control of PPNs in durable agroecosystems via decision support tools and decision support systems are addressed. The capability and effectiveness of nematicide operation harmony should be optimized via employing proper cooperative mechanisms among all partners.

In Vitro Lethality of Fenbendazole to the Eyeworm Oxyspirura petrowi.

Oxyspirura petrowi is a heteroxenous nematode that infects the harderian gland and other ocular tissues in birds. High-intensity infections often cause damage to the infected tissues. Due to the nature of the infection sites, treatment of O. petrowi in these hosts can be difficult. Fenbendazole (FBZ) is a common anthelmintic used to treat birds for helminth infections; however, little information exists as to the efficacy of the drug on O. petrowi infections. The present study aims to estimate lethal concentrations of FBZ to O. petrowi. Adult O. petrowi were maintained in vitro and exposed to doses of 5, 50, 100, and 200 µM concentrations of FBZ and included both negative and vehicle controls. Exposure lasted 7.5 days and lethality was determined for each treatment. Negative and vehicle controls did not differ, and both had 75% survival at the end of the treatment period. The percentage survivorship in ascending order of concentration, corrected for the controls, was 66.67%, 44.44%, 33.33%, and 0%. LC10, LC50, and LC90 estimates were 7.5 ± 0.26, 49.1 ± 1.69, and 163.2 ± 5.63 µM, respectively. In the context of known pharmacokinetics of FBZ in birds, a single oral dose of FBZ can achieve exposure levels that are lethal to O. petrowi, but the drug does not stay in the system long enough. Thus, treatment of O. petrowi infections will require multiple oral doses over several days.

Unraveling the enigma of root-knot nematodes: from origins to advanced management strategies in agriculture.

MAIN CONCLUSION: Integrated management strategies, including novel nematicides and resilient cultivars, offer sustainable solutions to combat root-knot nematodes, crucial for safeguarding global agriculture against persistent threats. Root-knot nematodes (RKN) pose a significant threat to a diverse range of host plants, with their obligatory endoparasitic nature leading to substantial agricultural losses. RKN spend much of their lives inside or in contact by secreting plant cell wall-modifying enzymes resulting in the giant cell development for establishing host-parasite relationships. Additionally, inflicting physical harm to host plants, RKN also contributes to disease complexes creation with fungi and bacteria. This review comprehensively explores the origin, history, distribution, and physiological races of RKN, emphasizing their economic impact on plants through gall formation. Management strategies, ranging from cultural and physical to biological and chemical controls, along with resistance mechanisms and marker-assisted selection, are explored. While recognizing the limitations of traditional nematicides, recent breakthroughs in non-fumigant alternatives like fluensulfone, spirotetramat, and fluopyram offer promising avenues for sustainable RKN management. Despite the success of resistance mechanisms like the Mi gene, challenges persist, prompting the need for integrative approaches to tackle Mi-virulent isolates. In conclusion, the review stresses the importance of innovative and resilient control measures for sustainable agriculture, emphasizing ongoing research to address evolving challenges posed by RKN. The integration of botanicals, resistant cultivars, and biological controls, alongside advancements in non-fumigant nematicides, contributes novel insights to the field, laying the ground work for future research directions to ensure the long-term sustainability of agriculture in the face of persistent RKN threats.

Microscopic and molecular epidemiology of gastrointestinal nematodes in dairy and beef cattle in Pak Chong district, Nakhon Ratchasima province, Thailand.

Background and Aim: Gastrointestinal (GI) nematode infection remains an important problem in livestock, particularly cattle. The infection may lead to serious health complications and affect animal products. The objective of this study was to investigate GI nematode infection and its associated risk factors in dairy and beef cattle farmed in Pak Chong District of Nakhon Ratchasima Province, northeast Thailand. Materials and Methods: Fecal specimens were collected from 101 dairy cattle and 100 beef cattle. Formalin-ethyl acetate concentration techniques were used to process the samples and the samples were observed under a light microscope. Samples were subjected to molecular identification of specific genera using conventional polymerase chain reaction and DNA sequencing. Results: The overall prevalence of GI nematode infection was 33.3%. The strongyle nematode was the most significant GI nematode in this area with a prevalence of 28.4%. The prevalence of strongyle nematodes was 58.0% in beef cattle and only 7.9% in dairy cattle. Trichuris spp. was another nematode found in both types of cattle with an overall prevalence of 5.0% with 9.0% in beef cattle and 1.0% in dairy cattle. The results of the epidemiological study indicate that the age of cattle, food, water sources, farming system, and housing floor are the most important risk factors. Among the strongyle nematodes, Ostertagia spp. was the most prevalent (82.0%), followed by Haemonchus spp. (62.3%) and Trichostrongylus spp. (8.2%), respectively. Conclusion: Infection with GI nematodes still exists in this area, particularly in beef cattle. Our reported data may benefit local parasitic control policies in the future.