ABSTRACT
In the dynamic landscape of biomedical science, the pursuit of effective treatments for motor neuron disorders like hereditary spastic paraplegia (HSP), amyotrophic lateral sclerosis (ALS), and spinal muscular atrophy (SMA) remains a key priority. Central to this endeavor is the development of robust animal models, with the zebrafish emerging as a prime candidate. Exhibiting embryonic transparency, a swift life cycle, and significant genetic and neuroanatomical congruencies with humans, zebrafish offer substantial potential for research. Despite the difference in locomotion-zebrafish undulate while humans use limbs, the zebrafish presents relevant phenotypic parallels to human motor control disorders, providing valuable insights into neurodegenerative diseases. This review explores the zebrafish's inherent traits and how they facilitate profound insights into the complex behavioral and cellular phenotypes associated with these disorders. Furthermore, we examine recent advancements in high-throughput drug screening using the zebrafish model, a promising avenue for identifying therapeutically potent compounds.
ABSTRACT
INTRODUCTION: Spinal Epidural Lipomatosis (SEL) is a rare disorder of pathological overgrowth of the spinal epidural fat in the extradural space. The pathogenesis of SEL usually involves exogenous steroid use or endogenous steroids overproduction. However, idiopathic cases have been reported. Magnetic resonance imaging (MRI) is the gold standard for diagnosis. Both conservative and surgical approaches are employed in management of these patients. CASE PRESENTATION: A 17-year-old male presented to our hospital complaining of progressive lower limb weakness, loss of sensation with urinary incontinence which ended up with paraplegia. He underwent extensive investigations and received multiple inaccurate diagnoses. MRI of the thoracic spine showed spinal epidural lipomatosis with dorsal kyphosis. Hemi-laminectomy for spinal cord decompression and trans-pedicular fixation for correction of kyphosis were performed showing excellent outcomes. CLINICAL DISCUSSION: Diagnosing SEL can be challenging due to its symptom overlap with other neurological conditions. Thus, higher levels of clinical suspicions and utilization of numerous diagnostic modalities including MRI are required. Treatment is largely determined by the clinical presentation and the severity of symptoms. Given the severity of neurological symptoms in our case, surgical intervention was performed resulting in fully regained functionality of previously paralyzed muscles. CONCLUSION: This case highlights the rare presentation and the diagnostic challenges of spinal epidural lipomatosis SEL in a young patient who was misdiagnosed for 9 consecutive months before receiving the correct diagnosis, emphasizing the importance of considering SEL in the differential diagnosis for progressive neurological deficits and the importance of MRI, especially in atypical cases.
ABSTRACT
BACKGROUND: To assess the safety of high-moderate (24.1-28.0°C) and low-moderate (20.1-24.0°C) systemic hypothermia (MHCA) during circulatory arrest in patients with acute DeBakey I aortic dissection (DeBakey I AAD), particularly concerning spinal cord protection. METHODS: Between 2009 and 2020, 1759 patients with DeBakey I AAD who underwent frozen elephant trunk and total arch replacement surgery at a tertiary center were divided into preoperative malperfusion (viscera, spinal cord, or lower extremities) and non-malperfusion subgroups. The baseline differences were balanced using propensity score matching. Prognoses were compared between those who were subjected to high-MHCA (nasopharyngeal temperature, 24.1-28.0°C) and low-MHCA (20.1-24.0°C). RESULTS: In the non-malperfusion subgroup (n=1389), 469 pairs of matched patients showed lower in-hospital mortality and incidence of acute kidney injury in the high-MHCA group than in the low-MHCA group (in-hospital mortality, 7.0% vs. 10.2%, P=0.01; acute kidney injury, 57.1% vs. 64.6%, P<0.01). The duration of mechanical ventilation was shorter in the high-MHCA group than that in the low-MHCA group (P=0.03). No significant difference in the incidence of paraplegia was observed between the two groups. In the malperfusion subgroup (n=370), 112 pairs of matched patients showed a higher incidence of paraplegia in the high-MHCA group than in the low-MHCA group (15.9% vs. 6.5%, P=0.04). CONCLUSIONS: The safety of high-MHCA, a commonly used temperature management strategy during aortic arch surgery, was recognized in most patients with DeBakey I AAD. However, among patients with preoperative distal organ malperfusion, low-MHCA may be more appropriate because of an increased risk of postoperative paraplegia associated with high-MHCA.
ABSTRACT
BACKGROUND AND PURPOSE: Hereditary spastic paraplegias (HSPs) comprise a group of inherited neurodegenerative disorders characterized by progressive spasticity and weakness. Botulinum toxin has been approved for lower limb spasticity following stroke and cerebral palsy, but its effects in HSPs remain underexplored. We aimed to characterize the effects of botulinum toxin on clinical, gait, and patient-reported outcomes in HSP patients and explore the potential of mobile digital gait analysis to monitor treatment effects and predict treatment response. METHODS: We conducted a prospective, observational, multicenter study involving ambulatory HSP patients treated with botulinum toxin tailored to individual goals. Comparing data at baseline, after 1 month, and after 3 months, treatment response was assessed using clinical parameters, goal attainment scaling, and mobile digital gait analysis. Machine learning algorithms were used for predicting individual goal attainment based on baseline parameters. RESULTS: A total of 56 patients were enrolled. Despite the heterogeneity of treatment goals and targeted muscles, botulinum toxin led to a significant improvement in specific clinical parameters and an improvement in specific gait characteristics, peaking at the 1-month and declining by the 3-month follow-up. Significant correlations were identified between gait parameters and clinical scores. With a mean balanced accuracy of 66%, machine learning algorithms identified important denominators to predict treatment response. CONCLUSIONS: Our study provides evidence supporting the beneficial effects of botulinum toxin in HSP when applied according to individual treatment goals. The use of mobile digital gait analysis and machine learning represents a novel approach for monitoring treatment effects and predicting treatment response.
Subject(s)
Gait Analysis , Spastic Paraplegia, Hereditary , Humans , Male , Female , Spastic Paraplegia, Hereditary/drug therapy , Adult , Middle Aged , Gait Analysis/methods , Prospective Studies , Neuromuscular Agents/pharmacology , Neuromuscular Agents/administration & dosage , Neuromuscular Agents/therapeutic use , Treatment Outcome , Botulinum Toxins, Type A/therapeutic use , Botulinum Toxins, Type A/pharmacology , Young Adult , Aged , Botulinum Toxins/therapeutic useABSTRACT
BACKGROUND: Spastic paraplegia 11 (SPG11) is the most prevalent form of autosomal recessive hereditary spastic paraplegia, resulting from biallelic pathogenic variants in the SPG11 gene (MIM *610844). METHODS: The proband is a 36-year-old female referred for genetic evaluation due to cognitive dysfunction, gait impairment, and corpus callosum atrophy (brain MRI was normal at 25-years-old). Diagnostic approaches included CGH array, next-generation sequencing, and whole transcriptome sequencing. RESULTS: CGH array revealed a 180 kb deletion located upstream of SPG11. Sequencing of SPG11 uncovered two rare single nucleotide variants: the novel variant c.3143C>T in exon 17 (in cis with the deletion), and the previously reported pathogenic variant c.6409C>T in exon 34 (in trans). Whole transcriptome sequencing revealed that the variant c.3143C>T caused exon 17 skipping. CONCLUSION: We report a novel sequence variant in the SPG11 gene resulting in exon 17 skipping, which, along with a nonsense variant, causes Spastic Paraplegia 11 in our proband. In addition, a deletion upstream of SPG11 was identified in the patient, whose implication in the phenotype remains uncertain. Nonetheless, the deletion apparently affects cis-regulatory elements of the gene, suggesting a potential new pathogenic mechanism underlying the disease in a subset of undiagnosed patients. Our findings further support the hypothesis that the origin of thin corpus callosum in patients with SPG11 is of progressive nature.
Subject(s)
Spastic Paraplegia, Hereditary , Humans , Female , Adult , Spastic Paraplegia, Hereditary/genetics , Spastic Paraplegia, Hereditary/diagnosis , Spastic Paraplegia, Hereditary/pathology , Exons , Proteins/genetics , Codon, Nonsense , Corpus Callosum/pathology , Corpus Callosum/diagnostic imaging , Sequence Deletion , PhenotypeABSTRACT
Variations in the UBQLN2 gene are associated with a group of diseases with X-linked dominant inheritance and clinical phenotypes of amyotrophic lateral sclerosis (ALS) and/or frontal temporal lobe dementia (FTD). Cases with UBQLN2 variations have been rarely reported worldwide. The reported cases exhibit strong clinical heterogeneity. Here, we report two adult-onset cases with UBQLN2 variations in Han Chinese. Whole exome sequencing revealed the hemizygous P506S (c.1516C > T) and the heterozygous P509S variation (c.1525C > T), both of which were located within the hotspot mutation region. The patient with the P506S variation was a 24-year-old male. The clinical feature was spastic paraplegia without lower motor neuron damage. The patient's mother was an asymptomatic heterozygote carrier with skewed X-chromosome inactivation. The patient with the P509S variation was a 63-year-old female. Clinical features included ALS and parkinsonism. 18F-fluorodopa PET-CT revealed presynaptic dopaminergic deficits in bilateral posterior putamen. These cases further highlight the clinical heterogeneity of UBQLN2 cases.
ABSTRACT
Spastic paraplegia and psychomotor retardation with or without seizures (SPPRS) is a rare neurodevelopmental disorder associated with autosomal recessive mutations in the HACE1 gene. This case report presents the clinical features and genetic analysis of an 11-month-old girl and her sister with SPPRS, making it the third reported case in the Middle East and the second in Saudi Arabia. The patient exhibited hypotonia, global developmental delay, speech delay, swallowing difficulties, and recurrent respiratory infections. A homozygous pathogenic variant in the HACE1 gene (p.R664*) was identified through genetic analysis, confirming the diagnosis of SPPRS. This case report emphasizes the importance of considering variations in clinical presentation, especially in rare disorders where only a few cases are reported. Further research and case studies are needed to better understand the complete phenotypic spectrum of SPPRS and its complications.
ABSTRACT
Hereditary spastic paraplegia (HSP) is a group of genetically heterogenous neurodegenerative disorders characterized by progressive spasticity and weakness of lower limbs. We report a novel splicing variant (c.1617-2A>C) of the SPAST gene in a heterozygous carrier from an Italian family with autosomal dominant HSP. The case study describes a pure form of spastic paraparesis with the cardinal clinical features of SPG4. The novel variant affects a canonical splice site and is likely to disrupt RNA splicing. We conclude that the c.1617-2A>C substitution is a null variant, which could be classified as pathogenic; its penetrance should be further investigated.
ABSTRACT
Mutations in the DDHD2 (DDHD domain containing 2) gene cause autosomal recessive spastic paraplegia type 54 (SPG54), a rare neurodegenerative disorder characterized by the early childhood onset of progressive spastic paraplegia. DDHD2 is reported as the principal brain triacylglycerol (TAG) lipase whose dysfunction causes massive lipid droplet (LD) accumulation in the brains of SPG54 patients. However, the precise functions of DDHD2 in regulating LD catabolism are not yet fully understood. In a recent study, we demonstrate that DDHD2 interacts with multiple members of the Atg8-family proteins (MAP1LC3/LC3s, GABARAPs), which play crucial roles in lipophagy. DDHD2 possesses two LC3-interacting region (LIR) motifs that contribute to its LD-eliminating activity. Moreover, DDHD2 enhances the colocalization between LC3B and LDs to promote lipophagy. LD·ATTEC, a compound that tethers LC3 to LDs to enhance their macroautophagic/autophagic clearance, effectively counteracts DDHD2 deficiency-induced LD accumulation. These findings provide insights into the dual functions of DDHD2 as a TAG lipase and cargo receptor for lipophagy in neuronal LD catabolism, and also suggest a potential therapeutic approach for treating SPG54 patients.
ABSTRACT
Mutation of the ATL1 gene is one of the most common causes of hereditary spastic paraplegia (HSP), a group of genetic neurodegenerative conditions characterised by distal axonal degeneration of the corticospinal tract axons. Atlastin-1, the protein encoded by ATL1, is one of three mammalian atlastins, which are homologous dynamin-like GTPases that control endoplasmic reticulum (ER) morphology by fusing tubules to form the three-way junctions that characterise ER networks. However, it is not clear whether atlastin-1 is required for correct ER morphology in human neurons and if so what the functional consequences of lack of atlastin-1 are. Using CRISPR-inhibition we generated human cortical neurons lacking atlastin-1. We demonstrate that ER morphology was altered in these neurons, with a reduced number of three-way junctions. Neurons lacking atlastin-1 had longer endosomal tubules, suggestive of defective tubule fission. This was accompanied by reduced lysosomal proteolytic capacity. As well as demonstrating that atlastin-1 is required for correct ER morphology in human neurons, our results indicate that lack of a classical ER-shaping protein such as atlastin-1 may cause altered endosomal tubulation and lysosomal proteolytic dysfunction. Furthermore, they strengthen the idea that defective lysosome function contributes to the pathogenesis of a broad group of HSPs, including those where the primary localisation of the protein involved is not at the endolysosomal system.
ABSTRACT
Biallelic variants in the SPG11 gene account for the most common form of autosomal recessive hereditary spastic paraplegia characterized by motor and cognitive impairment, with currently no therapeutic option. We previously observed in a Spg11 knockout mouse that neurodegeneration is associated with accumulation of gangliosides in lysosomes. To test whether a substrate reduction therapy could be a therapeutic option, we downregulated the key enzyme involved in ganglioside biosynthesis using an AAV-PHP.eB viral vector expressing a miRNA targeting St3gal5. Downregulation of St3gal5 in Spg11 knockout mice prevented the accumulation of gangliosides, delayed the onset of motor and cognitive symptoms, and prevented the upregulation of serum levels of neurofilament light chain, a biomarker widely used in neurodegenerative diseases. Importantly, similar results were observed when Spg11 knockout mice were administrated venglustat, a pharmacological inhibitor of glucosylceramide synthase expected to decrease ganglioside synthesis. Downregulation of St3gal5 or venglustat administration in Spg11 knockout mice strongly decreased the formation of axonal spheroids, previously associated with impaired trafficking. Venglustat had similar effect on cultured human SPG11 neurons. In conclusion, this work identifies the first disease-modifying therapeutic strategy in SPG11, and provides data supporting its relevance for therapeutic testing in SPG11 patients.
ABSTRACT
We present a 20-year-old patient with subglottic and tracheal stenosis was taken for a tracheal resection and end-to-end anastomosis. The patient's neck was positioned in hyperflexion using chin stitches to minimize tension at the anastomosis. On post-operative period, the patient developed paresthesias in upper and lower extremities associated with motor weakness. Magnetic resonance imaging was performed showing lesions compromising ventral spinal cord at the level of C4-C5 and C6-C7. Chin stitches were removed and neck flexion was reduced. The patient remained in the intensive care unit with vasopressors, physical therapy and intravenous fluid-therapy to maintain mean arterial pressure above 90 mmHg. After 3 weeks, the patient was discharged with no neurologic deficit. There are few cases reported of acute ischemic spinal injury following tracheal reconstruction. If this complication arises, neck posture should be corrected, maintenance of MAP above 90 mmHg and implementation of early physical therapy is key to improve neurologic outcomes.
ABSTRACT
We present a case of cytomegalovirus (CMV) polyradiculopathy which occurred concomitantly with CMV encephalitis and CMV retinitis in a patient with HIV/AIDS. Our patient is a 43-year-old male who was admitted with progressive changes in mentation. Cerebrospinal fluid (CSF) analysis showed elevated white blood cell (WBC), low glucose, and elevated protein. The polymerase chain reaction (PCR) panel of CSF was positive for CMV, and other microbiology results were negative. Extensive bilateral CMV retinitis was also noted. The patient was started on ganciclovir and foscarnet, and two weeks after, highly active antiretroviral therapy (HAART) was initiated using Truvada and dolutegravir. The hospital course was complicated by urinary retention and bilateral lower extremity weakness with hypotonia, severe hyperalgesia, and allodynia. An electromyography (EMG) study demonstrated bilateral lumbosacral root dysfunction at L2-S1 with active neurologic changes indicating significant axon loss. Neurology was consulted, and the patient was diagnosed with CMV-induced polyradiculopathy. After three months of treatment, no improvement was noted on lower limbs as he continued with intravenous (IV) ganciclovir. The therapeutic response to induction therapy was discordant as improvement of encephalitis was noted, but not on polyradiculopathy after 180 days of treatment. This highlights the lack of data and treatment guidelines for established CMV polyradiculopathy and not only the necessity for prolonged treatment of CMV polyradiculopathy but also the difficulty in recovery of function once it has developed.
ABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
KIF1A-related disorders (KRDs) encompass recessive and dominant variants with wide clinical variability. Recent genetic investigations have expanded the clinical phenotypes of heterozygous KIF1A variants. However, there have been a few long-term observational studies of patients with heterozygous KIF1A variants. A retrospective chart review of consecutive patients diagnosed with spastic paraplegia at Miyagi Children's Hospital from 2016 to 2020 identified six patients with heterozygous KIF1A variants. To understand the long-term changes in clinical symptoms, we examined these patients in terms of their characteristics, clinical symptoms, results of electrophysiological and neuroimaging studies, and genetic testing. The median follow-up period was 30 years (4-44 years). This long-term observational study showed that early developmental delay and equinus gait, or unsteady gait, are the first signs of disease onset, appearing with the commencement of independent walking. In addition, later age-related progression was observed in spastic paraplegia, and the appearance of axonal neuropathy and reduced visual acuity were characteristic features of the late disease phenotype. Brain imaging showed age-related progression of cerebellar atrophy and the appearance of hyperintensity of optic radiation on T2WI and FLAIR imaging. Long-term follow-up revealed a pattern of steady progression and a variety of clinical symptoms, including spastic paraplegia, peripheral neuropathy, reduced visual acuity, and some degree of cerebellar ataxia. Clinical variability between patients was observed to some extent, and therefore, further studies are required to determine the phenotype-genotype correlation.
ABSTRACT
PURPOSE: In some cases of endovascular thoracoabdominal or juxtarenal aortic aneurysm repair, a thoracic endograft in combination with a fenestrated renovisceral device may be needed in order to create a sufficient proximal landing zone. This study aimed to evaluate the technical aspects and postoperative morbidity of a single- or 2-stage approach. METHODS: Eighty-seven consecutive patients undergoing thoracic endovascular aortic repair (TEVAR) in combination with elective fenestrated repair (fenestrated endovascular aortic repair [FEVAR]; fenestrated Anaconda device) from 2015 to 2022 were included in this retrospective bicentric study. Underlying pathologies, aortic morphology, technical details, and postoperative morbidity were recorded. RESULTS: Single-staged ("1S," n=61) and 2-staged ("2S," n=26) interventions were compared. Indications were thoracoabdominal aneurysms (TAAAs) (Crawford I-IV) (n=56, 64%) and juxtarenal aneurysms (n=31, 36%). In 2S, the proportion of TAAA was higher than in 1S (2S: 77%, 1S: 59%; p=0.001). In 2S, the covered length of the descending aorta was longer (1S: 128±60 mm, 2S: 202±64 mm; p=0.003). Temporary aneurysm sack perfusion (TASP) was established in 11 (18%) of 1S and 1 (4%) of 2S patients (p=0.079), as well as cerebrospinal fluid (CSF) drainage catheter in 48 (79%) of 1S and 19 (73%) of 2S. The rate of spinal cord ischemia (SCI) and the severity of SCI were not different in both groups, with a total of 3 cases of persisting paraplegia. The rate of access complications was higher in 2S (n=6, 23%) than in 1S (n=4, 7%; p=0.027). Postoperative 30 day morbidity did not significantly differ in both groups and neither did 30 day mortality (4.6% in 1S vs 3.8% in 2S; p=0.083). CONCLUSION: The combination of TEVAR and FEVAR using a fenestrated endograft is feasible and safe. Aortic morphology does not change significantly after endovascular repair. A single-staged strategy is feasible with excellent results, especially in Crawford IV, Crawford V, or juxtarenal aneurysms. Two-staged repair is recommended in cases with long aortic coverage and a higher American Society of Anesthesiologists (ASA) class. Follow-up data are needed to evaluate the long-term stability of the TEVAR/FEVAR interconnection. CLINICAL IMPACT: Our study has revealed the safety and efficacy of the combination of TEVAR and FEVAR in the treatment of TAAAs and juxtarenal aneurysms with compromised supravisceral landing zones. A single-staged concept is not necessary in all cases. Staged procedures may reduce postoperative morbidity in cases with long aortic coverage and higher ASA class.