The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Frequency and molecular basis of CD36 deficiency among platelet donors in Kunming, China.

CD36 is a multifunctional receptor expressed on the surface of many cell types. Among healthy individuals, CD36 may be absent on platelets and monocytes (type I deficiency) or platelets alone (type II deficiency). However, the exact molecular mechanisms underlying CD36 deficiency remain unclear. In this study, we aimed to identify individuals with CD36 deficiency and investigate the molecular basis underlying it. Blood samples were collected from platelet donors at Kunming Blood Center. Platelets and monocytes were isolated and CD36-expression levels were analyzed using flow cytometry. DNA from whole blood and mRNA isolated from monocytes and platelets of individuals with CD36 deficiency were analyzed using polymerase chain reaction (PCR) testing. The PCR products were cloned and sequenced. Among the 418 blood donors,7 (1.68%) were CD36 deficient: 1 (0.24%) with type I deficiency and 6(1.44%) with type II deficiency. Six heterozygous mutations occurred, including c.268C>T (in type I individuals), c.120 + 1 G>T, c.268C>T, c.329_330del/AC, c.1156 C>T, c.1163A>C, and c.1228_1239del/ATTGTGCCTATT (in type II individuals). Mutations were not detected in one type II individual . At the cDNA level, only mutant, but not wild-type, transcripts were detected in the platelets and monocytes of type I individual. In type II individuals, only mutant transcripts were found in platelets, whereas monocytes possessed wild-type and mutant transcripts. Interestingly, only alternative splicing transcripts were observed in the individual without mutation. We report the incidence rates of type I and II CD36 deficiencies among platelet donors in Kunming. Molecular genetic analyses of DNA and cDNA demonstrated that homozygous mutations on the cDNA level in platelets and monocytes or platelets alone identified type I and II deficiencies, respectively. Furthermore, alternatively spliced products also potentially contribute to the mechanism of CD36 deficiency.

What is the context? Healthy individuals may lack CD36 on platelets and (or) monocytes, which are defined as Type I and Type II CD36 deficiency. These individuals could develop anti-CD36 antibodies associated with immune-mediated disorders. However, the mechanism underlying the CD36 deficiency is still unclear. In this study, we reported the incidence of CD36 deficiency in Kunming platelet donors and found the new molecular basis of CD36 deficiency individuals.What's new? Molecular genetic analysis of cDNA derived from type I subjects showed the presence of mutant transcript only, both in platelets and monocytes. In type II subjects, platelets only carry mutant transcript, whereas monocytes possessed both wild-type and mutant transcripts. Furthermore, we found that alternatively spliced product of CD36 transcript could also contribute to the mechanism of CD36 deficiencies.What's the impact? Our finding indicates that analysis of CD36 at cDNA level is mandatory to verify different forms of CD36 deficiencies. This information may help us to understand the development of anti-CD36 antibodies in CD36 deficient individuals.

Initial screening and retest mode in apheresis platelet donors: a comparative analysis / 中国输血杂志

【Objective】 To investigate the effectiveness of current indicators in initial screening and retest before donation and access the optimal testing strategies. 【Methods】 Data of initial screening (rate method for ALT, colloidal gold method for HBsAg) and retest (rate method for ALT, ELISA for HBsAg) of 18 510 platelet donors in our center from January 2019 to December 2021 were collected, and the results were retrospectively analyzed and compared in terms of different years and number of donations. 【Results】 From 2019 to 2021, data of initial screening and retest of platelet donors were as follows: 1) the deferral rate of ALT and HBsAg was 12.98% (2 403/18 510) vs 0.26%(40/15 412); 2) the deferral rate of ALT was 13.19% (712/5 398) vs 0.20%(9/4 410)in 2019, 13.33% (873/6 549) vs 0.06%(3/5 387)in 2020 and 11.05% (725/6 563) vs 0.07%(4/5 615)in 2021; for initial screening, significant difference was noticed in ALT reactivity in 2021 as in comparison to other two years(P<0.05); 3) the reactive rate of HBsAg was 0.43% (23/5 398) vs 0.18%(8/4 410)in 2019, 0.66% (43/6 549) vs 0.20%(11/5 387)in 2020 and 0.41% (27/6 563) vs 0.09%(5/5, 615) in 2021. For initial screening, HBsAg deferral in 2021 was significantly different from 2019, while similar with 2020. 4) Among ALT deferral samples in the retest, 68.75% (11/16) were ALT≥45 U/L. Among HBsAg reactive samples, 91.67% (22/24) were reactive by single reagent. 【Conclusion】 Setting the threshold value of ALT for platelet donors in initial screening as less than 45 U/L can effectively reduce the reactive rate in the retest. HBsAg screening only for first-time platelet donors can reduce the detection cost. Adding pre-donation detection indicators according to local prevalence of transfusion transmitted diseases is conductive to reduce the discarding rate of platelets.

Serial monitoring of ionised calcium levels in plateletpheresis donors: A study from tertiary care oncology centre in India.

BACKGROUND: Plateletpheresis is a safe procedure, and the most common reaction is hypocalcemia which is transient and self-limiting, but it can have an impact on donor experience and donor return rate. AIM: To serially monitor the ionized calcium levels of the plateletpheresis donors and to correlate with symptoms of hypocalcemia if any. METHODS: It was a prospective observational study in 126 healthy voluntary donors eligible for plateletpheresis as per the Departmental SOP and after taking written informed consent. Procedures were conducted on continuous flow centrifugation (CFC) and intermittent flow centrifugation (IFC) cell separators. Donor blood samples were collected in pre-heparinized syringes at different intervals to measure ionized calcium levels (iCa++) by venous blood gas analysis (Cobas 221). RESULTS: There was a continuous and gradual decrease in iCa++ from start to 30-45 minutes during the procedure; while the levels showed a gradual increase at end of the procedure and reached near the baseline values after 15-30 min of completion of the procedure. The change in iCa++ was statistically significant at 30 min and 45 min (p < 0.05), which was correlated with symptoms of hypocalcemia observed in 32.5 % (41/126) of the donors. Females experienced more symptoms of hypocalcemia as compared to males (p < 0.01). Donors who underwent plateletpheresis on the IFC machine experienced more symptoms of hypocalcemia as compared to the CFC machine (p < 0.05). CONCLUSION: For donors with persistent symptoms of hypocalcemia which are unrelieved by procedural modifications (reducing blood return rate, citrate infusion rate, etc.) measurement of iCa++ and administration of oral calcium tablets may be considered.

The polymorphism of HPA-1-6w, HPA-15 and HPA-32bw-35bw in platelet donors from Deyang, Sichuan / 中国输血杂志

【Objective】 To explore the polymorphism of HPA-1-6w, HPA-15 and 32bw-35bw in platelet donors in Deyang, Sichuan, and estimate whether to include the detection of 32bw-35bw in the platelet bank. 【Methods】 Polymerase chain reaction with sequenced based typing (PCR-SBT) was used to sequence the HPA-1-6w, HPA-15 and 32bw-35bw loci of 205 platelet donors in Deyang. Allele frequencies were calculated by the direct counting method. The frequencies of HPA-1-6 and 15 alleles in northern and southern Chinese, Japanese and Australian population were compared, and those HPA loci and HPA-32bw-35bw were searched in the Chinese Millionome Database (CMDB) and genomAD to obtain the polymorphism data. Then the Chi-square test was performed with the data of this study through GraphPad Prism 9 software. 【Results】 The allele frequencies of HPA-1b, 2b, 3b, 5b, 6bw and HPA-15b were 0.005(2/410), 0.037(15/410), 0.471(193/410), 0.020(8/410), 0.010(4/410) and 0.461(189/410), respectively, b allele of HPA-32bw-35bw and HPA-4 was not detected. Statistical significance was observed between the HPA-1b allele frequency of this study and northern Chinese, Australian population and genomAD global population sample (P< 0.05, 0.005 vs 0.014 vs 0.145 vs 0.122). The frequency of HPA-2b alleles in this study, Japanese population and genomAD global population samples was 0.037 vs 0.120 vs 0.100, with statistical difference(P<0.05). Comparison of HPA-5b and HPA-6bw allele frequencies with those of genomAD global population showed a statistical difference (P<0.05, 0.020 vs 0.089 and 0.010 vs 0.000 008, respectively). 【Conclusion】 The polymorphisms of HPA-1-6w and HPA-15 of donors in Deyang has characteristics of the southern Chinese. The frequencies of HPA-32bw-35bw were extremely low, which could be excluded from the platelet bank in Deyang.

Changes in hematological parameters of long-term high-frequency platelet donors / 中国输血杂志

【Objective】 To understand the effect of long-term high-frequency platelet donation on the health, safety and platelet quality of blood donors. 【Methods】 From August 2020 to July 2022, blood donors who donated platelets for single collection in the station were selected as two groups: those who donated for 20-29 times and those who donated for 30-44 times. Such 14 test indexes as red blood cell count (RBC), hemoglobin (Hb), hematocrit (Hct), mean corpuscular volume (MCV), platelet count (Plt), white blood cell count (WBC), large platelet ratio (P-LCR), lymphocyte (LYM) , neutrophil (NE), mean hemoglobin content (MCH), mean hemoglobin concentration (MCHC), platelet specific volume (PCT), mean platelet volume (MPV) and platelet distribution width (PDW) were grouped and statistically analyzed for 5 times in each group. In addition, blood donors who have donated platelets more than 100 times in the station were chosen; the changes of their 5 parameters as RBC, Hb, Hct, PLT and WBC, as well as the correlation with the total number of platelet donations were analyzed through statistical analysis of the first 100 donations(10 donations/group). 【Results】 During 2 years, the hematological parameters were similar between 20-29 donation group(n=30) and 30-44 donation group(n=11) (P>0.05). For donors with donations≥100 occasions, RBC, Hb, Hct and WBC were negatively correlated with the number of blood donations, while Plt was positively correlated. There were significant differences in Hb, Hct, WBC and Plt among groups (P<0.05). Hb, Hct and WBC showed a downward trend, while Plt showed an upward trend. 【Conclusion】 With the increase of blood donations and units of blood donated, some changes in hematological parameters are observed among long-term high-frequency platelet donors. Monitoring and health education should be strengthened to ensure the safety and quality of blood donors.

Genotyping of HPA-1-29bw in platelet donors in Nanjing, China / 中国输血杂志

【Objective】 To analyze the allele frequencies of the human platelet antigens 1-29 system (HPA-1-29bw) in Nanjing Han platelet donors, so as to provide references for compatible platelet transfusion. 【Methods】 HPA genotyping was performed by Sanger sequencing method in 900 Nanjing Han regular platelet donors who donated at Jiangsu Province Blood Center from February to September 2019. The frequencies of alleles and genotype were calculated using direct counting method. 【Results】 The HPA allele frequencies in Nanjing Han platelet donors were HPA-1a 0.9950, 1b 0.0050, 2a 0.9467, 2b 0.0533, 3a 0.5850, 3b 0.4150, 4a 0.9989, 4b 0.0011, 5a 0.9822, 5b 0.0178, 6a 0.9828, 6b 0.0172, 11a 0.9994, 11b 0.0006, 15a 0.5317, 15b 0.4683, 21a 0.9928 and 21b 0.0072, respectively. Only a allele was detected in HPA-7-10w, -12-14w, -16-20w and -22-29bw systems.The highest mismatch rate of HPA genes in 900 platelet donors was HPA-15 system, followed by HPA-3 system, with the rate of 37.40%(337/900) and 36.77%(331/900), respectively. One heterozygote was detected in HPA-11w system. 【Conclusion】 The chracteristics of HPA alleles frequencies in Nanjing Han platelet donors is that HPA-15 and HPA-3 are the most common heterozygotes, which should be paid attention to in local clinical transfusion.

Deferral causes of apheresis platelet donors during primary screening and the countermeasures, Qinghai / 中国输血杂志

【Objective】 To explore the deferral causes of apheresis platelet donors during primary screening in Qinghai, so as to take appropriate measures to improve the pass rate of donors. 【Methods】 The primary screening results of 6 673 apheresis donors from January 2018 to January 2020 in Qinghai were analyzed retrospectively. And the deferral results of donors were compared according to high(>2 500 m), middle(about 2 000 m) and low(<1500 m) altitude. 【Results】 41.7%(531) of those high-altitude blood donors were deferred, as low Plt accounted for 13.2%(168), high ALT 11.9%(151), high Hct/Hb/RBC 11.8%(150), and limepic blood 4.0%(51). 8.1% of the middle-altitude donors were deferred. As for low-altitude donors, low HCT, Hb and RBC(0.6%, 8 cases) were the dominant reason. 【Conclusion】 The different altitudes and living habits of blood donors may result in their deferral. Appropriate measures should be carried out for apheresis donors from areas of different altitudes when recruiting donors, so as to elevate the pass rate.

Donors' health state the year after peripheral haematopoietic progenitor cell collection: A prospective follow-up study in related and unrelated donors compared to first-time platelet donors.

Granulocyte colony-stimulating factor (G-CSF) mobilized peripheral haematopoietic progenitor cells collected by apheresis (HPC-A) are the most common source used for allogeneic hematopoietic stem cell transplantation (HSCT). Retrospective short and long-term donor follow-up studies show very low risks of serious complications and do not report compelling evidence of increased cancer occurrence. Some studies reported a prolonged period of leucopenia without an obvious association with infectious complications. However, beyond the first few weeks after the procedure a relationship between events is elusive. We therefore evaluated medical service utilization by prospectively recruited HPC-A donors and first-time platelet apheresis donors for comparison for 1 year after donation. Data were prospectively collected using questionnaires and by medical record review. A total of 215 HPC-A donors (111 unrelated donors and 104 related donors) and 96 first-time platelet donors consented to participation in the study. Follow-up was available for 202 (96%): questionnaires were returned by 74% and records from nonstudy contacts were available for 94% of donors. During the 1-year follow-up, 94 of the donors who returned questionnaires sought medical attention for diagnostic evaluation and/or treatment: 41% of HPC-A donors and 40% of platelet donors. Medical service utilization the first year after HPC-A donation is similar to that after first-time platelet donation. The occurrence of serious medical conditions in both related and unrelated HPC-A donors underscores the importance of participation in long-term follow-up in large cohorts. The findings in this relatively small cohort contribute to evidence on the safety of G-CSF mobilization and HPC-A. J. Clin. Apheresis 31:523-528, 2016. © 2015 Wiley Periodicals, Inc.

Evaluation of donor factors contributing to plateletpheresis yields among apheresis platelet donors.

BACKGROUND: The University of California, Irvine Blood Donor Center operates a plateletpheresis donor program utilizing the Amicus Cell Separator. Plateletpheresis donors may donate one or more apheresis platelet (PLT) units per collection event. This study seeks to characterize UC Irvine's donor pool by identifying biometric and demographic attributes predictive of double product (DP) collections. STUDY DESIGN AND METHODS: Biometric, demographic and procedural data from 1,786 apheresis donors were collected and entered into Excel spreadsheets. Of the 1,786 successful plateletpheresis procedures performed from January 2009 to April 2012, 1,442 of the donations were performed using double-needle (DN) kits. Only data from DN-kit collections were used for statistical analyses. The Classification And Regression Tree (CART) algorithm was used to help identify variables predictive of donating multiple PLT units in a single collection event. RESULTS: Donors weighing 75.7 kg or greater appear to be twice as likely to donate DPs as those weighing less than 75.7 kg. For donors weighing less than 75.7 kg, females appear to be twice as likely to donate DPs as males. Donors exhibiting platelet counts of 216.5 K/mcL or greater appear to be twice as likely to donate DPs as those with platelet counts fewer than 216.5 K/mcL. CONCLUSION: Weight, sex, and PLT count were identified as the most predictive donor attributes that separate UCI donors into DP donors and non-DP donors. Greater weights, greater PLT counts, and female sex confer to greater PLT yields per given amount of time.

Screening of Apheresis Platelet Donors for Human Parvovirus B19 by Gel Card Test / 대한수혈학회지

BACKGROUND: As apheresis platelet concentrates are widely used recently, the risk of transfusion associated infections is increased. Parvovirus B19 causes transfusion associated infections especially in chronic hemolytic anemia, haemophilia or immunosuppressed patients. We evaluated the significance of Parvovirus B19 antigen test to be one of the apheresis platelet donor screening test. METHODS: Three hundred forty eight serum (or plasma) samples from apheresis platelet donors were tested for Parvovirus B19 antigen test which was based on haemagglutination in gel technology. The tubes arranged in special gel cards (DiaMed) were added with 25 microL P antigen positive red cell and 10 microL patient's serum and then centrifuged at room temperature, 85 g for 10 minutes without incubation. The result was read and scored from 0 to 4 positive. Also the antibody screening test was performed for all of the positive samples on the Parvovirus B19 gel card test to exclude false positive reaction due to red cell alloantibody. We investigated directed recipient's disease state for all of positive donors and compared the result of the Parvovirus B19 antigen test with the routine screening test. RESLUTS: Six of the 348 samples were positive for Parvovirus B19 antigen test, the frequency was 1.7%. All of the six positive samples on gel card test reveal negative result by the antibody screening test. All of four directed recipients are immunosuppressed states. If the Parvovirus B19 antigen test was included in routine screening test, the rejection rate is expected to be increased about 1.4%. CONCLUSION: Screening for Parvovirus B 19 in apheresis platelet donors is considered to prevent transfusion mediated viral infection of susceptible recipients including immunocompromised patients.

Genetic polymorphism of HPA-1 to-5,HPA-15 alloantigen system in Qingdao Han population / 中国输血杂志

Objective To study the polymorphism of human platelet antigen HPA-1 to HPA-5,and HPA-15 system in Qingdao Han population.Methods A total of 918 samples from regular voluntary platelet donors in Qingdao were genotyped for HPA-1 to-5 and HPA-15 by PCR-SSP.Results The gene frequencies of HPA-1a,-1b;HPA-2a,-2b;HPA-3a,-3b;HPA-4a,-4b;HPA-5a,-5b;HPA-15a,-15b were 0.9940,0.0060;0.9319,0.0681;0.5822,0.4178;0.9897,0.0104;0.9804,0.0196;0.4913,0.5087,respectively.Both a and b alleles were found in each of the 6 HPA systems,and a/a homozygosity was more common in HPA-1,-2,-4 and-5 systems.The HPA genotype frequencies followed Hardy-Weinberg principle.HPA-1 frequency of Qingdao people was significantly different from that of North China(P