miR-155 influences cell-mediated immunity in Balb/c mice treated with aflatoxin M1.

Aflatoxin M1 (AFM1) is a 4-hydroxylated metabolite of aflatoxin B1 (AFB1). It induces various toxicological effects including immunotoxicity. In the present study, we investigated the effects of AFM1 on immune system and its modulation by MicroRNA (miR)-155. AFM1 was administered intraperitoneally at doses of 25 and 50 µg/kg for 28 days to Balb/c mice and different immune system parameters were analyzed. The levels of miR-155 and targeted proteins were evaluated in isolated T cells from spleens of mice. Spleen weight was reduced in mice exposed to AFM1 compared to negative control. Proliferation of splenocytes in response to phytohemagglutinin-A was reduced in mice exposed to AFM1. IFN-γ was decreased in mice exposed to AFM1, whereas IL-10 was increased. Concentration of IL-4 did not change different in mice exposed to AFM1 compared to negative control. Exposure to AFM1 reduced the expression of miR-155. Significant upregulation of phosphatidylinositol-3, 4, 5-trisphosphate 5-phosphatase 1 (Ship1) and suppressor of cytokine signaling 1 (Socs1) was observed in isolated T cells from spleens of mice treated with AFM1, but the transcription factor Maf (c-MAF) was not affected. These results suggest that miR-155 and targeted proteins might be involved in the immunotoxicity observed in mice exposed to AFM1.

Immunotoxicity of aflatoxin M1 : as a potent suppressor of innate and acquired immune systems in a subacute study.

BACKGROUND: Although, to date, there have been several in vitro and in vivo studies of immunomodulatory effects of aflatoxin M1 (AFB1 ), little is known about the effect of AFM1 on various aspects of innate and acquired immunity. In the present study, AFM1 was administered intraperitoneally, at doses of 25 and 50 µg kg-1 , body mass for 28 days and various immunological parameters were measured. RESULTS: Several parameters related to immune function were suppressed: organ mass, cellularity of spleen, proliferation response to lipopolysaccaride and phytohemagglutinin-A, hemagglutination titer, delayed type of hypersensitivity response, spleen cell subtypes, serum hemolytic activity, serum immunoglobulin G level and cytokine production. AFM1 did not cause changes in body mass, hematological parameters or the concentration of immunoglobulin M in blood serum. CONCLUSIONS: Overall, the data suggested that AFM1 suppressed innate and acquired immunity. Therefore, with respect to consumer safety, it is extremely important to further control the level of AFM1 in milk, and this should be considered as a precedence for risk management actions. © 2018 Society of Chemical Industry.

Prediction of shorter oligonucleotide sequences recognizing aflatoxin M1.

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement.

Doses of Immunogen Contribute to Specificity Spectrums of Antibodies against Aflatoxin.

Research about antibody specificity spectra was conducted to develop single-specific antibodies or broad-specific antibodies. Aflatoxins, as one class of high-toxicity mycotoxins, were selected as the research targets to investigate the effect of the immunogen dose on antibody specificity spectra. For this aim, 16 monoclonal antibodies were induced by low or high doses of aflatoxin B1-BSA, and 34 monoclonal antibodies were induced by low or high doses of aflatoxin M1-BSA. The specificities of the antibodies induced, whether by aflatoxin B1 conjugate or aflatoxin M1 conjugate, indicated that the low dose of the immunogen induced a narrow spectrum of antibody specificity, while the high dose of the immunogen showed an advantage to form a broad spectrum of antibody specificity. Therefore, this report provides important information for the development of new antibodies against small molecules like aflatoxins.

Aflatoxin m1 in milk products in china and dietary risk assessment.

This study was conducted to investigate the occurrence of aflatoxin M1 (AFM1) in milk products in China using the competitive enzyme-linked immunosorbent assay method and to estimate the dietary exposure to this toxin through a probabilistic approach. Based on the exposure assessment results, a quantitative cancer potency formula developed by the Joint Food and Agriculture Organization and World Health Organization Expert Committee on Food Additives was applied to assess the cancer risk. AFM1 was detected in 48.07% of the milk samples and 4.49% of the yoghurt samples. No samples contained AFM1 above the current regulatory limit in China. The simulated AFM1 intake (90% confidence interval) in various sex-age groups ranged from 0.023 (0.021 to 0.023) ng/kg of body weight per day for 30- to 45-year-old men to 0.382 (0.354 to 0.386) ng/kg of body weight per day for 2- to 4-year-old girls at the 99th percentile. The cancer risk of AFM1 to the general population of China was assessed to be 0.129 cancer cases per year per 10(8) persons at the 99th percentile. These results indicate that the health risk associated with AFM1 in milk in China is relatively low.

Incidence of aflatoxin M1 in human and animal milk in Jordan.

This study was undertaken to determine the presence of aflatoxin M1 (AFM1) in animal milk. In addition, exposure of infants to aflatoxin M1 (AFM1) and lactating mothers to aflatoxin B1 (AFB1) was examined using AFM1 in breast milk as a biomarker for exposure to AFB1. In total, 100 samples of fresh animal milk and fermented milk (buttermilk) and 80 samples of human breast milk were collected during the period 2011-2012. An enzyme-linked immunosorbent assay (ELISA) was used for the analysis of milk samples. AFM1 was detected in all animal fresh and fermented milk samples. The concentrations of AFM1 in 70 samples of fresh and fermented milk were higher than the maximum tolerance limit accepted by the European Union and the United States of 50 ng/kg. In human milk samples the average concentration of AFM1 was higher than the maximum tolerance limit accepted by the European Union and the United States of 25 ng/kg. Logistic regression analysis failed to show a correlation between AFM1 and type and amount of dairy consumption, vegetables, fruits, and meat. However, an association between AFM1 and cereal consumption was detected. This study is the first to report on the occurrence of AFM1 in milk consumed by the Jordanian population.

Analysis of duplicate 24-hour diet samples for aflatoxin B1, aflatoxin M1 and ochratoxin A.

In the spring and autumn of 1994, a total diet study, in which 123 participants collected duplicates of their 24-hour diets, was carried out. The goal of this study was to determine the mass fractions of a number of analytes in these duplicate diets, so as to be able to establish oral daily intake values. After measurements were carried out for pesticides, PCBs, elements, sterols, nitrate and nitrite, and fatty acids, the duplicate diet study was concluded with analyses for aflatoxin M1, aflatoxin B1 and ochratoxin A. For this purpose a method of analysis was developed, that could simultaneously determine these mycotoxins at very low levels. The method involved chloroform extraction, liquid-liquid extraction, immunoaffinity cleanup and liquid chromatography. The method was supplemented with a procedure to confirm the identity of chromatographic peaks, assumed to represent aflatoxin M1, aflatoxin B1 and ochratoxin A. The method was in-house validated. Recoveries ranged from 68-74% for aflatoxin M1 (at spiking levels from 30-120 ng/kg, c.v. 7.6%), from 95-97% for aflatoxin B1 (at spiking levels from 50-200 ng/kg, c.v. 2.8%), and from 75-84% for ochratoxin A (at spiking levels from 150-600 ng/kg, c.v. 4.3%). Limits of quantitation (defined as signal/noise = 10) were estimated to be 24, 5 and 16 ng/kg lyophilised material for aflatoxin M1, aflatoxin B1 and ochratoxin A respectively. The newly developed method was used to analyse 123 samples of 24-hour diets. Aflatoxin M1 was detectable in 48% of the samples; the toxin contents remained below the limit of quantitation in all samples. Aflatoxin B1 could be detected in 42% of the samples; in 25% of the samples the levels were above the limit of quantitation. Ochratoxin A could be quantified in all samples. The analytical results were further processed to estimate levels of intake. Intake levels for the aflatoxins were very low, and could not reliably be established. The mean ochratoxin A intake was estimated to be 1.2 ng/kg body weight per day. This is well below the tolerable daily intake established by JECFA at 14 ng/kg body weight per day. The current dietary intake of ochratoxin A in the Netherlands is concluded to pose no appreciable health risk.

Aflatoxins B1, M1 and aflatoxicol in tissues and urine of calves receiving aflatoxin.

Liver and kidney tissues and urine from calves chronically or acutely intoxicated by aflatoxin were surveyed to detect the presence of aflatoxins B1, M1 (AFB1, AFM1) and aflatoxicol (AFL). Aflatoxins B1, M1, and aflatoxicol were not found in the liver, kidney or urine from animals intoxicated by chronic forms. However in a calf that received a single dose of 0.8 mg of AFB1/kg of live weight and one submitted to a single dose of 1.8 mg of AFB1/kg of live weight detectable levels of aflatoxins occurred in tissues and urine.