Fatal disseminated aspergillosis in an immunocompetent patient with COVID-19 due to Aspergillus ochraceus.

Aspergillus infection is a well-known complication of severe influenza and severe acute respiratory syndrome coronavirus (SARS-CoV), and these infections have been related with significant morbidity and mortality even when appropriately diagnosed and treated. Recent studies have indicated that SARS-CoV-2 might increase the risk of invasive pulmonary aspergillosis (IPA). Here, we report the first case of Aspergillus ochraceus in a SARS-CoV-2 positive immunocompetent patient, which is complicated by pulmonary and brain infections. Proven IPA is supported by the positive Galactomannan test, culture-positive, and histopathological evidence. The patient did not respond to voriconazole, and liposomal amphotericin B was added to his anti-fungal regimen. Further studies are needed to evaluate the prevalence of IPA in immunocompetent patients infected with SARS-CoV-2. Consequently, testing for the incidence of Aspergillus species in lower respiratory secretions and Galactomannan test of COVID-19 patients with appropriate therapy and targeted anti-fungal therapy based on the primary clinical suspicion of IPA are highly recommended.

Pyrazinone derivatives from the coral-derived Aspergillus ochraceus LCJ11-102 under high iodide salt.

Five new pyrazin-2(1H)-one derivatives, ochramides A-D (1-4) and ochralate A (5), as well as three known analogues (6-8) were isolated from the fermentation broth of the marine coral-derived halotolerant Aspergillus ochraceus LCJ11-102 in a nutrient-limited medium containing 10% NaI. Their chemical structures were determined by analyzing NMR and X-ray diffraction data. Compounds 2, 5 and 6 showed antimicrobial activities against Enterobacter aerogenes with the MIC values of 40.0, 18.9, and 20.1 µM, respectively.

Ochratoxin A and ochratoxin-producing fungi on cereal grain in China: a review.

The mycotoxin ochratoxin A (OTA) is known to be the main contaminant of cereal grain and has become increasingly important in recent years. Therefore, a survey of ochratoxigenic fungi and OTA contamination in China is a special challenge. This paper summarises data on cereals and moulds (Aspergillus niger, Penicillium verrucosum, Aspergillus ochraceus, for example) and on grain and OTA from 1973 by searching Chinese information databases (NCKI, VIP, DuXiu etc.), calculating the OTA-producing mould detection rate, referring to sampling locations, latitude and temperature, and also combining six grain-producing areas of ochratoxigenic fungi and OTA positive rate through a comprehensive analysis. It is concluded that in China rice (excluding shell rice) has less OTA contamination than wheat or maize. The contamination of cereal grains with Aspergillus section Nigri (formerly of the A. niger group) is a serious problem in China, and these fungi may be the main ochratoxigenic fungi on cereals.

Efficiency of Artemisia nilagirica (Clarke) Pamp. essential oil as a mycotoxicant against postharvest mycobiota of table grapes.

BACKGROUND: In order to get a potent botanical fungicide for the management of fungal decay of table grapes, an experiment was conducted in which 20 essential oils of higher plants were screened at 0.33 µL mL(-1) against dominant fungi causing decay of table grapes, including Aspergillus flavus, A. niger and A. ochraceus. Furthermore, the minimum inhibitory/fungicidal concentration, fungitoxic spectrum and mycotoxin inhibition activity of the most potent oil were determined. The efficacy of the most potent oil in preservation of table grapes, along with organoleptic evaluation, was also carried out by storing 1 kg of grapes in the oil vapour. RESULTS: Artemisia nilagirica oil was found to be most toxic, exhibiting 100% mycelia inhibition of all test fungi. Moreover, 0.29 µL mL(-1) A. nilagirica oil was fungistatic and 0.58 µL mL(-1) was fungicidal for all tested species of Aspergillus. The oil exhibited a broad range of fungitoxicity against other grape berry-rotting fungi. Artemisia nilagirica oil completely suppressed the growth and mycotoxin (AFB1 and OTA) secretion of aflatoxigenic and ochratoxigenic strains of Aspergillus at 1.6 µL mL(-1) . During the in vivo experiment, fumigation of 1 kg of table grapes with 200 and 300 µL dosage of A. nilagirica oil enhanced the shelf life for up to 9 days. The oil did not show any phytotoxic effect. Besides, oil application did not substantively change the sensory properties of the fruits. CONCLUSION: Artemisia nilagirica oil can be used as an alternative botanical fungicide for the control of fruit-rotting fungi of stored grapes.

A novel xylan degrading ß-D-xylosidase: purification and biochemical characterization.

Aspergillus ochraceus, a thermotolerant fungus isolated in Brazil from decomposing materials, produced an extracellular ß-xylosidase that was purified using DEAE-cellulose ion exchange chromatography, Sephadex G-100 and Biogel P-60 gel filtration. ß-xylosidase is a glycoprotein (39 % carbohydrate content) and has a molecular mass of 137 kDa by SDS-PAGE, with optimal temperature and pH at 70 °C and 3.0-5.5, respectively. ß-xylosidase was stable in acidic pH (3.0-6.0) and 70 °C for 1 h. The enzyme was activated by 5 mM MnCl2 (28 %) and MgCl2 (20 %) salts. The ß-xylosidase produced by A. ochraceus preferentially hydrolyzed p-nitrophenyl-ß-D-xylopyranoside, exhibiting apparent K(m) and V(max) values of 0.66 mM and 39 U (mg protein)⁻¹ respectively, and to a lesser extent p-nitrophenyl-ß-D-glucopyranoside. The enzyme was able to hydrolyze xylan from different sources, suggesting a novel ß-D-xylosidase that degrades xylan. HPLC analysis revealed xylans of different compositions which allowed explaining the differences in specificity observed by ß-xylosidase. TLC confirmed the capacity of the enzyme in hydrolyzing xylan and larger xylo-oligosaccharides, as xylopentaose.

Impact of drying surface and raking frequencies on mold incidence, ochratoxin A contamination, and cup quality during preparation of arabica and robusta cherries at the farm level.

The aim of this study was to evaluate the impact and contribution of various drying surfaces (soil, cement, and tarpaulin) and raking frequencies (1 and 4/day) on the incidence of toxigenic molds, ochratoxin A (OTA) production, and on the overall cup quality during preparation of arabica and robusta coffee cherry in India. Two individual experimental batches (run 1 at the begin of harvest and run 2 at the end of harvest) were set up for the study. Results showed high incidence of molds in coffee dried on soil surface compared with that on cement and tarpaulin surfaces. In both arabica and robusta, OTA could be detected in Aspergillus ochraceus contaminated samples at the end of harvest. Raking of the cherries 4 times/day showed lower fungal incidence with no OTA levels detected. Overall, coffee cherry prepared by drying on tarpaulin surface with 4 rakings/day showed lower OTA and fungal incidence with good and acceptable cup quality, and this is recommended to be practiced at the farm level.

Chronic monolateral otomycosis in a dog caused by Aspergillus ochraceus.

Aspergillus ochraceus, a widely distributed filamentous fungus, was isolated and identified by cytology and culture as the cause of unilateral ceruminous purulent otitis in a 4-year-old male mixed-breed dog. The pathogenic role of the fungal isolate was confirmed by a good response to antifungal therapy and the absence of other pathogens. No underlying diseases were identified and the dog recovered after 3 weeks of therapy with oral itraconazole and topical miconazole.

ITS-based detection and quantification of Aspergillus ochraceus and Aspergillus westerdijkiae in grapes and green coffee beans by real-time quantitative PCR.

Aspergillus ochraceus and A. westerdijkiae are considered the most important Ochratoxin A (OTA) producing species included in Aspergillus section Circumdati which contaminate foodstuffs and beverages for human consumption. In this work a real-time quantitative PCR protocol was developed to detect both species using SYBR Green and primers designed on the basis of the multicopy ITS1 region of the rDNA. The assay had high efficiency (94%) and showed no inhibition by host or fungal DNA other than the target species. The lower detection limit of the target DNA was 2.5 pg/reaction. Accuracy of detection and quantification by qPCR were tested with genomic DNA obtained from green coffee beans and grapes artificially contaminated with spore suspensions of known concentrations. Spore concentrations equal or higher than 10(6) spore/ml could be detected by the assay directly without prior incubation of the samples and a positive relationship was observed between incubation time and qPCR values. The assay developed would allow rapid, specific, accurate and sensitive detection and quantification of A. ochraceus and A. westerdijkiae to be directly used in a critical point of the food chain, before harvesting green coffee and grape berries, to predict and control fungal growth and OTA production.

Detection of Aspergillus spp. and aflatoxin B1 in rice in India.

Twelve hundred rice samples consisting of paddy (675) and milled rice (525) were collected from 20 states across India. These samples were assessed for Aspergillus spp. infection on selective medium and aflatoxin B(1) (AFB1) by indirect competitive ELISA. In this investigation, Aspergillus flavus contamination dominated in all the seed samples. The other major contaminants were Aspergillus niger, Aspergillus ochraceus and Aspergillus parasiticus. Out of 1200 rice samples, 67.8% showed AFB1 ranging from 0.1 to 308.0 microg/kg. All the paddy samples from Chattishgarh, Meghalaya and Tamil Nadu showed AFB1 contamination. Milled rice grains from different states showed below the permissible levels of AFB1 (average 0.5-3.5 microg/kg). Eighty-two percent of samples from open storage that were exposed to rain showed AFB1 contamination followed by one-year-old seed. Out of 1200 samples, 2% showed AFB1 contamination above the permissible limits (>30 microg/kg). This is the first comprehensive report of aflatoxin contamination in rice across 20 states in India.

Moulds and ochratoxin A on surfaces of artisanal and industrial dry sausages.

The use of moulds as a seasoning for sausage can have both desirable and undesirable consequences. The desirable consequences are the creation of a successful product that appeals to consumers. The undesirable consequences are due to the growth of undesirable moulds that produce highly toxic secondary metabolites referred to as mycotoxins. The aim of the paper was to investigate the presence of moulds producing ochratoxin A (OTA) on the surface of sausages from northern Italy. A total of 757 mould strains were isolated from sausage casings. The most frequently identified species were Penicillium nalgiovense, Penicillium oxalicum, Eurotium amstelodami, Penicillium olsonii, Penicillium chrysogenum, Penicillium verrucosum, Penicillium viridicatum, and Eupenicillium crustaceum. Aspergillus ochraceus was detected in only one production lot. Approximately 45% of these samples were positive for the presence of OTA. On the casings of the investigated sausages, the lowest and highest OTA values were 3 and 18 microg/kg, respectively. The OTA concentration was reduced to below the limit of detection (LOD) by brushing and washing the sausages prior to sale. From these data it appears that the presence of OTA on the surface of sausage (on the casings) is not indicative of any health risk for human consumption of sausage, since OTA was not identified inside the dry meat.

Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Occurrence of ochratoxin A and ochratoxigenic mycoflora in corn and corn based foods and feeds in some South American countries.

Cereals and cereal- derived products constitute the base of human and animal feeding in South American countries. This review attempts to give an overview of the ochratoxin A (OTA) occurrence and potential sources of OTA contamination in those products. The environmental conditions as humidity and temperature in the colonization of the substrates by Aspergillus section Nigri isolated from corn kernels were also discussed. The available information on the ochratoxigenic mycoflora and OTA presence in corn, corn based food and feed is limited. Only few surveys have been carried out in Argentina, Ecuador and Brazil; which showed that Aspergillus niger aggregate and A. ochraceus species would be the main source of OTA. It's possible to emphasize that, the species A. carbonarius has not been isolated from these substrates and Penicillium verrucosum was isolated only from pig feeds of Argentinean samples in low percentage. Studies about the ecophysiology of ochratoxigenic fungi and OTA occurrence are in progress in Latin America to reduce the impact of this toxin in the food chain.

[Ochratoxin A contamination of cereal grain harvested in 2003 and 2004 years].

The analysis of ochratoxin A--mycotoxin produced by widely distributed Aspergillus and Penicillium--of cereal grain harvested in 2003 - 2004 years were performed by immunoaffinity column clean-up and HPLC with fluorescence detection. This survey examined 282 samples of raw grain wheat, rye, barley and oat 13.8% of all samples contaminated by ochratoxin A in the range 0.2-33.3 mg/kg. Calculation made on the basis of the obtained means showed that the daily ochratoxin A intake of human from cereal grain were from 1.58 to 2.84 ng/kg b.w. Scientific Committee for Food of the European Commission suggested that it was prudent to reduce exposure to ochratoxin A as much as possible below 5 ng/kg bw/day. Codex Alimentarius and European Commission have established maximum permissible level of 5 mg/kg for ochratoxin A in raw cereal grains.

Fungi and ochratoxin A detected in healthy grapes for wine production.

AIMS: The mycoflora of healthy grapes (i.e. without visible symptoms of rot) for wine production in Portuguese wine-making regions was assessed and its potential for ochratoxin A (OTA) production evaluated. The OTA content of grapes was also determined. METHODS AND RESULTS: A total of 386 fungal strains were isolated by plating methods. The most frequent genera found in grapes were non-ochratoxigenic species: Cladosporium (28%), Penicillium (24%), Botrytis (13%) and Aspergillus (9%). Two OTA-producing strains were isolated, belonging to the species Aspergillus carbonarius and Aspergillus ochraceus. OTA was detected in three of four grape samples, up to 116 ng l(-1). CONCLUSIONS: OTA is being produced in healthy berries by Aspergillus species, namely A. carbonarius, at levels below the maximum recommended limit of 2,000 ng l(-1) in wine. SIGNIFICANCE AND IMPACT OF THE STUDY: The OTA concentration detected in healthy Portuguese grapes does not represent a risk to wine regarding the legal limit established.

Incidence of toxigenic fungi and ochratoxin A in dried fruits sold in Brazil.

A total of 117 dried fruit samples (black sultanas, white sultanas, dates, dried plums, dried figs and apricots) from different origins were analysed both for toxigenic fungi and for the presence of ochratoxin A. Amongst the fungi found, Aspergillus niger was predominant, with 406 isolates, of which 15% were ochratoxin A producers. They were followed by A. ochraceus, with 15 isolates and 87% ochratoxigenics, and A. carbonarius, with only five isolates of which 60% were ochratoxin A producers. The average infection rates for A. niger in black sultanas, plums, figs, dates and white sultanas were 22.0, 8.0, 4.0, 1.5 and 0.5%, respectively. The apricot samples were not contaminated by any fungi or ochratoxin A. Black sultana and dried figs contained the highest contamination with ochratoxin A, with 33 and 26.3% of the samples containing more than 5 microg kg(-1) respectively, while all the white sultanas, dates and plums had no sample that exceeded this limit.

PCR detection assays for the ochratoxin-producing Aspergillus carbonarius and Aspergillus ochraceus species.

Two PCR assays have been developed to detect Aspergillus carbonarius and Aspergillus ochraceus, considered the main sources of ochratoxin A (OTA) contaminating commodities, particularly grapes, coffee and derivatives, in warm climates. The species specific primers have been designed on the basis of ITS (internal transcribed spacers of rDNA units) sequence comparisons obtained from Aspergillus strains and have been tested in a number of strains from different origins and hosts. These PCR assays, based on multi-copy sequences, are highly sensitive and specific and represent a good tool for an early detection of OTA-producing Aspergillus species and to prevent OTA entering the food chain.

Detection and quantification of Aspergillus ochraceus in green coffee by PCR.

AIMS: The aim of this study was to detect and quantify DNA of the ochratoxinogenic fungus Aspergillus ochraceus in green coffee and to compare the results with the ochratoxin A content of naturally contaminated samples. METHODS AND RESULTS: A DNA extraction protocol based on a combination of ultrasonification and a commercial kit was tested for the recovery of fungal DNA. PCR and real-time PCR protocols were established for the detection of A. ochraceus. Sensitivity of the PCR was checked by the addition of inoculated green coffee and pure fungal DNA to uncontaminated green coffee samples. The A. ochraceus DNA content of 30 naturally contaminated green coffee samples was determined and compared with the ochratoxin A concentrations. CONCLUSIONS: Aspergillus ochraceus can be rapidly and specifically detected in green coffee by PCR. A positive correlation between the ochratoxin A content and the DNA quantity was established. SIGNIFICANCE AND IMPACT OF THE STUDY: This work offers a quick alternative to the conventional mycological detection and quantification of A. ochraceus in green coffee.

Spoilage fungi and their mycotoxins in commercially marketed chestnuts.

A nationwide survey was carried out to assess mould spoilage of Castanea sativa nuts sold in Canadian grocery stores in 1998-99. Morphological and cultural characters, along with secondary metabolite profiles derived from thin-layer chromatography, were used to sort and identify fungi cultured from nut tissue. Three mycotoxigenic fungi dominated (Penicillium crustosum, Penicillium glabrum/spinulosum and Penicillium discolor) and were isolated at frequencies of 67.1%, 18.6% and 17.7%, respectively, from a total sample size of 350 nuts. Another mycotoxin producer, Aspergillus ochraceus was also isolated, but at a much lower frequency. HPLC and diode array detection were used to confirm the suspected presence of the mycotoxins penitrem A, chaetoglobosin A and C, emodin and ochratoxin A in extracts prepared from naturally infected nut tissue. To the best of our knowledge, this is the first time emodin has been found in a naturally contaminated food source.

Molecular typing of Aspergillus ochraceus and construction of species specific SCAR-primers based on AFLP.

70 strains of Aspergillus ochraceus mainly isolated from Brazilian coffee related sources were investigated for genetic relatedness using automated laser fluorescence analysis of AFLP fragments. Cluster analysis of fingerprints revealed a very close relationship among most of the strains. Based on these results, a sub-set of characteristic A. ochraceus strains was chosen for the detection of marker sequences. These sequences were obtained from silver stained AFLPs separated on polyacrylamide gels. A number of bands characteristic for A. ochraceus were detected and cut out from the gels. DNA was reamplified, cloned and fragments were sequenced. Based on these sequences a set of SCAR PCR-primers was constructed. PCRs were optimised for specificity and subsequently tested against a panel of Aspergillus species. Using this approach a PCR specific for Aspergillus ochraceus was developed.

[Invasive pulmonary aspergillosis caused by Aspergillus ochraceus]. / Inwazyjna aspergiloza pluc wywolana przez Aspergillus ochraceus.

Invasive pulmonary aspergillosis (IPA) is a frequent complication in patients with severe neutropenia resulting from cytotoxic chemotherapy. In Europe, Aspergillus fumigatus is most common pathogen of IPA. In our case, IPA was recognised in 54 year old female suffering from acute lymphoblastic leukemia with pancytopenia. The patient developed severe granulocytopenia during chemotherapy. Chest radiograph revealed progressive bilateral infiltrations with cavitation. In sputum culture Aspergillus ochraceus was found. The results of precipitating tests were positive for A. ochraceus and A. fumigatus. Treatment with amphotericin B was used successfully leading soon to clinical improvement, yet radiological lesions remained largely unchanged. The patient received itraconazole, which was very effective and caused almost complete regression. Two episodes of IPA recurrence were treated with antifungal therapy with good results.