Whole-body deletion of Endospanin 1 protects from obesity-associated deleterious metabolic alterations.

The importance of the proper localization of most receptors at the cell surface is often underestimated, although this feature is essential for optimal receptor response. Endospanin 1 (Endo1) (also known as OBRGRP or LEPROT) is a protein generated from the same gene as the human leptin receptor and regulates the trafficking of proteins to the surface, including the leptin receptor. The systemic role of Endo1 on whole-body metabolism has not been studied so far. Here, we report that general Endo1-KO mice fed a high-fat diet develop metabolically healthy obesity with lipid repartitioning in organs and preferential accumulation of fat in adipose tissue, limited systematic inflammation, and better controlled glucose homeostasis. Mechanistically, Endo1 interacts with the lipid translocase CD36, thus regulating its surface abundance and lipid uptake in adipocytes. In humans, the level of Endo1 transcripts is increased in the adipose tissue of patients with obesity, but low levels rather correlate with a profile of metabolically healthy obesity. We suggest here that Endo1, most likely by controlling CD36 cell surface abundance and lipid uptake in adipocytes, dissociates obesity from diabetes and that its absence participates in metabolically healthy obesity.

The CD36 scavenger receptor Bez regulates lipid redistribution from fat body to ovaries in Drosophila.

Lipid distribution in an organism is mediated by the interplay between lipoprotein particles, lipoprotein receptors and class B scavenger receptors of the CD36 family. CD36 is a multifunctional protein mediating lipid uptake, mobilization and signaling at the plasma membrane and inside of the cell. The CD36 protein family has 14 members in Drosophila melanogaster, which allows for the differentiated analysis of their functions. Here, we unravel a role for the so far uncharacterized scavenger receptor Bez in lipid export from Drosophila adipocytes. Bez shares the lipid binding residue with CD36 and is expressed at the plasma membrane of the embryonic, larval and adult fat body. Bez loss of function lowers the organismal availability of storage lipids and blocks the maturation of egg chambers in ovaries. We demonstrate that Bez interacts with the APOB homolog Lipophorin at the plasma membrane of adipocytes and trace the Bez-dependent transfer of an alkyne-labeled fatty acid from adipocytes to Lipophorin. Our study demonstrates how lipids are distributed by scavenger receptor-lipoprotein interplay and contribute to the metabolic control of development.

Unveiling the hidden role of the interaction between CD36 and FcγRIIb: implications for autoimmune disorders.

BACKGROUND: The role of the scavenger receptor CD36 in cell metabolism and the immune response has been investigated mainly in macrophages, dendritic cells, and T cells. However, its involvement in B cells has not been comprehensively examined. METHODS: To investigate the function of CD36 in B cells, we exposed Cd36fl/flMB1cre mice, which lack CD36 specifically in B cells, to apoptotic cells to trigger an autoimmune response. To validate the proteins that interact with CD36 in primary B cells, we conducted mass spectrometry analysis following anti-CD36 immunoprecipitation. Immunofluorescence and co-immunoprecipitation were used to confirm the protein interactions. RESULTS: The data revealed that mice lacking CD36 in B cells exhibited a reduction in germinal center B cells and anti-DNA antibodies in vivo. Mass spectrometry analysis identified 30 potential candidates that potentially interact with CD36. Furthermore, the interaction between CD36 and the inhibitory Fc receptor FcγRIIb was first discovered by mass spectrometry and confirmed through immunofluorescence and co-immunoprecipitation techniques. Finally, deletion of FcγRIIb in mice led to decreased expression of CD36 in marginal zone B cells, germinal center B cells, and plasma cells. CONCLUSIONS: Our data indicate that CD36 in B cells is a critical regulator of autoimmunity. The interaction of CD36-FcγRIIb has the potential to serve as a therapeutic target for the treatment of autoimmune disorders.

Qilong capsule prevents myocardial ischemia/reperfusion injury by inhibiting platelet activation via the platelet CD36 signaling pathway.

ETHNOPHARMACOLOGICAL RELEVANCE: Qilong capsule (QC) is developed from the traditional Chinese medicine formula Buyang Huanwu Decoction, which has been clinically used to invigorate Qi and promote blood circulation to eliminate blood stasis. Myocardial ischemia‒reperfusion injury (MIRI) can be attributed to Qi deficiency and blood stasis. However, the effects of QC on MIRI remain unclear. AIM OF THE STUDY: This study aimed to investigate the protective effect and possible mechanism of QC on platelet function in MIRI rats. MATERIALS AND METHODS: The left anterior descending artery of adult Sprague‒Dawley rats was ligated for 30 min and then reperfused for 120 min with or without QC treatment. Then, the whole blood viscosity, plasma viscosity, coagulation, platelet adhesion rate, platelet aggregation, and platelet release factors were evaluated. Platelet CD36 and its downstream signaling pathway-related proteins were detected by western blotting. Furthermore, the active components of QC and the molecular mechanism by which QC regulates platelet function were assessed via molecular docking, platelet aggregation tests in vitro and BLI analysis. RESULTS: We found that QC significantly reduced the whole blood viscosity, plasma viscosity, platelet adhesion rate, and platelet aggregation induced by ADP or AA in rats with MIRI. The inhibition of platelet activation by QC was associated with reduced levels of ß-TG, PF-4, P-selectin and PAF. Mechanistically, QC effectively attenuated the expression of platelet CD36 and thus inhibited the activation of Src, ERK5, and p38. The active components of QC apparently suppressed platelet aggregation in vitro and regulated the CD36 signaling pathway. CONCLUSIONS: QC improves MIRI-induced hemorheological disorders, which might be partly attributed to the inhibition of platelet activation via CD36-mediated platelet signaling pathways.

Visceral adipose of obese mice inhibits endothelial inwardly rectifying K+ channels in a CD36-dependent fashion.

Obesity imposes deficits on adipose tissue and vascular endothelium, yet the role that distinct adipose depots play in mediating endothelial dysfunction in local arteries remains unresolved. We recently showed that obesity impairs endothelial Kir2.1 channels, mediators of nitric oxide production, in arteries of visceral adipose tissue (VAT), while Kir2.1 function in subcutaneous adipose tissue (SAT) endothelium remains intact. Therefore, we determined if VAT versus SAT from lean or diet-induced obese mice affected Kir2.1 channel function in vitro. We found that VAT from obese mice reduces Kir2.1 function without altering channel expression whereas AT from lean mice and SAT from obese mice had no effect on Kir2.1 function as compared to untreated control cells. As Kir2.1 is well known to be inhibited by fatty acid derivatives and obesity is strongly associated with elevated circulating fatty acids, we next tested the role of the fatty acid translocase CD36 in mediating VAT-induced Kir2.1 dysfunction. We found that the downregulation of CD36 restored Kir2.1 currents in endothelial cells exposed to VAT from obese mice. In addition, endothelial cells exposed to VAT from obese mice exhibited a significant increase in CD36-mediated fatty acid uptake. The importance of CD36 in obesity-induced endothelial dysfunction of VAT arteries was further supported in ex vivo pressure myography studies where CD36 ablation rescued the endothelium-dependent response to flow via restoring Kir2.1 and endothelial nitric oxide synthase function. These findings provide new insight into the role of VAT in mediating obesity-induced endothelial dysfunction and suggest a novel role for CD36 as a mediator of endothelial Kir2.1 impairment.NEW & NOTEWORTHY Our findings suggest a role for visceral adipose tissue (VAT) in the dysfunction of endothelial Kir2.1 in obesity. We further reveal a role for CD36 as a major contributor to VAT-mediated Kir2.1 and endothelial dysfunction, suggesting that CD36 offers a potential target for preventing the early development of obesity-associated cardiovascular disease.

Droplet-based proteomics reveals CD36 as a marker for progenitors in mammary basal epithelium.

Deep proteomic profiling of rare cell populations has been constrained by sample input requirements. Here, we present DROPPS (droplet-based one-pot preparation for proteomic samples), an accessible low-input platform that generates high-fidelity proteomic profiles of 100-2,500 cells. By applying DROPPS within the mammary epithelium, we elucidated the connection between mitochondrial activity and clonogenicity, identifying CD36 as a marker of progenitor capacity in the basal cell compartment. We anticipate that DROPPS will accelerate biology-driven proteomic research for a multitude of rare cell populations.

Conjugated linoleic acid (CLA) reduces intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

The anti-obesity effect of conjugated linoleic acid (CLA) has been well elucidated, but whether CLA affects fat deposition by regulating intestinal dietary fat absorption remains largely unknown. Thus, this study aimed to investigate the effects of CLA on intestinal fatty acid uptake and chylomicron formation and explore the possible underlying mechanisms. We found that CLA supplementation reduced the intestinal fat absorption in HFD (high fat diet)-fed mice accompanied by the decreased serum TG level, increased fecal lipids and decreased intestinal expression of ApoB48 and MTTP. Correspondingly, c9, t11-CLA, but not t10, c12-CLA induced the reduction of fatty acid uptake and TG content in PA (palmitic acid)-treated MODE-K cells. In the mechanism of fatty acid uptake, c9, t11-CLA inhibited the binding of CD36 with palmitoyltransferase DHHC7, thus leading to the decreases of CD36 palmitoylation level and localization on the cell membrane of the PA-treated MODE-K cells. In the mechanism of chylomicron formation, c9, t11-CLA inhibited the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the PA-treated MODE-K cells. In in vivo verification, CLA supplementation reduced the DHHC7-mediated total and cell membrane CD36 palmitoylation and suppressed the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the jejunum of HFD-fed mice. Altogether, these data showed that CLA reduced intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

Genotypic and Allelic Distribution of the CD36 rs1761667 Polymorphism in High-Level Moroccan Athletes: A Pilot Study.

Previous studies have shown that variations in the CD36 gene may affect phenotypes associated with fat metabolism as the CD36 protein facilitates the transport of fatty acids to the mitochondria for oxidation. However, no previous study has tested whether variations in the CD36 gene are associated with sports performance. We investigated the genotypic and allelic distribution of the single-nucleotide polymorphism (SNP) rs1761667 in the CD36 gene in elite Moroccan athletes (cyclists and hockey players) in comparison with healthy non-athletes of the same ethnic origin. Forty-three Moroccan elite male athletes (nineteen cyclists and twenty-four field hockey players) belonging to the national teams of their respective sports (athlete group) were compared to twenty-eight healthy, active, male university students (control group). Genotyping of the CD36 rs1761667 (G>A) SNP was performed via polymerase chain reaction (PCR) and Sanger sequencing. A chi-square (χ2) test was used to assess the Hardy-Weinberg equilibrium (HWE) and to compare allele and genotype frequencies in the "athlete" and "control" groups. The genotypic distribution of the CD36 rs1761667 polymorphism was similar in elite athletes (AA: 23.81, AG: 59.52, and GG: 16.67%) and controls (AA: 19.23, AG: 69.23, and GG: 11.54%; χ2 = 0.67, p = 0.71). However, the genotypic distribution of the CD36 rs1761667 polymorphism was different between cyclists (AA: 0.00, AG: 72.22, and GG: 27.78%) and hockey players (AA: 41.67, AG: 50.00, and GG: 8.33%; χ2 = 10.69, p = 0.004). Specifically, the frequency of the AA genotype was significantly lower in cyclists than in hockey players (p = 0.02). In terms of allele frequency, a significant difference was found between cyclists versus field hockey players (χ2 = 7.72, p = 0.005). Additionally, there was a predominance of the recessive model in cyclists over field hockey players (OR: 0.00, 95% CI: 0.00-0.35, p = 0.002). Our study shows a significant difference between cyclists and field hockey players in terms of the genotypic and allelic frequency of the SNP rs1761667 of the CD36 gene. This divergence suggests a probable association between genetic variations in the CD36 gene and the type of sport in elite Moroccan athletes.

Sesamin ameliorates nonalcoholic hepatic steatosis by inhibiting CD36-mediated hepatocyte lipid accumulation in vitro and in vivo.

Hepatic steatosis is a critical factor in the development of nonalcoholic steatohepatitis (NASH). Sesamin (Ses), a functional lignan isolated from Sesamum indicum, possesses hypolipidemic, liver-protective, anti-hypertensive, and anti-tumor properties. Ses has been found to improve hepatic steatosis, but the exact mechanisms through which Ses achieves this are not well understood. In this study, we observed the anti-hepatic steatosis effects of Ses in palmitate/oleate (PA/OA)-incubated primary mouse hepatocytes, AML12 hepatocytes, and HepG2 cells, as well as in high-fat, high-cholesterol diet-induced NASH mice. RNA sequencing analysis revealed that cluster of differentiation 36 (CD36), a free fatty acid (FA) transport protein, was involved in the Ses-mediated inhibition of hepatic fat accumulation. Moreover, the overexpression of CD36 significantly increased hepatic steatosis in both Ses-treated PA/OA-incubated HepG2 cells and NASH mice. Furthermore, Ses treatment suppressed insulin-induced de novo lipogenesis in HepG2 cells, which was reversed by CD36 overexpression. Mechanistically, we found that Ses ameliorated NASH by inhibiting CD36-mediated FA uptake and upregulation of lipogenic genes, including FA synthase, stearoyl-CoA desaturase 1, and sterol regulatory element-binding protein 1. The findings of our study provide novel insights into the potential therapeutic applications of Ses in the treatment of NASH.

A novel fatty acid analogue triggers CD36-GPR120 interaction and exerts anti-inflammatory action in endotoxemia.

Inflammation is a mediator of a number of chronic pathologies. We synthesized the diethyl (9Z,12Z)-octadeca-9,12-dien-1-ylphosphonate, called NKS3, which decreased lipopolysaccharide (LPS)-induced mRNA upregulation of proinflammatory cytokines (IL-1ß, IL-6 and TNF-α) not only in primary intraperitoneal and lung alveolar macrophages, but also in freshly isolated mice lung slices. The in-silico studies suggested that NKS3, being CD36 agonist, will bind to GPR120. Co-immunoprecipitation and proximity ligation assays demonstrated that NKS3 induced protein-protein interaction of CD36 with GPR120in RAW 264.7 macrophage cell line. Furthermore, NKS3, via GPR120, decreased LPS-induced activation of TAB1/TAK1/JNK pathway and the LPS-induced mRNA expression of inflammatory markers in RAW 264.7 cells. In the acute lung injury model, NKS3 decreased lung fibrosis and inflammatory cytokines (IL-1ß, IL-6 and TNF-α) and nitric oxide (NO) production in broncho-alveolar lavage fluid. NKS3 exerted a protective effect on LPS-induced remodeling of kidney and liver, and reduced circulating IL-1ß, IL-6 and TNF-α concentrations. In a septic shock model, NKS3 gavage decreased significantly the LPS-induced mortality in mice. In the last, NKS3 decreased neuroinflammation in diet-induced obese mice. Altogether, these results suggest that NKS3 is a novel anti-inflammatory agent that could be used, in the future, for the treatment of inflammation-associated pathologies.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Circadian Gene Variants: Effects in Overweight and Obese Pregnant Women.

Obesity and overweight are common and complex conditions influenced by multiple genetic and environmental factors. Several genetic variants located in the genes involved in clock systems and fat taste perception can affect metabolic health. In particular, the polymorphisms in CLOCK and BMAL1 genes were reported to be significantly related to cardiovascular disease, metabolic syndrome, sleep reduction, and evening preference. Moreover, genetic variants in the CD36 gene have been shown to be involved in lipid metabolism, regulation of fat intake, and body weight regulation. The aim of this study is to evaluate, for the first time, the association between variants in some candidate genes (namely, BMAL1 rs7950226 (G>A), CLOCK rs1801260 (A>G), CLOCK rs4864548 (G>A), CLOCK rs3736544 (G>A), CD36 rs1984112 (A>G), CD36 rs1761667 (G>A)) and overweight/obesity (OB) in pregnant women. A total of 163 normal-weight (NW) and 128 OB participants were included. A significant correlation was observed between A-allele in CLOCK rs4864548 and an increased risk of obesity (OR: 1.97; 95% CI 1.22-3.10, p = 0.005). In addition, we found that subjects carrying the haplotype of rs1801260-A, rs4864548-A, and rs3736544-G are likely to be overweight or obese (OR 1.47, 95% CI 1.03-2.09, p = 0.030), compared with those with other haplotypes. Moreover, a significant relation was observed between third-trimester lipid parameters and genetic variants-namely, CD36 rs1984112, CD36 rs1761667, BMAL1 rs7950226, and CLOCK rs1801260. A multivariate logistic regression model revealed that CLOCK rs4864548 A-allele carriage was a strong risk factor for obesity (OR 2.05, 95% CI 1.07-3.93, p = 0.029); on the other hand, greater adherence to Mediterranean diet (OR 0.80, 95% CI 0.65-0.98, p = 0.038) and higher HDL levels (OR 0.96, 95% CI 0.94-0.99, p = 0.021) were related to a reduced risk of obesity. Interestingly, an association between maternal CLOCK rs4864548 and neonatal birthweight was detected (p = 0.025). These data suggest a potential role of the polymorphisms in clock systems and in fat taste perception in both susceptibility to overweight/obesity and influencing the related metabolic traits in pregnant women.

Membrane phospholipids activate the inflammatory response in macrophages by various mechanisms.

Exosomes, which are small membrane-encapsulated particles derived from all cell types, are emerging as important mechanisms for intercellular communication. In addition, exosomes are currently envisioned as potential carriers for the delivery of drugs to target tissues. The natural population of exosomes is very variable due to the limited amount of cargo components present in these small vesicles. Consequently, common components of exosomes may play a role in their function. We have proposed that membrane phospholipids could be a common denominator in the effect of exosomes on cellular functions. In this regard, we have previously shown that liposomes made of phosphatidylcholine (PC) or phosphatidylserine (PS) induced a robust alteration of macrophage (Mϕ) gene expression. We herewith report that these two phospholipids modulate gene expression in Mϕs by different mechanisms. PS alters cellular responses by the interaction with surface receptors, particularly CD36. In contrast, PC is captured by a receptor-independent process and likely triggers an activity within endocytic vesicles. Despite this difference in the capture mechanisms, both lipids mounted similar gene expression responses. This investigation suggests that multiple mechanisms mediated by membrane phospholipids could be participating in the alteration of cellular functions by exosomes.

Triphenyl phosphate interferes with the synthesis of steroid hormones through the PPARγ/CD36 pathway in human trophoblast JEG-3 cells.

Triphenyl phosphate (TPhP), a chemical commonly found in human placenta and breast milk, has been shown to disturb the endocrine system. Our previous study confirmed that TPhP could accumulate in the placenta and interference with placental lipid metabolism and steroid hormone synthesis, as well as induce endoplasmic reticulum (ER) stress through PPARγ in human placental trophoblast JEG-3 cells. However, the molecular mechanism underlying this disruption remains unknown. Our study aimed to identify the role of the PPARγ/CD36 pathway in TPhP-induced steroid hormone disruption. We found that TPhP increased lipid accumulation, total cholesterol, low- and high-density protein cholesterol, progesterone, estradiol, glucocorticoid, and aldosterone levels, and genes related to steroid hormones synthesis, including 3ßHSD1, 17ßHSD1, CYP11A, CYP19, and CYP21. These effects were largely blocked by co-exposure with either a PPARγ antagonist GW9662 or knockdown of CD36 using siRNA (siCD36). Furthermore, an ER stress inhibitor 4-PBA attenuated the effect of TPhP on progesterone and glucocorticoid levels, and siCD36 reduced ER stress-related protein levels induced by TPhP, including BiP, PERK, and CHOP. These findings suggest that ER stress may also play a role in the disruption of steroid hormone synthesis by TPhP. As our study has shed light on the PPARγ/CD36 pathway's involvement in the disturbance of steroid hormone biosynthesis by TPhP in the JEG-3 cells, further investigations of the potential impacts on the placental function and following birth outcome are warranted.

Proteomics study of bone tissue around ameloblastoma and the potential mechanism of CD36 in bone remodelling.

Ameloblastoma (AM) is characterised by local aggressiveness and bone resorption. To our knowledge, the proteomic profile of bone adjacent to AM has not previously been explored. We therefore looked at the differential proteins in cancellous bone (CB) adjacent to AM and normal CB from the mandible. CB proteins were extracted, purified, quantified, and analysed by liquid chromatography-mass spectrometry (LC-MS) using samples from five patients with AM. These proteins were further investigated using gene ontology for additional functional annotation and enrichment. Proteins that met the screening requirements of expression difference ploidy > 1.5-fold (upregulation and downregulation) and p < 0.05 were subsequently deemed differential proteins. Immunohistochemical staining was performed to confirm the above findings. Compared with normal mandibular CB, 151 differential proteins were identified in CB adjacent to the mandibular AM. These were mainly linked to cellular catabolic processes, lipid metabolism, and fatty acids (FA) metabolism. LC-MS and immunohistochemistry showed that CD36 was one of the notably decreased proteins in CB bordering the AM compared with normal mandibular CB (p = 0.0066 and p = 0.0095, respectively). CD36 expression in CB correlates with bone remodelling in AM, making CD36 a viable target for therapeutic approaches.

Interplay of CD36, autophagy, and lipid metabolism: insights into cancer progression.

CD36, a scavenger receptor B2 that is dynamically distributed between cell membranes and organelle membranes, plays a crucial role in regulating lipid metabolism. Abnormal CD36 activity has been linked to a range of metabolic disorders, such as obesity, nonalcoholic fatty liver disease, insulin resistance and cardiovascular disease. CD36 undergoes various modifications, including palmitoylation, glycosylation, and ubiquitination, which greatly affect its binding affinity to various ligands, thereby triggering and influencing various biological effects. In the context of tumors, CD36 interacts with autophagy to jointly regulate tumorigenesis, mainly by influencing the tumor microenvironment. The central role of CD36 in cellular lipid homeostasis and recent molecular insights into CD36 in tumor development indicate the applicability of CD36 as a therapeutic target for cancer treatment. Here, we discuss the diverse posttranslational modifications of CD36 and their respective roles in lipid metabolism. Additionally, we delve into recent research findings on CD36 in tumors, outlining ongoing drug development efforts targeting CD36 and potential strategies for future development and highlighting the interplay between CD36 and autophagy in the context of cancer. Our aim is to provide a comprehensive understanding of the function of CD36 in both physiological and pathological processes, facilitating a more in-depth analysis of cancer progression and a better development and application of CD36-targeting drugs for tumor therapy in the near future.

Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

BACKGROUND: Atherosclerosis (AS) is a persistent inflammatory condition triggered and exacerbated by several factors including lipid accumulation, endothelial dysfunction and macrophages infiltration. Nobiletin (NOB) has been reported to alleviate atherosclerosis; however, the underlying mechanism remains incompletely understood. METHODS: This study involved comprehensive bioinformatic analysis, including multidatabase target prediction; GO and KEGG enrichment analyses for function and pathway exploration; DeepSite and AutoDock for drug binding site prediction; and CIBERSORT for immune cell involvement. In addition, target intervention was verified via cell scratch assays, oil red O staining, ELISA, flow cytometry, qRT‒PCR and Western blotting. In addition, by establishing a mouse model of AS, it was demonstrated that NOB attenuated lipid accumulation and the extent of atherosclerotic lesions. RESULTS: (1) Altogether, 141 potentially targetable genes were identified through which NOB could intervene in atherosclerosis. (2) Lipid and atherosclerosis, fluid shear stress and atherosclerosis may be the dominant pathways and potential mechanisms. (3) ALB, AKT1, CASP3 and 7 other genes were identified as the top 10 target genes. (4) Six genes, including PPARG, MMP9, SRC and 3 other genes, were related to the M0 fraction. (5) CD36 and PPARG were upregulated in atherosclerosis samples compared to the normal control. (6) By inhibiting lipid uptake in RAW264.7 cells, NOB prevents the formation of foam cell. (7) In RAW264.7 cells, the inhibitory effect of oxidized low-density lipoprotein on foam cells formation and lipid accumulation was closely associated with the PPARG signaling pathway. (8) In vivo validation showed that NOB significantly attenuated intra-arterial lipid accumulation and macrophage infiltration and reduced CD36 expression. CONCLUSIONS: Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

Systemic loss of CD36 aggravates NAFLD-related HCC through MEK1/2-ERK1/2 signaling pathway.

BACKGROUND & AIMS: CD36, a membrane protein widely present in various tissues, is crucial role in regulating energy metabolism. The rise of HCC as a notable outcome of NAFLD is becoming more apparent. Patients with hereditary CD36 deficiency are at increased risk of NAFLD. However, the impact of CD36 deficiency on NAFLD-HCC remains unclear. METHODS: Global CD36 knockout mice (CD36KO) and wild type mice (WT) were induced to establish NAFLD-HCC model by N-nitrosodiethylamine (DEN) plus high fat diet (HFD). Transcriptomics was employed to examine genes that were expressed differentially. RESULTS: Compared to WT mice, CD36KO mice showed more severe HFD-induced liver issues and increased tumor malignancy. The MEK1/2-ERK1/2 pathway activation was detected in the liver tissues of CD36KO mice using RNA sequencing and Western blot analysis. CONCLUSION: Systemic loss of CD36 leaded to the advancement of NAFLD to HCC by causing lipid disorders and metabolic inflammation, a process that involves the activation of MAPK signaling pathway. We found that CD36 contributes significantly to the maintenance of metabolic homeostasis in NAFLD-HCC.

Computational Deciphering of the Role of S100A8 and S100A9 Proteins and Their Changes in the Structure Assembly Influences Their Interaction with TLR4, RAGE, and CD36.

S100A8 and S100A9 belong to the calcium-binding, damage associated molecular pattern (DAMP) proteins shown to aggravate the pathogenesis of rheumatoid arthritis (RA) through their interaction with the TLR4, RAGE and CD36 receptors. S100A8 and S100A9 proteins tend to exist in monomeric, homo and heterodimeric forms, which have been implicated in the pathogenesis of RA, via interacting with Pattern Recognition receptors (PRRs). The study aims to assess the influence of changes in the structure and biological assembly of S100A8 and S100A9 proteins as well as their interaction with significant receptors in RA through computational methods and surface plasmon resonance (SPR) analysis. Molecular docking analysis revealed that the S100A9 homodimer and S100A8/A9 heterodimer showed higher binding affinity towards the target receptors. Most S100 proteins showed good binding affinity towards TLR4 compared to other receptors. Based on the 50 ns MD simulations, TLR4, RAGE, and CD36 formed stable complexes with the monomeric and dimeric forms of S100A8 and S100A9 proteins. However, SPR analysis showed that the S100A8/A9 heterodimers formed stable complexes and exhibited high binding affinity towards the receptors. SPR data also indicated that TLR4 and its interactions with S100A8/A9 proteins may play a primary role in the pathogenesis of RA, with additional contributions from CD36 and RAGE interactions. Subsequent in vitro and in vivo investigations are warranted to corroborate the involvement of S100A8/A9 and the expression of TLR4, RAGE, and CD36 in the pathophysiology of RA.

Use of Callistemon citrinus as a gastroprotective and anti-inflammatory agent on indomethacin-induced gastric ulcers in obese rats.

Background: Obesity leads to an elevated risk of developing gastrointestinal disease such as gastric ulcers. Callistemon citrinus leaf extract has shown antioxidant, antimicrobial, hepatoprotective, and chemoprotective effects against colon cancer. The aim of this study is to evaluate the gastroprotective effect of C. citrinus leaf extract on indomethacin-induced gastric ulcers in obese rats. Methods: Gastric ulcers were induced in female obese Wistar rats using a single oral dose of indomethacin (IND). In the first stage, the rats were fed with a high fat sugar diet (HFSD) for 15 weeks to induce obesity and, at the same time, the diet of the other group of animals included daily administration of ethanolic C. citrinus leaf extract (250 mg/kg) in addition to HFSD. In the second stage, gastric ulcers were induced with IND (30 mg/kg). The gastroprotective activity of C. citrinus, the inflammatory enzyme activities, and cytokines in the stomach were determined. Results: C. citrinus produced a reduction of gastric lesions caused by IND. Myeloperoxidase (MPO), cyclooxygenase-2 (COX-2), and 5-lipoxygenase (5-LOX) activities also decreased. Although inflammatory biomarkers such as TNFα, IL-6, AOPP, and leptin were significantly decreased by C. citrinus, adiponectin levels increased. Moreover, C. citrinus decreased weight gain and morphological and biochemical parameters. Conclusion: The use of indomethacin in rats fed with a high fat-sugar diet increased gastric ulcers. Gastroprotective effect of C. citrinus in obese rats is attributed to the reduction of pro-inflammatory cytokines and the inflammatory enzymes.