CD36 deletion prevents white matter injury by modulating microglia polarization through the Traf5-MAPK signal pathway.

BACKGROUND: White matter injury (WMI) represents a significant etiological factor contributing to neurological impairment subsequent to Traumatic Brain Injury (TBI). CD36 receptors are recognized as pivotal participants in the pathogenesis of neurological disorders, including stroke and spinal cord injury. Furthermore, dynamic fluctuations in the phenotypic polarization of microglial cells have been intimately associated with the regenerative processes within the injured tissue following TBI. Nevertheless, there is a paucity of research addressing the impact of CD36 receptors on WMI and microglial polarization. This investigation aims to elucidate the functional role and mechanistic underpinnings of CD36 in modulating microglial polarization and WMI following TBI. METHODS: TBI models were induced in murine subjects via controlled cortical impact (CCI). The spatiotemporal patterns of CD36 expression were examined through quantitative polymerase chain reaction (qPCR), Western blot analysis, and immunofluorescence staining. The extent of white matter injury was assessed via transmission electron microscopy, Luxol Fast Blue (LFB) staining, and immunofluorescence staining. Transcriptome sequencing was employed to dissect the molecular mechanisms underlying CD36 down-regulation and its influence on white matter damage. Microglial polarization status was ascertained using qPCR, Western blot analysis, and immunofluorescence staining. In vitro, a Transwell co-culture system was employed to investigate the impact of CD36-dependent microglial polarization on oligodendrocytes subjected to oxygen-glucose deprivation (OGD). RESULTS: Western blot and qPCR analyses revealed that CD36 expression reached its zenith at 7 days post-TBI and remained sustained at this level thereafter. Immunofluorescence staining exhibited robust CD36 expression in astrocytes and microglia following TBI. Genetic deletion of CD36 ameliorated TBI-induced white matter injury, as evidenced by a reduced SMI-32/MBP ratio and G-ratio. Transcriptome sequencing unveiled differentially expressed genes enriched in processes linked to microglial activation, regulation of neuroinflammation, and the TNF signaling pathway. Additionally, bioinformatics analysis pinpointed the Traf5-p38 axis as a critical signaling pathway. In vivo and in vitro experiments indicated that inhibition of the CD36-Traf5-MAPK axis curtailed microglial polarization toward the pro-inflammatory phenotype. In a Transwell co-culture system, BV2 cells treated with LPS + IFN-γ exacerbated the damage of post-OGD oligodendrocytes, which could be rectified through CD36 knockdown in BV2 cells. CONCLUSIONS: This study illuminates that the suppression of CD36 mitigates WMI by constraining microglial polarization towards the pro-inflammatory phenotype through the down-regulation of the Traf5-MAPK signaling pathway. Our findings present a potential therapeutic strategy for averting neuroinflammatory responses and ensuing WMI damage resulting from TBI.

Unveiling the hidden role of the interaction between CD36 and FcγRIIb: implications for autoimmune disorders.

BACKGROUND: The role of the scavenger receptor CD36 in cell metabolism and the immune response has been investigated mainly in macrophages, dendritic cells, and T cells. However, its involvement in B cells has not been comprehensively examined. METHODS: To investigate the function of CD36 in B cells, we exposed Cd36fl/flMB1cre mice, which lack CD36 specifically in B cells, to apoptotic cells to trigger an autoimmune response. To validate the proteins that interact with CD36 in primary B cells, we conducted mass spectrometry analysis following anti-CD36 immunoprecipitation. Immunofluorescence and co-immunoprecipitation were used to confirm the protein interactions. RESULTS: The data revealed that mice lacking CD36 in B cells exhibited a reduction in germinal center B cells and anti-DNA antibodies in vivo. Mass spectrometry analysis identified 30 potential candidates that potentially interact with CD36. Furthermore, the interaction between CD36 and the inhibitory Fc receptor FcγRIIb was first discovered by mass spectrometry and confirmed through immunofluorescence and co-immunoprecipitation techniques. Finally, deletion of FcγRIIb in mice led to decreased expression of CD36 in marginal zone B cells, germinal center B cells, and plasma cells. CONCLUSIONS: Our data indicate that CD36 in B cells is a critical regulator of autoimmunity. The interaction of CD36-FcγRIIb has the potential to serve as a therapeutic target for the treatment of autoimmune disorders.

The CD36 scavenger receptor Bez regulates lipid redistribution from fat body to ovaries in Drosophila.

Lipid distribution in an organism is mediated by the interplay between lipoprotein particles, lipoprotein receptors and class B scavenger receptors of the CD36 family. CD36 is a multifunctional protein mediating lipid uptake, mobilization and signaling at the plasma membrane and inside of the cell. The CD36 protein family has 14 members in Drosophila melanogaster, which allows for the differentiated analysis of their functions. Here, we unravel a role for the so far uncharacterized scavenger receptor Bez in lipid export from Drosophila adipocytes. Bez shares the lipid binding residue with CD36 and is expressed at the plasma membrane of the embryonic, larval and adult fat body. Bez loss of function lowers the organismal availability of storage lipids and blocks the maturation of egg chambers in ovaries. We demonstrate that Bez interacts with the APOB homolog Lipophorin at the plasma membrane of adipocytes and trace the Bez-dependent transfer of an alkyne-labeled fatty acid from adipocytes to Lipophorin. Our study demonstrates how lipids are distributed by scavenger receptor-lipoprotein interplay and contribute to the metabolic control of development.

Whole-body deletion of Endospanin 1 protects from obesity-associated deleterious metabolic alterations.

The importance of the proper localization of most receptors at the cell surface is often underestimated, although this feature is essential for optimal receptor response. Endospanin 1 (Endo1) (also known as OBRGRP or LEPROT) is a protein generated from the same gene as the human leptin receptor and regulates the trafficking of proteins to the surface, including the leptin receptor. The systemic role of Endo1 on whole-body metabolism has not been studied so far. Here, we report that general Endo1-KO mice fed a high-fat diet develop metabolically healthy obesity with lipid repartitioning in organs and preferential accumulation of fat in adipose tissue, limited systematic inflammation, and better controlled glucose homeostasis. Mechanistically, Endo1 interacts with the lipid translocase CD36, thus regulating its surface abundance and lipid uptake in adipocytes. In humans, the level of Endo1 transcripts is increased in the adipose tissue of patients with obesity, but low levels rather correlate with a profile of metabolically healthy obesity. We suggest here that Endo1, most likely by controlling CD36 cell surface abundance and lipid uptake in adipocytes, dissociates obesity from diabetes and that its absence participates in metabolically healthy obesity.

A novel fatty acid analogue triggers CD36-GPR120 interaction and exerts anti-inflammatory action in endotoxemia.

Inflammation is a mediator of a number of chronic pathologies. We synthesized the diethyl (9Z,12Z)-octadeca-9,12-dien-1-ylphosphonate, called NKS3, which decreased lipopolysaccharide (LPS)-induced mRNA upregulation of proinflammatory cytokines (IL-1ß, IL-6 and TNF-α) not only in primary intraperitoneal and lung alveolar macrophages, but also in freshly isolated mice lung slices. The in-silico studies suggested that NKS3, being CD36 agonist, will bind to GPR120. Co-immunoprecipitation and proximity ligation assays demonstrated that NKS3 induced protein-protein interaction of CD36 with GPR120in RAW 264.7 macrophage cell line. Furthermore, NKS3, via GPR120, decreased LPS-induced activation of TAB1/TAK1/JNK pathway and the LPS-induced mRNA expression of inflammatory markers in RAW 264.7 cells. In the acute lung injury model, NKS3 decreased lung fibrosis and inflammatory cytokines (IL-1ß, IL-6 and TNF-α) and nitric oxide (NO) production in broncho-alveolar lavage fluid. NKS3 exerted a protective effect on LPS-induced remodeling of kidney and liver, and reduced circulating IL-1ß, IL-6 and TNF-α concentrations. In a septic shock model, NKS3 gavage decreased significantly the LPS-induced mortality in mice. In the last, NKS3 decreased neuroinflammation in diet-induced obese mice. Altogether, these results suggest that NKS3 is a novel anti-inflammatory agent that could be used, in the future, for the treatment of inflammation-associated pathologies.

Membrane phospholipids activate the inflammatory response in macrophages by various mechanisms.

Exosomes, which are small membrane-encapsulated particles derived from all cell types, are emerging as important mechanisms for intercellular communication. In addition, exosomes are currently envisioned as potential carriers for the delivery of drugs to target tissues. The natural population of exosomes is very variable due to the limited amount of cargo components present in these small vesicles. Consequently, common components of exosomes may play a role in their function. We have proposed that membrane phospholipids could be a common denominator in the effect of exosomes on cellular functions. In this regard, we have previously shown that liposomes made of phosphatidylcholine (PC) or phosphatidylserine (PS) induced a robust alteration of macrophage (Mϕ) gene expression. We herewith report that these two phospholipids modulate gene expression in Mϕs by different mechanisms. PS alters cellular responses by the interaction with surface receptors, particularly CD36. In contrast, PC is captured by a receptor-independent process and likely triggers an activity within endocytic vesicles. Despite this difference in the capture mechanisms, both lipids mounted similar gene expression responses. This investigation suggests that multiple mechanisms mediated by membrane phospholipids could be participating in the alteration of cellular functions by exosomes.

Genotypic and Allelic Distribution of the CD36 rs1761667 Polymorphism in High-Level Moroccan Athletes: A Pilot Study.

Previous studies have shown that variations in the CD36 gene may affect phenotypes associated with fat metabolism as the CD36 protein facilitates the transport of fatty acids to the mitochondria for oxidation. However, no previous study has tested whether variations in the CD36 gene are associated with sports performance. We investigated the genotypic and allelic distribution of the single-nucleotide polymorphism (SNP) rs1761667 in the CD36 gene in elite Moroccan athletes (cyclists and hockey players) in comparison with healthy non-athletes of the same ethnic origin. Forty-three Moroccan elite male athletes (nineteen cyclists and twenty-four field hockey players) belonging to the national teams of their respective sports (athlete group) were compared to twenty-eight healthy, active, male university students (control group). Genotyping of the CD36 rs1761667 (G>A) SNP was performed via polymerase chain reaction (PCR) and Sanger sequencing. A chi-square (χ2) test was used to assess the Hardy-Weinberg equilibrium (HWE) and to compare allele and genotype frequencies in the "athlete" and "control" groups. The genotypic distribution of the CD36 rs1761667 polymorphism was similar in elite athletes (AA: 23.81, AG: 59.52, and GG: 16.67%) and controls (AA: 19.23, AG: 69.23, and GG: 11.54%; χ2 = 0.67, p = 0.71). However, the genotypic distribution of the CD36 rs1761667 polymorphism was different between cyclists (AA: 0.00, AG: 72.22, and GG: 27.78%) and hockey players (AA: 41.67, AG: 50.00, and GG: 8.33%; χ2 = 10.69, p = 0.004). Specifically, the frequency of the AA genotype was significantly lower in cyclists than in hockey players (p = 0.02). In terms of allele frequency, a significant difference was found between cyclists versus field hockey players (χ2 = 7.72, p = 0.005). Additionally, there was a predominance of the recessive model in cyclists over field hockey players (OR: 0.00, 95% CI: 0.00-0.35, p = 0.002). Our study shows a significant difference between cyclists and field hockey players in terms of the genotypic and allelic frequency of the SNP rs1761667 of the CD36 gene. This divergence suggests a probable association between genetic variations in the CD36 gene and the type of sport in elite Moroccan athletes.

Conjugated linoleic acid (CLA) reduces intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

The anti-obesity effect of conjugated linoleic acid (CLA) has been well elucidated, but whether CLA affects fat deposition by regulating intestinal dietary fat absorption remains largely unknown. Thus, this study aimed to investigate the effects of CLA on intestinal fatty acid uptake and chylomicron formation and explore the possible underlying mechanisms. We found that CLA supplementation reduced the intestinal fat absorption in HFD (high fat diet)-fed mice accompanied by the decreased serum TG level, increased fecal lipids and decreased intestinal expression of ApoB48 and MTTP. Correspondingly, c9, t11-CLA, but not t10, c12-CLA induced the reduction of fatty acid uptake and TG content in PA (palmitic acid)-treated MODE-K cells. In the mechanism of fatty acid uptake, c9, t11-CLA inhibited the binding of CD36 with palmitoyltransferase DHHC7, thus leading to the decreases of CD36 palmitoylation level and localization on the cell membrane of the PA-treated MODE-K cells. In the mechanism of chylomicron formation, c9, t11-CLA inhibited the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the PA-treated MODE-K cells. In in vivo verification, CLA supplementation reduced the DHHC7-mediated total and cell membrane CD36 palmitoylation and suppressed the formation of the CD36/FYN/LYN complex and the activation of the ERK pathway in the jejunum of HFD-fed mice. Altogether, these data showed that CLA reduced intestinal fatty acid uptake and chylomicron formation in HFD-fed mice associated with the inhibition of DHHC7-mediated CD36 palmitoylation and the downstream ERK pathway.

Sesamin ameliorates nonalcoholic hepatic steatosis by inhibiting CD36-mediated hepatocyte lipid accumulation in vitro and in vivo.

Hepatic steatosis is a critical factor in the development of nonalcoholic steatohepatitis (NASH). Sesamin (Ses), a functional lignan isolated from Sesamum indicum, possesses hypolipidemic, liver-protective, anti-hypertensive, and anti-tumor properties. Ses has been found to improve hepatic steatosis, but the exact mechanisms through which Ses achieves this are not well understood. In this study, we observed the anti-hepatic steatosis effects of Ses in palmitate/oleate (PA/OA)-incubated primary mouse hepatocytes, AML12 hepatocytes, and HepG2 cells, as well as in high-fat, high-cholesterol diet-induced NASH mice. RNA sequencing analysis revealed that cluster of differentiation 36 (CD36), a free fatty acid (FA) transport protein, was involved in the Ses-mediated inhibition of hepatic fat accumulation. Moreover, the overexpression of CD36 significantly increased hepatic steatosis in both Ses-treated PA/OA-incubated HepG2 cells and NASH mice. Furthermore, Ses treatment suppressed insulin-induced de novo lipogenesis in HepG2 cells, which was reversed by CD36 overexpression. Mechanistically, we found that Ses ameliorated NASH by inhibiting CD36-mediated FA uptake and upregulation of lipogenic genes, including FA synthase, stearoyl-CoA desaturase 1, and sterol regulatory element-binding protein 1. The findings of our study provide novel insights into the potential therapeutic applications of Ses in the treatment of NASH.

Visceral adipose of obese mice inhibits endothelial inwardly rectifying K+ channels in a CD36-dependent fashion.

Obesity imposes deficits on adipose tissue and vascular endothelium, yet the role that distinct adipose depots play in mediating endothelial dysfunction in local arteries remains unresolved. We recently showed that obesity impairs endothelial Kir2.1 channels, mediators of nitric oxide production, in arteries of visceral adipose tissue (VAT), while Kir2.1 function in subcutaneous adipose tissue (SAT) endothelium remains intact. Therefore, we determined if VAT versus SAT from lean or diet-induced obese mice affected Kir2.1 channel function in vitro. We found that VAT from obese mice reduces Kir2.1 function without altering channel expression whereas AT from lean mice and SAT from obese mice had no effect on Kir2.1 function as compared to untreated control cells. As Kir2.1 is well known to be inhibited by fatty acid derivatives and obesity is strongly associated with elevated circulating fatty acids, we next tested the role of the fatty acid translocase CD36 in mediating VAT-induced Kir2.1 dysfunction. We found that the downregulation of CD36 restored Kir2.1 currents in endothelial cells exposed to VAT from obese mice. In addition, endothelial cells exposed to VAT from obese mice exhibited a significant increase in CD36-mediated fatty acid uptake. The importance of CD36 in obesity-induced endothelial dysfunction of VAT arteries was further supported in ex vivo pressure myography studies where CD36 ablation rescued the endothelium-dependent response to flow via restoring Kir2.1 and endothelial nitric oxide synthase function. These findings provide new insight into the role of VAT in mediating obesity-induced endothelial dysfunction and suggest a novel role for CD36 as a mediator of endothelial Kir2.1 impairment.NEW & NOTEWORTHY Our findings suggest a role for visceral adipose tissue (VAT) in the dysfunction of endothelial Kir2.1 in obesity. We further reveal a role for CD36 as a major contributor to VAT-mediated Kir2.1 and endothelial dysfunction, suggesting that CD36 offers a potential target for preventing the early development of obesity-associated cardiovascular disease.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Circadian Gene Variants: Effects in Overweight and Obese Pregnant Women.

Obesity and overweight are common and complex conditions influenced by multiple genetic and environmental factors. Several genetic variants located in the genes involved in clock systems and fat taste perception can affect metabolic health. In particular, the polymorphisms in CLOCK and BMAL1 genes were reported to be significantly related to cardiovascular disease, metabolic syndrome, sleep reduction, and evening preference. Moreover, genetic variants in the CD36 gene have been shown to be involved in lipid metabolism, regulation of fat intake, and body weight regulation. The aim of this study is to evaluate, for the first time, the association between variants in some candidate genes (namely, BMAL1 rs7950226 (G>A), CLOCK rs1801260 (A>G), CLOCK rs4864548 (G>A), CLOCK rs3736544 (G>A), CD36 rs1984112 (A>G), CD36 rs1761667 (G>A)) and overweight/obesity (OB) in pregnant women. A total of 163 normal-weight (NW) and 128 OB participants were included. A significant correlation was observed between A-allele in CLOCK rs4864548 and an increased risk of obesity (OR: 1.97; 95% CI 1.22-3.10, p = 0.005). In addition, we found that subjects carrying the haplotype of rs1801260-A, rs4864548-A, and rs3736544-G are likely to be overweight or obese (OR 1.47, 95% CI 1.03-2.09, p = 0.030), compared with those with other haplotypes. Moreover, a significant relation was observed between third-trimester lipid parameters and genetic variants-namely, CD36 rs1984112, CD36 rs1761667, BMAL1 rs7950226, and CLOCK rs1801260. A multivariate logistic regression model revealed that CLOCK rs4864548 A-allele carriage was a strong risk factor for obesity (OR 2.05, 95% CI 1.07-3.93, p = 0.029); on the other hand, greater adherence to Mediterranean diet (OR 0.80, 95% CI 0.65-0.98, p = 0.038) and higher HDL levels (OR 0.96, 95% CI 0.94-0.99, p = 0.021) were related to a reduced risk of obesity. Interestingly, an association between maternal CLOCK rs4864548 and neonatal birthweight was detected (p = 0.025). These data suggest a potential role of the polymorphisms in clock systems and in fat taste perception in both susceptibility to overweight/obesity and influencing the related metabolic traits in pregnant women.

Systemic loss of CD36 aggravates NAFLD-related HCC through MEK1/2-ERK1/2 signaling pathway.

BACKGROUND & AIMS: CD36, a membrane protein widely present in various tissues, is crucial role in regulating energy metabolism. The rise of HCC as a notable outcome of NAFLD is becoming more apparent. Patients with hereditary CD36 deficiency are at increased risk of NAFLD. However, the impact of CD36 deficiency on NAFLD-HCC remains unclear. METHODS: Global CD36 knockout mice (CD36KO) and wild type mice (WT) were induced to establish NAFLD-HCC model by N-nitrosodiethylamine (DEN) plus high fat diet (HFD). Transcriptomics was employed to examine genes that were expressed differentially. RESULTS: Compared to WT mice, CD36KO mice showed more severe HFD-induced liver issues and increased tumor malignancy. The MEK1/2-ERK1/2 pathway activation was detected in the liver tissues of CD36KO mice using RNA sequencing and Western blot analysis. CONCLUSION: Systemic loss of CD36 leaded to the advancement of NAFLD to HCC by causing lipid disorders and metabolic inflammation, a process that involves the activation of MAPK signaling pathway. We found that CD36 contributes significantly to the maintenance of metabolic homeostasis in NAFLD-HCC.

Computational Deciphering of the Role of S100A8 and S100A9 Proteins and Their Changes in the Structure Assembly Influences Their Interaction with TLR4, RAGE, and CD36.

S100A8 and S100A9 belong to the calcium-binding, damage associated molecular pattern (DAMP) proteins shown to aggravate the pathogenesis of rheumatoid arthritis (RA) through their interaction with the TLR4, RAGE and CD36 receptors. S100A8 and S100A9 proteins tend to exist in monomeric, homo and heterodimeric forms, which have been implicated in the pathogenesis of RA, via interacting with Pattern Recognition receptors (PRRs). The study aims to assess the influence of changes in the structure and biological assembly of S100A8 and S100A9 proteins as well as their interaction with significant receptors in RA through computational methods and surface plasmon resonance (SPR) analysis. Molecular docking analysis revealed that the S100A9 homodimer and S100A8/A9 heterodimer showed higher binding affinity towards the target receptors. Most S100 proteins showed good binding affinity towards TLR4 compared to other receptors. Based on the 50 ns MD simulations, TLR4, RAGE, and CD36 formed stable complexes with the monomeric and dimeric forms of S100A8 and S100A9 proteins. However, SPR analysis showed that the S100A8/A9 heterodimers formed stable complexes and exhibited high binding affinity towards the receptors. SPR data also indicated that TLR4 and its interactions with S100A8/A9 proteins may play a primary role in the pathogenesis of RA, with additional contributions from CD36 and RAGE interactions. Subsequent in vitro and in vivo investigations are warranted to corroborate the involvement of S100A8/A9 and the expression of TLR4, RAGE, and CD36 in the pathophysiology of RA.

Triphenyl phosphate interferes with the synthesis of steroid hormones through the PPARγ/CD36 pathway in human trophoblast JEG-3 cells.

Triphenyl phosphate (TPhP), a chemical commonly found in human placenta and breast milk, has been shown to disturb the endocrine system. Our previous study confirmed that TPhP could accumulate in the placenta and interference with placental lipid metabolism and steroid hormone synthesis, as well as induce endoplasmic reticulum (ER) stress through PPARγ in human placental trophoblast JEG-3 cells. However, the molecular mechanism underlying this disruption remains unknown. Our study aimed to identify the role of the PPARγ/CD36 pathway in TPhP-induced steroid hormone disruption. We found that TPhP increased lipid accumulation, total cholesterol, low- and high-density protein cholesterol, progesterone, estradiol, glucocorticoid, and aldosterone levels, and genes related to steroid hormones synthesis, including 3ßHSD1, 17ßHSD1, CYP11A, CYP19, and CYP21. These effects were largely blocked by co-exposure with either a PPARγ antagonist GW9662 or knockdown of CD36 using siRNA (siCD36). Furthermore, an ER stress inhibitor 4-PBA attenuated the effect of TPhP on progesterone and glucocorticoid levels, and siCD36 reduced ER stress-related protein levels induced by TPhP, including BiP, PERK, and CHOP. These findings suggest that ER stress may also play a role in the disruption of steroid hormone synthesis by TPhP. As our study has shed light on the PPARγ/CD36 pathway's involvement in the disturbance of steroid hormone biosynthesis by TPhP in the JEG-3 cells, further investigations of the potential impacts on the placental function and following birth outcome are warranted.

Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

BACKGROUND: Atherosclerosis (AS) is a persistent inflammatory condition triggered and exacerbated by several factors including lipid accumulation, endothelial dysfunction and macrophages infiltration. Nobiletin (NOB) has been reported to alleviate atherosclerosis; however, the underlying mechanism remains incompletely understood. METHODS: This study involved comprehensive bioinformatic analysis, including multidatabase target prediction; GO and KEGG enrichment analyses for function and pathway exploration; DeepSite and AutoDock for drug binding site prediction; and CIBERSORT for immune cell involvement. In addition, target intervention was verified via cell scratch assays, oil red O staining, ELISA, flow cytometry, qRT‒PCR and Western blotting. In addition, by establishing a mouse model of AS, it was demonstrated that NOB attenuated lipid accumulation and the extent of atherosclerotic lesions. RESULTS: (1) Altogether, 141 potentially targetable genes were identified through which NOB could intervene in atherosclerosis. (2) Lipid and atherosclerosis, fluid shear stress and atherosclerosis may be the dominant pathways and potential mechanisms. (3) ALB, AKT1, CASP3 and 7 other genes were identified as the top 10 target genes. (4) Six genes, including PPARG, MMP9, SRC and 3 other genes, were related to the M0 fraction. (5) CD36 and PPARG were upregulated in atherosclerosis samples compared to the normal control. (6) By inhibiting lipid uptake in RAW264.7 cells, NOB prevents the formation of foam cell. (7) In RAW264.7 cells, the inhibitory effect of oxidized low-density lipoprotein on foam cells formation and lipid accumulation was closely associated with the PPARG signaling pathway. (8) In vivo validation showed that NOB significantly attenuated intra-arterial lipid accumulation and macrophage infiltration and reduced CD36 expression. CONCLUSIONS: Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.

CD36 inhibition reduces non-small-cell lung cancer development through AKT-mTOR pathway.

Lung cancer is the most common cause of cancer-related deaths worldwide and is caused by multiple factors, including high-fat diet (HFD). CD36, a fatty acid receptor, is closely associated with metabolism-related diseases, including cardiovascular disease and cancer. However, the role of CD36 in HFD-accelerated non-small-cell lung cancer (NSCLC) is unclear. In vivo, we fed C57BL/6J wild-type (WT) and CD36 knockout (CD36-/-) mice normal chow or HFD in the presence or absence of pitavastatin 2 weeks before subcutaneous injection of LLC1 cells. In vitro, A549 and NCI-H520 cells were treated with free fatty acids (FFAs) to mimic HFD situation for exploration the underlying mechanisms. We found that HFD promoted LLC1 tumor growth in vivo and that FFAs increased cell proliferation and migration in A549 and NCI-H520 cells. The enhanced cell or tumor growth was inhibited by the lipid-lowering agent pitavastatin, which reduced lipid accumulation. More importantly, we found that plasma soluble CD36 (sCD36) levels were higher in NSCLC patients than those in healthy ones. Compared to that in WT mice, the proliferation of LLC1 cells in CD36-/- mice was largely suppressed, which was further repressed by pitavastatin in HFD group. At the molecular level, we found that CD36 inhibition, either with pitavastatin or plasmid, reduced proliferation- and migration-related protein expression through the AKT/mTOR pathway. Taken together, we demonstrate that inhibition of CD36 expression by pitavastatin or other inhibitors may be a viable strategy for NSCLC treatment.

Microcystin-RR promote lipid accumulation through CD36 mediated signal pathway and fatty acid uptake in HepG2 cells.

Microcystins (MC)-RR is a significant analogue of MC-LR, which has been identified as a hepatotoxin capable of influencing lipid metabolism and promoting the progression of liver-related metabolic diseases. However, the toxicity and biological function of MC-RR are still not well understood. In this study, the toxic effects and its role in lipid metabolism of MC-RR were investigated in hepatoblastoma cells (HepG2cells). The results demonstrated that MC-RR dose-dependently reduced cell viability and induced apoptosis. Additionally, even at low concentrations, MC-RR promoted lipid accumulation through up-regulating levels of triglyceride, total cholesterol, phosphatidylcholines and phosphatidylethaolamine in HepG2 cells, with no impact on cell viability. Proteomics and transcriptomics analysis further revealed significant alterations in the protein and gene expression profiles in HepG2 cells treated with MC-RR. Bioinformatic analysis, along with subsequent validation, indicated the upregulation of CD36 and activation of the AMPK and PI3K/AKT/mTOR in response to MC-RR exposure. Finally, knockdown of CD36 markedly ameliorated MC-RR-induced lipid accumulation in HepG2 cells. These findings collectively suggest that MC-RR promotes lipid accumulation in HepG2 cells through CD36-mediated signal pathway and fatty acid uptake. Our findings provide new insights into the hepatotoxic mechanism of MC-RR.

Evidence that CD36 is expressed on red blood cells and constitutes a novel blood group system of clinical importance.

BACKGROUND AND OBJECTIVES: Polymorphic molecules expressed on the surface of certain blood cells are traditionally categorized as blood groups and human platelet or neutrophil antigens. CD36 is widely considered a platelet antigen (Naka) and anti-CD36 can cause foetal/neonatal alloimmune thrombocytopenia (FNAIT) in CD36-negative pregnant women. CD36 is used as a marker of differentiation in early erythroid culture. During the experimental culture of CD34+ cells from random blood donors, we observed that one individual lacked CD36. We sought to investigate this observation further and determine if CD36 fulfils the International Society of Blood Transfusion criteria for becoming a blood group. MATERIALS AND METHODS: Surface markers were monitored by flow cytometry on developing cells during the erythroid culture of CD34+ cells. Genetic and flow cytometric analyses on peripheral blood cells were performed. Proteomic datasets were analysed, and clinical case reports involving anti-CD36 and foetal anaemia were scrutinized. RESULTS: Sequencing of CD36-cDNA identified homozygosity for c.1133G>T/p.Gly378Val in the CD36-negative donor. The minor allele frequency of rs146027667:T is 0.1% globally and results in abolished CD36 expression. CD36 has been considered absent from mature red blood cells (RBCs); however, we detected CD36 expression on RBCs and reticulocytes from 20 blood donors. By mining reticulocyte and RBC datasets, we found evidence for CD36-derived peptides enriched in the membrane fractions. Finally, our literature review revealed severe cases of foetal anaemia attributed to anti-CD36. CONCLUSIONS: Based on these findings, we conclude that CD36 fulfils the criteria for becoming a new blood group system and that anti-CD36 is implicated not only in FNAIT but also foetal anaemia.

Effects of Lizhong Tongmai acupuncture on TMAO, CD36 expression, and cholesterol deposition in atherosclerotic mice. / "理中通脉"æ³•é’ˆåˆºå¯¹åŠ¨è„‰ç²¥æ ·ç¡¬åŒ–å°é¼ TMAO、CD36表达及胆固醇沉积的影响.

OBJECTIVES: To observe the effects of Lizhong Tongmai acupuncture (acupuncture for regulating middle jiao and promoting meridians) on trimethylamine-N-oxide (TMAO), CD36 expression, and cholesterol deposition in atherosclerotic (AS) mice, exploring potential mechanism of electroacupuncture (EA) in treating AS. METHODS: A total of 31 male SPF-grade C57BL/6J ApoE-/- mice were fed with high-fat diet for 8 weeks to establish AS model. After successful modeling, the remaining 30 mice were randomly divided into a model group, a medication group, and an EA group, with 10 mice in each group. An additional 10 normal mice of the same strain were selected as a blank group. The mice in the blank group and the model group received no intervention. The mice in the medication group were treated with intragastric administration of atorvastatin calcium. The mice in the EA group were treated with EA at "Neiguan" (PC 6), "Tianshu" (ST 25) and "Zusanli" (ST 36). The same-side "Neiguan" (PC 6) and "Zusanli" (ST 36), "Tianshu" (ST 25) and the tail of the mice were connected to the EA apparatus, with disperse-dense wave, a frequency of 2 Hz/15 Hz, and a current intensity of 0.3 mA for 10 min per session. Acupuncture was performed unilaterally per session, alternating between the left and right sides, with a frequency of once every other day. After intervention, HE staining was used to observe the pathological morphology of the aorta. Microplate assays were conducted to measure triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels in serum. Ultra high performance liquid chromatography-mass spectrometry technique (UPLC-MS) was employed to detect TMAO level in plasma. Western blot was performed to assess CD36 protein expression level in the aorta. Microanalysis was used to measure cholesterol ester (CE) level in the aorta and the CE/TC ratio was calculated. RESULTS: Compared with the blank group, the mice in the model group exhibited significant pathological changes of atherosclerosis, serum TG, TC, LDL-C levels were increased (P<0.01), and HDL-C level was decreased (P<0.01); the plasma TMAO level, aortic CE level, and the CE/TC ratio were increased (P<0.01), along with elevated CD36 protein expression level in the aorta (P<0.01). Compared with the model group, the mice in the medication group and the EA group showed improvements in aortic pathology, serum TG, TC, LDL-C levels were reduced, HDL-C levels were increased (P<0.05); plasma TMAO levels, aortic CE levels, and the CE/TC ratio were decreased (P<0.01), and CD36 protein expression levels were lowered (P<0.05). The serum TG and TC levels in the EA group were higher than those in the medication group (P<0.05). CONCLUSIONS: The Lizhong Tongmai acupuncture can ameliorate aortic pathological changes, regulate blood lipid levels, reduce plasma TMAO level, inhibit CD36 protein expression in the aorta, and decrease cholesterol deposition. These effects may contribute to the therapeutic mechanism of EA in treating AS.