Interference of gastrointestinal barriers with antibiotic susceptibility of foodborne pathogens: an in vitro case study of ciprofloxacin and tetracycline against Salmonella enterica and Listeria monocytogenes.

Minimum inhibitory concentrations (MIC) assays are often questioned for their representativeness. Especially when foodborne pathogens are tested, it is of crucial importance to also consider parameters of the human digestive system. Hence, the current study aimed to assess the inhibitory capacity of two antibiotics, ciprofloxacin and tetracycline, against Salmonella enterica and Listeria monocytogenes, under representative environmental conditions. More specifically, aspects of the harsh environment of the human gastrointestinal tract (GIT) were gradually added to the experimental conditions starting from simple aerobic lab conditions into an in vitro simulation of the GIT. In this way, the effects of parameters including the anoxic environment, physicochemical conditions of the GIT (low gastric pH, digestive enzymes, bile acids) and the gut microbiota were evaluated. The latter was simulated by including a representative consortium of selected gut bacteria species. In this study, the MIC of the two antibiotics against the relevant foodborne pathogens were established, under the previously mentioned environmental conditions. The results of S. enterica highlighted the importance of the anaerobic environment when conducting such studies, since the pathogen thrived under such conditions. Inclusion of physicochemical barriers led to exactly opposite results for S. enterica and L. monocytogenes since the former became more susceptible to ciprofloxacin while the latter showed lower susceptibility towards tetracycline. Finally, the inclusion of gut bacteria had a bactericidal effect against L. monocytogenes even in the absence of antibiotics, while gut bacteria protected S. enterica from the effect of ciprofloxacin.

Enhanced removal of ciprofloxacin and associated antibiotic-resistant genes from wastewater using a biological aeration filters in combination with Fe3O4-modified zeolite.

Antibiotics release into the water environment through sewage discharge is a significant environmental concern. In the present study, we investigated the removal of ciprofloxacin (CIP) in simulated sewage by biological aeration filter (BAF) equipped with Fe3O4-modified zeolite (Fe3O4@ZF). Fe3O4@ZF were prepared with impregnation method, and the Fe3O4 particles were successfully deposited on the surface of ZF in an amorphous form according to the results of XPS and XRD analysis. The modification also increased the specific surface area (from 16.22 m²/g to 22 m²/g) and pore volume (from 0.0047 cm³/g to 0.0063 cm³/g), improving the adsorption efficiency of antibiotics. Fe3O4 modified ZF improved the treatment performance significantly, and the removal efficiency of CIP in BAF-Fe3O4@ZF was 79%±2.4%. At 10ml/L CIP, the BAF-Fe3O4@ZF reduced the relative abundances of antibiotics resistance genes (ARGs) int, mexA, qnrB and qnrS in the effluent by 57.16%, 39.59%, 60.22%, and 20.25%, respectively, which effectively mitigate the dissemination risk of ARGs. The modification of ZF increased CIP-degrading bacteria abundance, such as Rhizobium and Deinococcus-Thermus, and doubled bacterial ATP activity, promoting CIP degradation. This study offers a viable, efficient method to enhance antibiotic treatment and prevent leakage via sewage discharge.

Increased tolerance to commonly used antibiotics in a Pseudomonas aeruginosa ex vivo porcine keratitis model.

Introduction. Bacterial keratitis, particularly caused by Pseudomonas aeruginosa, is challenging to treat because of multi-drug tolerance, often associated with the formation of biofilms. Antibiotics in development are typically evaluated against planktonic bacteria in a culture medium, which may not accurately represent the complexity of infections in vivo.Hypothesis/Gap Statement. Developing a reliable, economic ex vivo keratitis model that replicates some complexity of tissue infections could facilitate a deeper understanding of antibiotic efficacy, thus aiding in the optimization of treatment strategies for bacterial keratitis.Methodology. Here we investigated the efficacy of three commonly used antibiotics (gentamicin, ciprofloxacin and meropenem) against Pseudomonas aeruginosa cytotoxic strain PA14 and invasive strain PA01 using an ex vivo porcine keratitis model.Results. Both strains of P. aeruginosa were susceptible to the MIC of the three tested antibiotics. However, significantly higher concentrations were necessary to inhibit bacterial growth in the minimum biofilm eradication concentration (MBEC) assay, with both strains tolerating concentrations greater than 512 mg l-1 of meropenem. When MIC and higher concentrations than MBEC (1024 mg l-1) of antibiotics were applied, ciprofloxacin exhibited the highest potency against both P. aeruginosa strains, followed by meropenem, while gentamicin showed the least potency. Despite this, none of the antibiotic concentrations used effectively cleared the infection, even after 18 h of continuous exposure.Conclusions. Further exploration of antibiotic concentrations and aligning dosing with clinical studies to validate the model is needed. Nonetheless, our ex vivo porcine keratitis model could be a valuable tool for assessing antibiotic efficacy.

Biochar-derived dissolved organic matter enhanced the release of residual ciprofloxacin from the soil solid phase.

Biochar has been utilized to reduce ciprofloxacin (CIP) residues in soil. However, little is known about the effect of biochar-derived dissolved organic matter (DOM) on residual CIP transformation. Thus, we analyzed the residual soil CIP as influenced by biochar generated from rice straw (RS3 and RS6), pig manure (PM3 and PM6), and cockroach shell (CS3 and CS6) at 300 °C and 600 °C. The three-dimensional excitation-emission matrix (3D-EEM), parallel factor analysis (PARAFAC) and two-dimensional correlation spectral analysis (2D-COS) were used to describe the potential variation in the DOM-CIP interaction. Compared with CK, biochar amendment increased the water-soluble CIP content by 160.7% (RS3), 55.2% (RS6), 534.1% (PM3), 277.5% (PM6), 1160.6% (CS3) and 703.9% (CS6), indicating that the biochar feedstock controlled the soil CIP release. The content of water-soluble CIP was positively correlated with the content of dissolved organic carbon (r = 0.922, p < 0.01) and dissolved organic nitrogen (r = 0.898, p < 0.01), suggesting that the major influence of the water-soluble CIP increase was DOM. The fluorescence quenching experiment showed that the interaction between DOM and CIP triggered static quenching and the creation of a DOM complex. The mean log K of protein-like material (4.977) was higher than that of terrestrial humus-like material (3.491), suggesting that the protein-like material complexed CIP was more stable than the humus-like material. Compared with pyrolysis at 300 °C, pyrolysis at 600 °C decreased the stability of the complex of protein-like material and CIP by 0.44 (RS), 1.689 (PM) and 0.548 (CS). This result suggested that the influence of temperature change was more profound on PM biochar-derived DOM than on RS and CS. These insights are essential for understanding CIP transportation in soil and controlling CIP contamination with biochar.

Transcriptomic and proteomic analysis of the virulence inducing effect of ciprofloxacin on enterohemorrhagic Escherichia coli.

Enterohemorrhagic E. coli (EHEC) is considered to be the most dangerous pathotype of E. coli, as it causes severe conditions such as hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS). Antibiotic treatment of EHEC infections is generally not recommended since it may promote the production of the Shiga toxin (Stx) and lead to worsened symptoms. This study explores how exposure to the fluoroquinolone ciprofloxacin reorganizes the transcriptome and proteome of EHEC O157:H7 strain EDL933, with special emphasis on virulence-associated factors. As expected, exposure to ciprofloxacin caused an extensive upregulation of SOS-response- and Stx-phage proteins, including Stx. A range of other virulence-associated factors were also upregulated, including many genes encoded by the LEE-pathogenicity island, the enterohemolysin gene (ehxA), as well as several genes and proteins involved in LPS production. However, a large proportion of the genes and proteins (17 and 8%, respectively) whose expression was upregulated upon ciprofloxacin exposure (17 and 8%, respectively) are not functionally assigned. This indicates a knowledge gap in our understanding of mechanisms involved in EHECs response to antibiotic-induced stress. Altogether, the results contribute to better understanding of how exposure to ciprofloxacin influences the virulome of EHEC and generates a knowledge base for further studies on how EHEC responds to antibiotic-induced stress. A deeper understanding on how EHEC responds to antibiotics will facilitate development of novel and safer treatments for EHEC infections.

Photocatalytic degradation of antibiotics and antimicrobial and anticancer activities of two-dimensional ZnO nanosheets.

Active pharmaceutical ingredients have emerged as an environmentally undesirable element because of their widespread exploitation and consequent pollution, which has deleterious effects on living things. In the pursuit of sustainable environmental remediation, biomedical applications, and energy production, there has been a significant focus on two-dimensional materials (2D materials) owing to their unique electrical, optical, and structural properties. Herein, we have synthesized 2D zinc oxide nanosheets (ZnO NSs) using a facile and practicable hydrothermal method and characterized them thoroughly using spectroscopic and microscopic techniques. The 2D nanosheets are used as an efficient photocatalyst for antibiotic (herein, end-user ciprofloxacin (CIP) was used as a model antibiotic) degradation under sunlight. It is observed that ZnO NSs photodegrade ~ 90% of CIP within two hours of sunlight illumination. The molecular mechanism of CIP degradation is proposed based on ex-situ IR analysis. Moreover, the 2D ZNO NSs are used as an antimicrobial agent and exhibit antibacterial qualities against a range of bacterial species, including Escherichia coli, Staphylococcus aureus, and MIC of the bacteria are found to be 5 µg/l and 10 µg/l, respectively. Despite having the biocompatible nature of ZnO, as-synthesized nanosheets have also shown cytotoxicity against two types of cancer cells, i.e. A549 and A375. Thus, ZnO nanosheets showed a nontoxic nature, which can be exploited as promising alternatives in different biomedical applications.

Digital Photocolorimetric Analysis of In Vitro Tooth Color Changes.

OBJECTIVE: Tooth color matching is challenging, and digital photocolorimetry using eLABor_aid (eLAB) provides objective evaluation through polarized photographs. However, its comparability with spectrophotometry remains unclear. METHODS AND MATERIALS: Bovine incisor root canals (n=30) were prepared to simulate an incomplete root apex. The teeth were randomly assigned to three groups based on intracanal medication: control (without medication); calcium hydroxide/propylene glycol; and triple-antibiotic paste (n=10 each). Tooth color was assessed using both eLAB and spectrophotometry. Measurements were taken at the crown medio-cervical region on five-time intervals (baseline, 1, 3, 7, and 14 days). Statistical analysis included two-way repeated-measures ANOVA, Sidak post hoc and Pearson's correlation test (α=0.05). RESULTS: No significant differences were observed between the two methods for either medication or follow-ups (p>0.05). Triple-antibiotic paste exhibited higher color variation (p<0.05). After 7 days, all groups presented significant color changes (p<0.05). Moderate to high correlations (R2 from 0.51 to 0.84, p<0.0001) were found between both methods for all groups at all intervals. CONCLUSION: The eLAB is a reliable method for detecting tooth color changes, and its results are comparable to spectrophotometry analysis.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

A novel N-CNDs/PAni modified molecular imprinted polymer for ultraselective and sensitive detection of ciprofloxacin in lentic ecosystems: a dual responsive optical sensor.

The research study describes the development of a hybrid nanocomposite called nitro-doped carbon nanodots/polyaniline/molecularly imprinted polymer (N-CNDs/PAni/MIP). This composite is specifically engineered to function as a durable and flexible dual-response sensor to detect and analyze pharmaceutical organic contaminants (POCs). Powder X-Ray diffraction (PXRD), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA), transmission electron microscopy (TEM), and scanning electron microscopy (SEM) were employed to perform an exhaustive structural and morphological analysis of N-CNDs/PAni/MIP. N-CNDs/PAni/MIP emitted blue luminescence under ultraviolet irradiation and exhibited typical excitation-dependent emission properties. It can act as fluorescent probe for the detection of CIPRO with high selectivity and sensitivity with an IF value of 4.2. Furthermore, N-CNDs/PAni/MIP exhibited high peroxidase-like catalytic behavior. After adding CIPRO to the N-CNDs/PAni/MIP/TMB/H2O2 system, the blue color of the solution faded due to the reduction of blue ox-TMB to colorless TMB. Based on these two phenomena, with CIPRO as the target analyte, the N-CNDs/PAni/MIP dual sensor showed a minimal detection limit of 70 pM for the fluorescent signaling platform and 3.5 nM for the colorimetric probe with a linear range of 0.038-200 nM. The fluorometric and colorimetric assays based on N-CNDs/PAni/MIP for CIPRO detection were then successfully applied to lentic water as well as to tap water samples, demonstrating the sensitivity and dependability of the instrument. Furthermore, the synthesized PVA (N-CNDs/PAni/MIP) films enable the recognition of CIPRO, and these films have the potential to be integrated into portable sensing devices, providing a practical solution for rapid and on-site detection of CIPRO in various samples.

Synthesis and drug release kinetics of ciprofloxacin from polyacrylamide/dextran/carbon quantum dots (PAM/Dex/CQD) hydrogels.

Sustainable release of drug by utilizing ß-cyclodextrin (ß-CD) based inclusion complex (IC) is the prime objective of the present work. Herein, polyacrylamide/dextran containing carbon quantum dots (PAM/Dex/CQD) nanocomposite hydrogels are prepared by in situ polymerization of acrylamide. The incorporation of CQD triggers the change in orientation of the PAM/Dex polymeric chains to result the formation of stacked surface morphology of the hydrogel. The average particle size of CQD is found to be 4.13 nm from HRTEM analysis. As-synthesized nanocomposite hydrogel exhibits an optimum swelling ratio of 863 % in aqueous medium. The cytotoxicity study is conducted on HeLa cells by taking up to 2 µM concentration of the prepared nanocomposite hydrogel demonstrate 78 % cell viability. In present study, ciprofloxacin (Cipro) is taken as model drug that achieves release of 64.15 % in 32 h from ß-Cipro@PAM/Dex/CQD hydrogels in acidic medium. From theoretical study, release rate constants, R2, Akaike information criterion (AIC) and model selection criterion (MSC) are computed to determine the best fitted kinetics model. Peppas-Sahlin model is the best fitted kinetics model for ß-Cipro@PAM/Dex/CQD and concluded that the release of Cipro follows Fickian drug diffusion mechanism in acidic medium.

Photocatalytic activation of peroxydisulfate by UV-LED through rGO/g-C3N4/SiO2 nanocomposite for ciprofloxacin removal: Mineralization, toxicity, degradation pathways, and application for real matrix.

If trace amounts of antibiotics remain in the environment, they can lead to microbial pathogens becoming resistant to antibiotics and putting ecosystem health at risk. For instance, ciprofloxacin (CIP) can be found in surface and ground waters, suggesting that conventional water treatment technologies are ineffective at removing it. Now, a rGO/g-C3N4/SiO2 nanocomposite was synthesized in this study to activate peroxydisulfate (PDS) under UVA-LED irradiation. UVA-LED/rGO-g-C3N4-SiO2/PDS system performance was evaluated using Ciprofloxacin as an antibiotic. Particularly, rGO/g-C3N4/SiO2 showed superior catalytic activity for PDS activation to remove CIP. Operational variables, reactive species determination, and mechanisms were investigated. 0.85 mM PDS and 0.3 g/L rGO/g-C3N4/SiO2 eliminated 99.63% of CIP in 35 min and mineralized 59.78% in 100 min at pH = 6.18. By scavenging free radicals, bicarbonate ions inhibit CIP degradation. According to the trapping experiments, superoxide (O2•-) was the main active species rather than sulfate (SO4•-) and hydroxyl radicals (•OH). RGO/g-C3N4/SiO2 showed an excellent recyclable capability of up to six cycles. The UVA-LED/rGO-g-C3N4-SiO2/PDS system was also tested under real conditions. The system efficiency was reasonable. By calculating the synergistic factor (SF), this work highlights the benefit of combining composite, UVA-LED, and PDS. UVA-LED/rGO-g-C3N4-SiO2/PDS had also been predicted to be an eco-friendly process based on the results of the ECOSAR program. Consequently, this study provides a novel and durable nanocomposite with supreme thermal stability that effectively mitigates environmental contamination by eliminating antibiotics from wastewater.

Enhanced biotoxicity by co-exposure of aged polystyrene and ciprofloxacin: the adsorption and its influence factors.

Microplastics (MPs), as emerging contaminants, usually experience aging processes in natural environments and further affect their interactions with coexisted contaminants, resulting in unpredictable ecological risks. Herein, the effect of MPs aging on their adsorption for coexisting antibiotics and their joint biotoxicity have been investigated. Results showed that the adsorption capacity of aged polystyrene (PS, 100 d and 50 d) for ciprofloxacin (CIP) was 1.10-4.09 times higher than virgin PS due to the larger BET surface area and increased oxygen-containing functional groups of aged PS. Following the increased adsorption capacity of aged PS, the joint toxicity of aged PS and CIP to Shewanella Oneidensis MR-1 (MR-1) was 1.03-1.34 times higher than virgin PS and CIP. Combined with the adsorption process, CIP posed higher toxicity to MR-1 compared to aged PS due to the rapid adsorption of aged PS for CIP in the first 12 h. After that, the adsorption process tended to be gentle and hence the joint toxicity to MR-1 was gradually dominated by aged PS. A similar transformation between the adsorption rate and the joint toxicity of PS and CIP was observed under different conditions. This study supplied a novel perception of the synergistic effects of PS aging and CIP on ecological health.

Physicochemical parameters affecting the adhesion of ciprofloxacin-resistant Escherichia coli to activated sludge.

To investigate the physicochemical conditions necessary to stably remove antibiotic-resistant bacteria (ARB) via contact with activated sludge (AS), the adhesion of ciprofloxacin (CIP)-resistant and -susceptible Escherichia coli to AS was simulated by contact tests in the laboratory. The CIP-resistant E. coli and susceptible E. coli were removed by a 3 log smaller concentration by a 5 h contact test at maximum. Considering the hydraulic retention time of a reaction tank (∼5 h) and step-feeding operation, we considered the removal rate of E. coli in the current simulated contact test to be in agreement with the actual situation where 1-2 log concentrations of E. coli were reported to be removed from an AS reaction tank. With the increase in the AS concentration and/or dissolved oxygen, the removal rate of E. coli increased. The removal rate of CIP-resistant E. coli was greater than that of susceptible E. coli under all experimental conditions. Although the mechanism by which CIP-resistant E. coli preferably adhered to AS was not clearly understood in detail, finding optimum conditions under which bacteria, including ARB, were efficiently removed by the AS process may be possible.

Alien emergent aquatic plants develop better ciprofloxacin tolerance and metabolic capacity than one native submerged species.

Antibiotic pollution and biological invasion pose significant risks to freshwater biodiversity and ecosystem health. However, few studies have compared the ecological adaptability and ciprofloxacin (CIPR) degradation potential between alien and native macrophytes. We examined growth, physiological response, and CIPR accumulation, translocation and metabolic abilities of two alien plants (Eichhornia crassipes and Myriophyllum aquaticum) and one native submerged species (Vallisneria natans) exposed to CIPR at 0, 1 and 10 mg/L. We found that E. crassipes and M. aquaticum's growth were unaffected by CIPR while V. natans was significantly hindered under the 10 mg/L treatment. CIPR significantly decreased the maximal quantum yield of PSII, actual quantum yield of PSII and relative electron transfer rate in E. crassipes and V. natans but didn't impact these photosynthetic characteristics in M. aquaticum. All the plants can accumulate, translocate and metabolize CIPR. M. aquaticum and E. crassipes in the 10 mg/L treatment group showed greater CIPR accumulation potential than V. natans indicated by higher CIPR contents in their roots. The oxidative cleavage of the piperazine ring acts as a key pathway for these aquatic plants to metabolize CIPR and the metabolites mainly distributed in plant roots. M. aquaticum and E. crassipes showed a higher production of CIPR metabolites compared to V. natans, with M. aquaticum exhibiting the strongest CIPR metabolic ability, as indicated by the most extensive structural breakdown of CIPR and the largest number of potential metabolic pathways. Taken together, alien species outperformed the native species in ecological adaptability, CIPR accumulation and metabolic capacity. These findings may shed light on the successful invasion mechanisms of alien aquatic species under antibiotic pressure and highlight the potential ecological impacts of alien species, particularly M. aquaticum. Additionally, the interaction of antibiotic contamination and invasion might further challenge the native submerged macrophytes and pose greater risks to freshwater ecosystems.

Utilizing olive leaves biomass as an efficient adsorbent for ciprofloxacin removal: characterization, isotherm, kinetic, and thermodynamic analysis.

Olive leaves were utilized to produce activated biomass for the removal of ciprofloxacin (CIP) from water. The raw biomass (ROLB) was activated with sodium hydroxide, phosphoric acid, and Dead Sea water to create co-precipitated adsorbent (COLB) with improved adsorption performance. The characteristics of the ROLB and COLB were examined using SEM images, BET surface area analyzer, and ATR-FTIR spectroscopy. COLB has a BET surface area of 7.763 m2/g, markedly higher than ROLB's 2.8 m2/g, indicating a substantial increase in adsorption sites. Through investigations on operational parameters, the optimal adsorption efficiency was achieved by COLB is 77.9% within 60 min, obtained at pH 6, and CIP concentration of 2 mg/mL. Isotherm studies indicated that both Langmuir and Freundlich models fit the adsorption data well for CIP onto ROLB and COLB, with R2 values exceeding 0.95, suggesting effective monolayer and heterogeneous surface adsorption. The Langmuir model revealed maximum adsorption capacities of 636 mg/g for ROLB and 1243 mg/g for COLB, highlighting COLB's superior adsorption capability attributed to its enhanced surface characteristics post-modification. Kinetic data fitting the pseudo-second-order model with R2 of 0.99 for ROLB and 1 for COLB, along with a higher calculated qe for COLB, suggest its modified surface provides more effective binding sites for CIP, enhancing adsorption capacity. Thermodynamic analysis revealed that the adsorption process is spontaneous (∆Go < 0), and exothermic (∆Ho < 0), and exhibits a decrease in randomness (∆So < 0) as the process progresses. The ΔH° value of 10.6 kJ/mol for ROLB signifies physisorption, whereas 35.97 kJ/mol for COLB implies that CIP adsorption on COLB occurs through a mixed physicochemical process.

Assessing microplastics-antibiotics coexistence induced ciprofloxacin-resistant Pseudomonas aeruginosa at a water region scale.

Microplastics (MPs) waste is widespread globally in water systems. The opportunistic human pathogen Pseudomonas aeruginosa can cause serious acute and chronic infections that are notoriously difficult to treat. Ciprofloxacin (CIP) is broadly applied as an anti-P. aeruginosa drug. A growing evidence reveals that antibiotic-resistance genes-carrying Pseudomonas aeruginosa were detected on MPs forming plastisphere due to their adsorbability along with high occurrence of CIP in water environments. The MPs-niched CIP-resistant P. aeruginosa has been likely to emerge as an unignorable public health issue. Here, we offered a novel approach to assess the development of CIP-resistant P. aeruginosa under MPs-antibiotic coexistence at a water region scale. By combing the adsorption isotherm models used to estimate CIP condensation around MPs and a pharmacokinetic/pharmacodynamic-based microbial population dynamic model, we predicted the P. aeruginosa development on CIP-adsorbed MPs in waters. Our assessment revealed a high antibiotic resistance in the P. aeruginosa populations (∼50 %) with a wider range of waterborne total cell counts (∼10-2-104 cfu mL-1) among water regions in that the resistance proportion was primarily determined by CIP pollution level and relative abundance of various polymer type of MPs. We implicate that water region-specific MPs were highly likely to provide media for P. aeruginosa propagation. Our results highlight the importance of antibiotic-resistant pathogen colonization-emerging environmental medium interactions when addressing global threat from MPs pollution, in the context of MPs-antibiotics co-contamination assessment and for the continued provision of water system management.

Potential antivirulence activity of sub-inhibitory concentrations of ciprofloxacin against Proteus mirabilis isolates: an in-vitro and in-vivo study.

BACKGROUND: Proteus mirabilis is a significant nosocomial pathogen that is frequently associated with a wide range of infections, necessitating heightened attention to mitigate potential health risks. Hence, this study was performed to investigate the impact of sub-minimum inhibitory concentrations (MICs) of ciprofloxacin (CIP) on Proteus mirabilis clinical isolates. METHODS: The sub-MICs of CIP were selected using the growth curve approach. The untreated and treated isolates with sub-MICs of CIP were assessed for their biofilm development, motilities on agar, and other virulence factors. The cell morphology of untreated and treated isolates with sub-MIC of CIP was explored using electron microscope. Moreover, the expression levels of the virulence genes in isolates were measured using quantitative real-time PCR. RESULTS: Data revealed that sub-MICs of CIP significantly (p < 0.05), in a concentration-dependent manner, inhibited biofilm formation and other virulence factors in the selected isolates. Electron microscope analysis showed cell enlargement and various abnormalities in the cell wall and membrane integrity. CONCLUSION: Sub-MICs of CIP exhibited inhibition of virulence and alterations in morphological integrity against P. mirabilis isolates.

Effects of combined ciprofloxacin and Neulasta therapy on intestinal pathology and gut microbiota after high-dose irradiation in mice.

Introduction: Treatments that currently exist in the strategic national stockpile for acute radiation syndrome (ARS) focus on the hematopoietic subsyndrome, with no treatments on gastrointestinal (GI)-ARS. While the gut microbiota helps maintain host homeostasis by mediating GI epithelial and mucosal integrity, radiation exposure can alter gut commensal microbiota which may leave the host susceptible to opportunistic pathogens and serious sequelae such as sepsis. To mitigate the effects of hematopoietic ARS irradiation, currently approved treatments exist in the form of colony stimulating factors and antibiotics: however, there are few studies examining how these therapeutics affect GI-ARS and the gut microbiota. The aim of our study was to examine the longitudinal effects of Neulasta and/or ciprofloxacin treatment on the gut microbiota after exposure to 9.5 Gy 60Co gamma-radiation in mice. Methods: The gut microbiota of vehicle and drug-treated mice exposed to sham or gamma-radiation was characterized by shotgun sequencing with alpha diversity, beta diversity, and taxonomy analyzed on days 2, 4, 9, and 15 post-irradiation. Results: No significant alpha diversity differences were observed following radiation, while beta diversity shifts and taxonomic profiles revealed significant alterations in Akkermansia, Bacteroides, and Lactobacillus. Ciprofloxacin generally led to lower Shannon diversity and Bacteroides prevalence with increases in Akkermansia and Lactobacillus compared to vehicle treated and irradiated mice. While Neulasta increased Shannon diversity and by day 9 had more similar taxonomic profiles to sham than ciprofloxacin-or vehicle-treated irradiated animals. Combined therapy of Neulasta and ciprofloxacin induced a decrease in Shannon diversity and resulted in unique taxonomic profiles early post-irradiation, returning closer to vehicle-treated levels over time, but persistent increases in Akkermansia and Bacteroides compared to Neulasta alone. Discussion: This study provides a framework for the identification of microbial elements that may influence radiosensitivity, biodosimetry and the efficacy of potential therapeutics. Moreover, increased survival from H-ARS using these therapeutics may affect the symptoms and appearance of what may have been subclinical GI-ARS.

Citizen science in action: Time-resolved immunofluorescence-based field detection of antibiotics with portable analytical kit.

Citizen scientist-based environmental monitoring and public education are becoming increasingly popular. However, current technologies for antibiotic-based novel contaminant identification are still restricted to laboratory sample collection and analysis due to detection methodologies and apparatus limitations. This study developed a time-resolved immunofluorescence-based simultaneous field-based assay for ciprofloxacin (CIP) and enrofloxacin (ENR) that matches test results to geographic locations. The assay helps the public understand the potential levels of antibiotic exposures in their environments and helps them take appropriate action to reduce risk. The assay was developed using smartphones and social software in addition to rapid testing. The method uses a portable, low-cost analytical kit with a smartphone app to build a field-based detection platform for the detection and analysis of ENR and CIP in water and aquatic products. The methodological evaluation was good, with detection limits of 0.4 ng/mL and 0.5 ng/g for ENR in water and fish, and quantification limits of 1.2 ng/mL and 1.4 ng/g, with recoveries of 89.0 %-101.0 % and 78.0 %-97.0 %. For CIP in water and fish, the limits of detection were 0.3 ng/mL and 0.4 ng/g, the limits of quantification were 0.9 ng/mL and 1.2 ng/g, and the recoveries were 75.0 %-91.0 % and 72.0 %-89.0 %, both with coefficients of variation <15 %. These limits were sufficient to prevent the two antibiotics from crossing over during simultaneous detection. The assay was validated using real samples to assess the effectiveness of the assay platform in field deployments, and the results were consistent with those obtained through liquid chromatography-tandem mass spectrometry (LC-MS) and enzyme-linked immunoassay (ELISA) techniques. In addition, the TRFIA assay process requires less time, uses more portable instruments, and is less complex than traditional methods. This study provides a new scientific, accurate, and rapid detection method for antibiotic detection by citizen scientists, helping scientists to obtain a wider range of data and providing more opportunities to solve scientific problems.

Impact of molecular ciprofloxacin resistance testing in management of gonorrhoea in a large urban clinic.

OBJECTIVES: Antibiotic resistance in gonorrhoea is of significant public health concern with the emergence of resistance to last-line therapies such as ceftriaxone. Despite around half of Neisseria gonorrhoeae isolates tested in the UK being susceptible to ciprofloxacin, very little ciprofloxacin is used in clinical practice. Testing for the S91F mutation associated with ciprofloxacin resistance is now available in CE-marked assays and may reduce the requirement for ceftriaxone, but many patients are treated empirically, or as sexual contacts, which may limit any benefit. We describe the real-world impact of such testing on antimicrobial use and clinical outcomes in people found to have gonorrhoea in a large urban UK sexual health clinic. METHODS: Molecular ciprofloxacin resistance testing (ResistancePlus GC assay (SpeeDx)) was undertaken as an additional test after initial diagnosis (m2000 Realtime CT/NG assay (Abbott Molecular)) in those not already known to have had antimicrobial treatment. Data from a 6-month period (from March to September 2022) were analysed to determine treatment choice and treatment outcome. RESULTS: A total of 998 clinical samples tested positive for N. gonorrhoeae in 682 episodes of infection. Of the 560 (56%) samples eligible for resistance testing, 269 (48.0%) were reported as wild-type, 180 (32.1%) were predicted to be resistant, 63 (11.3%) had an indeterminate resistance profile, and in 48 (8.6%) samples, N. gonorrhoeae was not detected. Ciprofloxacin was prescribed in 172 (75%) of 228 episodes in which the wild-type strain was detected. Four (2%) of those treated with ciprofloxacin had a positive test-of-cure sample by NAAT, with no reinfection risk. All four had ciprofloxacin-susceptible infection by phenotypic antimicrobial susceptibility testing. CONCLUSIONS: In routine practice in a large UK clinic, molecular ciprofloxacin resistance testing led to a significant shift in antibiotic use, reducing use of ceftriaxone. Testing can be targeted to reduce unnecessary additional testing. Longer term impact on antimicrobial resistance requires ongoing surveillance.