Enhanced removal of ciprofloxacin and associated antibiotic-resistant genes from wastewater using a biological aeration filters in combination with Fe3O4-modified zeolite.

Antibiotics release into the water environment through sewage discharge is a significant environmental concern. In the present study, we investigated the removal of ciprofloxacin (CIP) in simulated sewage by biological aeration filter (BAF) equipped with Fe3O4-modified zeolite (Fe3O4@ZF). Fe3O4@ZF were prepared with impregnation method, and the Fe3O4 particles were successfully deposited on the surface of ZF in an amorphous form according to the results of XPS and XRD analysis. The modification also increased the specific surface area (from 16.22 m²/g to 22 m²/g) and pore volume (from 0.0047 cm³/g to 0.0063 cm³/g), improving the adsorption efficiency of antibiotics. Fe3O4 modified ZF improved the treatment performance significantly, and the removal efficiency of CIP in BAF-Fe3O4@ZF was 79%±2.4%. At 10ml/L CIP, the BAF-Fe3O4@ZF reduced the relative abundances of antibiotics resistance genes (ARGs) int, mexA, qnrB and qnrS in the effluent by 57.16%, 39.59%, 60.22%, and 20.25%, respectively, which effectively mitigate the dissemination risk of ARGs. The modification of ZF increased CIP-degrading bacteria abundance, such as Rhizobium and Deinococcus-Thermus, and doubled bacterial ATP activity, promoting CIP degradation. This study offers a viable, efficient method to enhance antibiotic treatment and prevent leakage via sewage discharge.

Advancements in Synthetic Strategies and Biological Effects of Ciprofloxacin Derivatives: A Review.

Ciprofloxacin is a widely used antibiotic in the fluoroquinolone class. It is widely acknowledged by various researchers worldwide, and it has been documented to have a broad range of other pharmacological activities, such as anticancer, antiviral, antimalarial activities, etc. Researchers have been exploring the synthesis of ciprofloxacin derivatives with enhanced biological activities or tailored capability to target specific pathogens. The various biological activities of some of the most potent and promising ciprofloxacin derivatives, as well as the synthetic strategies used to develop them, are thoroughly reviewed in this paper. Modification of ciprofloxacin via 4-oxo-3-carboxylic acid resulted in derivatives with reduced efficacy against bacterial strains. Hybrid molecules containing ciprofloxacin scaffolds displayed promising biological effects. The current review paper provides reported findings on the development of novel ciprofloxacin-based molecules with enhanced potency and intended therapeutic activities which will be of great interest to medicinal chemists.

Biochar-derived dissolved organic matter enhanced the release of residual ciprofloxacin from the soil solid phase.

Biochar has been utilized to reduce ciprofloxacin (CIP) residues in soil. However, little is known about the effect of biochar-derived dissolved organic matter (DOM) on residual CIP transformation. Thus, we analyzed the residual soil CIP as influenced by biochar generated from rice straw (RS3 and RS6), pig manure (PM3 and PM6), and cockroach shell (CS3 and CS6) at 300 °C and 600 °C. The three-dimensional excitation-emission matrix (3D-EEM), parallel factor analysis (PARAFAC) and two-dimensional correlation spectral analysis (2D-COS) were used to describe the potential variation in the DOM-CIP interaction. Compared with CK, biochar amendment increased the water-soluble CIP content by 160.7% (RS3), 55.2% (RS6), 534.1% (PM3), 277.5% (PM6), 1160.6% (CS3) and 703.9% (CS6), indicating that the biochar feedstock controlled the soil CIP release. The content of water-soluble CIP was positively correlated with the content of dissolved organic carbon (r = 0.922, p < 0.01) and dissolved organic nitrogen (r = 0.898, p < 0.01), suggesting that the major influence of the water-soluble CIP increase was DOM. The fluorescence quenching experiment showed that the interaction between DOM and CIP triggered static quenching and the creation of a DOM complex. The mean log K of protein-like material (4.977) was higher than that of terrestrial humus-like material (3.491), suggesting that the protein-like material complexed CIP was more stable than the humus-like material. Compared with pyrolysis at 300 °C, pyrolysis at 600 °C decreased the stability of the complex of protein-like material and CIP by 0.44 (RS), 1.689 (PM) and 0.548 (CS). This result suggested that the influence of temperature change was more profound on PM biochar-derived DOM than on RS and CS. These insights are essential for understanding CIP transportation in soil and controlling CIP contamination with biochar.

A Ce2MgMoO6 double perovskite decorated on a functionalized carbon nanofiber nanocomposite for quantification of ciprofloxacin in milk and honey samples: Density functional theory interpretation.

In this study, a novel Ce2MgMoO6/CNFs (cerium magnesium molybdite double perovskite decorated on carbon nanofibers) nanocomposite was developed for selective and ultra-sensitive detection of ciprofloxacin (CFX). Physical characterization and analytical techniques were used to explore the morphology, structure, and electrocatalytic characteristics of the Ce2MgMoO6/CNFs nanocomposite. The sensor has a wide linear range (0.005-7.71 µM and 9.75-77.71 µM), a low limit of detection (0.012 µM), high sensitivity (0.807 µA µM-1 cm-2 nM), remarkable repeatability, and an appreciable storage stability. Here, we used density functional theory to investigate CFX and oxidized CFX as well as the locations of the energy levels and electron transfer sites. Furthermore, the Ce2MgMoO6/CNFs-modified electrode was successfully tested in food samples (milk and honey), indicating an acceptable response with a recovery percentage and relative standard deviation of less than 4%, which is comparable to that of GC-MS. Finally, the developed sensor exhibited high selectivity and stability for CFX detection.

Enhanced biotoxicity by co-exposure of aged polystyrene and ciprofloxacin: the adsorption and its influence factors.

Microplastics (MPs), as emerging contaminants, usually experience aging processes in natural environments and further affect their interactions with coexisted contaminants, resulting in unpredictable ecological risks. Herein, the effect of MPs aging on their adsorption for coexisting antibiotics and their joint biotoxicity have been investigated. Results showed that the adsorption capacity of aged polystyrene (PS, 100 d and 50 d) for ciprofloxacin (CIP) was 1.10-4.09 times higher than virgin PS due to the larger BET surface area and increased oxygen-containing functional groups of aged PS. Following the increased adsorption capacity of aged PS, the joint toxicity of aged PS and CIP to Shewanella Oneidensis MR-1 (MR-1) was 1.03-1.34 times higher than virgin PS and CIP. Combined with the adsorption process, CIP posed higher toxicity to MR-1 compared to aged PS due to the rapid adsorption of aged PS for CIP in the first 12 h. After that, the adsorption process tended to be gentle and hence the joint toxicity to MR-1 was gradually dominated by aged PS. A similar transformation between the adsorption rate and the joint toxicity of PS and CIP was observed under different conditions. This study supplied a novel perception of the synergistic effects of PS aging and CIP on ecological health.

Photocatalytic degradation of antibiotics and antimicrobial and anticancer activities of two-dimensional ZnO nanosheets.

Active pharmaceutical ingredients have emerged as an environmentally undesirable element because of their widespread exploitation and consequent pollution, which has deleterious effects on living things. In the pursuit of sustainable environmental remediation, biomedical applications, and energy production, there has been a significant focus on two-dimensional materials (2D materials) owing to their unique electrical, optical, and structural properties. Herein, we have synthesized 2D zinc oxide nanosheets (ZnO NSs) using a facile and practicable hydrothermal method and characterized them thoroughly using spectroscopic and microscopic techniques. The 2D nanosheets are used as an efficient photocatalyst for antibiotic (herein, end-user ciprofloxacin (CIP) was used as a model antibiotic) degradation under sunlight. It is observed that ZnO NSs photodegrade ~ 90% of CIP within two hours of sunlight illumination. The molecular mechanism of CIP degradation is proposed based on ex-situ IR analysis. Moreover, the 2D ZNO NSs are used as an antimicrobial agent and exhibit antibacterial qualities against a range of bacterial species, including Escherichia coli, Staphylococcus aureus, and MIC of the bacteria are found to be 5 µg/l and 10 µg/l, respectively. Despite having the biocompatible nature of ZnO, as-synthesized nanosheets have also shown cytotoxicity against two types of cancer cells, i.e. A549 and A375. Thus, ZnO nanosheets showed a nontoxic nature, which can be exploited as promising alternatives in different biomedical applications.

Utilizing olive leaves biomass as an efficient adsorbent for ciprofloxacin removal: characterization, isotherm, kinetic, and thermodynamic analysis.

Olive leaves were utilized to produce activated biomass for the removal of ciprofloxacin (CIP) from water. The raw biomass (ROLB) was activated with sodium hydroxide, phosphoric acid, and Dead Sea water to create co-precipitated adsorbent (COLB) with improved adsorption performance. The characteristics of the ROLB and COLB were examined using SEM images, BET surface area analyzer, and ATR-FTIR spectroscopy. COLB has a BET surface area of 7.763 m2/g, markedly higher than ROLB's 2.8 m2/g, indicating a substantial increase in adsorption sites. Through investigations on operational parameters, the optimal adsorption efficiency was achieved by COLB is 77.9% within 60 min, obtained at pH 6, and CIP concentration of 2 mg/mL. Isotherm studies indicated that both Langmuir and Freundlich models fit the adsorption data well for CIP onto ROLB and COLB, with R2 values exceeding 0.95, suggesting effective monolayer and heterogeneous surface adsorption. The Langmuir model revealed maximum adsorption capacities of 636 mg/g for ROLB and 1243 mg/g for COLB, highlighting COLB's superior adsorption capability attributed to its enhanced surface characteristics post-modification. Kinetic data fitting the pseudo-second-order model with R2 of 0.99 for ROLB and 1 for COLB, along with a higher calculated qe for COLB, suggest its modified surface provides more effective binding sites for CIP, enhancing adsorption capacity. Thermodynamic analysis revealed that the adsorption process is spontaneous (∆Go < 0), and exothermic (∆Ho < 0), and exhibits a decrease in randomness (∆So < 0) as the process progresses. The ΔH° value of 10.6 kJ/mol for ROLB signifies physisorption, whereas 35.97 kJ/mol for COLB implies that CIP adsorption on COLB occurs through a mixed physicochemical process.

Photocatalytic activation of peroxydisulfate by UV-LED through rGO/g-C3N4/SiO2 nanocomposite for ciprofloxacin removal: Mineralization, toxicity, degradation pathways, and application for real matrix.

If trace amounts of antibiotics remain in the environment, they can lead to microbial pathogens becoming resistant to antibiotics and putting ecosystem health at risk. For instance, ciprofloxacin (CIP) can be found in surface and ground waters, suggesting that conventional water treatment technologies are ineffective at removing it. Now, a rGO/g-C3N4/SiO2 nanocomposite was synthesized in this study to activate peroxydisulfate (PDS) under UVA-LED irradiation. UVA-LED/rGO-g-C3N4-SiO2/PDS system performance was evaluated using Ciprofloxacin as an antibiotic. Particularly, rGO/g-C3N4/SiO2 showed superior catalytic activity for PDS activation to remove CIP. Operational variables, reactive species determination, and mechanisms were investigated. 0.85 mM PDS and 0.3 g/L rGO/g-C3N4/SiO2 eliminated 99.63% of CIP in 35 min and mineralized 59.78% in 100 min at pH = 6.18. By scavenging free radicals, bicarbonate ions inhibit CIP degradation. According to the trapping experiments, superoxide (O2•-) was the main active species rather than sulfate (SO4•-) and hydroxyl radicals (•OH). RGO/g-C3N4/SiO2 showed an excellent recyclable capability of up to six cycles. The UVA-LED/rGO-g-C3N4-SiO2/PDS system was also tested under real conditions. The system efficiency was reasonable. By calculating the synergistic factor (SF), this work highlights the benefit of combining composite, UVA-LED, and PDS. UVA-LED/rGO-g-C3N4-SiO2/PDS had also been predicted to be an eco-friendly process based on the results of the ECOSAR program. Consequently, this study provides a novel and durable nanocomposite with supreme thermal stability that effectively mitigates environmental contamination by eliminating antibiotics from wastewater.

A new strategy for the treatment of middle ear infection using ciprofloxacin/amoxicillin-loaded ethyl cellulose/polyhydroxybutyrate nanofibers.

A middle ear infection occurs due to the presence of several microorganisms behind the eardrum (tympanic membrane) and is very challenging to treat due to its unique location and requires a well-designed treatment. If not treated properly, the infection can result in severe symptoms and unavoidable side effects. In this study, excellent biocompatible ethyl cellulose (EC) and biodegradable polyhydroxybutyrate (PHB) biopolymer were used to fabricate drug-loaded nanofiber scaffolds using an electrospinning technique to overcome antibiotic overdose and insufficient efficacy of drug release during treatment. PHB polymer was produced from Halomonas sp., and the purity of PHB was found to around be 90 %. Additionally, ciprofloxacin (CIP) and amoxicillin (AMX) are highly preferable since both drugs are highly effective against gram-negative and gram-positive bacteria to treat several infections. Obtained smooth nanofibers were between 116.24 and 171.82 nm in diameter and the addition of PHB polymer and antibiotics improved the morphology of the nanofiber scaffolds. Thermal properties of the nanofiber scaffolds were tested and the highest Tg temperature resulted at 229 °C. The mechanical properties of the scaffolds were tested, and the highest tensile strength resulted in 4.65 ± 6.33 MPa. Also, drug-loaded scaffolds were treated against the most common microorganisms that cause the infection, such as S.aureus, E.coli, and P.aeruginosa, and resulted in inhibition zones between 10 and 21 mm. MTT assay was performed by culturing human adipose-derived mesenchymal stem cells (hAD MSCs) on the scaffolds. The morphology of the hAD MSCs' attachment was tested with SEM analysis and hAD MSCs were able to attach, spread, and live on each scaffold even on the day of 7. The cumulative drug release kinetics of CIP and AMX from drug-loaded scaffolds were analysed in phosphate-buffered saline (pH: 7.4) within different time intervals of up to 14 days using a UV spectrophotometer. Furthermore, the drug release showed that the First-Order and Korsmeyer-Peppas models were the most suitable kinetic models. Animal testing was performed on SD rats, matrix and collagen deposition occurred on days 5 and 10, which were observed using Hematoxylin-eosin and Masson's trichrome staining. At the highest drug concentration, a better repair effect was observed. Results were promising and showed potential for novel treatment.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

A novel N-CNDs/PAni modified molecular imprinted polymer for ultraselective and sensitive detection of ciprofloxacin in lentic ecosystems: a dual responsive optical sensor.

The research study describes the development of a hybrid nanocomposite called nitro-doped carbon nanodots/polyaniline/molecularly imprinted polymer (N-CNDs/PAni/MIP). This composite is specifically engineered to function as a durable and flexible dual-response sensor to detect and analyze pharmaceutical organic contaminants (POCs). Powder X-Ray diffraction (PXRD), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA), transmission electron microscopy (TEM), and scanning electron microscopy (SEM) were employed to perform an exhaustive structural and morphological analysis of N-CNDs/PAni/MIP. N-CNDs/PAni/MIP emitted blue luminescence under ultraviolet irradiation and exhibited typical excitation-dependent emission properties. It can act as fluorescent probe for the detection of CIPRO with high selectivity and sensitivity with an IF value of 4.2. Furthermore, N-CNDs/PAni/MIP exhibited high peroxidase-like catalytic behavior. After adding CIPRO to the N-CNDs/PAni/MIP/TMB/H2O2 system, the blue color of the solution faded due to the reduction of blue ox-TMB to colorless TMB. Based on these two phenomena, with CIPRO as the target analyte, the N-CNDs/PAni/MIP dual sensor showed a minimal detection limit of 70 pM for the fluorescent signaling platform and 3.5 nM for the colorimetric probe with a linear range of 0.038-200 nM. The fluorometric and colorimetric assays based on N-CNDs/PAni/MIP for CIPRO detection were then successfully applied to lentic water as well as to tap water samples, demonstrating the sensitivity and dependability of the instrument. Furthermore, the synthesized PVA (N-CNDs/PAni/MIP) films enable the recognition of CIPRO, and these films have the potential to be integrated into portable sensing devices, providing a practical solution for rapid and on-site detection of CIPRO in various samples.

Synthesis and drug release kinetics of ciprofloxacin from polyacrylamide/dextran/carbon quantum dots (PAM/Dex/CQD) hydrogels.

Sustainable release of drug by utilizing ß-cyclodextrin (ß-CD) based inclusion complex (IC) is the prime objective of the present work. Herein, polyacrylamide/dextran containing carbon quantum dots (PAM/Dex/CQD) nanocomposite hydrogels are prepared by in situ polymerization of acrylamide. The incorporation of CQD triggers the change in orientation of the PAM/Dex polymeric chains to result the formation of stacked surface morphology of the hydrogel. The average particle size of CQD is found to be 4.13 nm from HRTEM analysis. As-synthesized nanocomposite hydrogel exhibits an optimum swelling ratio of 863 % in aqueous medium. The cytotoxicity study is conducted on HeLa cells by taking up to 2 µM concentration of the prepared nanocomposite hydrogel demonstrate 78 % cell viability. In present study, ciprofloxacin (Cipro) is taken as model drug that achieves release of 64.15 % in 32 h from ß-Cipro@PAM/Dex/CQD hydrogels in acidic medium. From theoretical study, release rate constants, R2, Akaike information criterion (AIC) and model selection criterion (MSC) are computed to determine the best fitted kinetics model. Peppas-Sahlin model is the best fitted kinetics model for ß-Cipro@PAM/Dex/CQD and concluded that the release of Cipro follows Fickian drug diffusion mechanism in acidic medium.

Sono-assisted photocatalytic degradation of ciprofloxacin in aquatic media using g-C3N4/MOF-based nanocomposite under visible light irradiation.

This research study is centered on the sono-assisted photocatalytic degradation of a well-known antibiotic (ciprofloxacin; CIP) in aquatic media using a g-C3N4/NH2-UiO-66 (Zr) catalyst under visible light irradiation. Initially, the catalyst was prepared by a simple method, and its physiochemical features were thoroughly analyzed by XRD, FT-IR, FE-SEM, EDX, EDS-Dot-Mapping, and UV-Vis analytical techniques. After that, the impact of several influential factors affecting the performance of the applied sono-assisted photocatalytic process such as the initial concentration of CIP, solution pH, catalyst dosage, light intensity, and ultrasound power was fully assessed, and the optimal conditions were established. After 75 min of the sono-assisted photocatalytic treatment, the complete degradation of CIP (10 mg/L) was accomplished under the condition as follows: g-C3N4/NH2-UiO-66 (Zr), 0.6 g/L; pH, 5.0, and ultrasound power, light intensity 75 mw/cm2, 200 W/m2. Meanwhile, the photocatalytic degradation of CIP followed the pseudo-first-order kinetic model. In addition, the scavenger experiments demonstrated that OH˚ and O2°- radicals played a key role in the sono-assisted photocatalytic degradation process. It is also acknowledged that the applied catalyst was reused for five consecutive runs with a minor loss observed in its degradation efficiency. In a further experiment, a significant synergistic effect with regard to the degradation of CIP was observed once all three major parameters (visible light, ultrasound waves, and catalyst) were used in combination compared to each used alone. To sum up, it is thought that the integration of g-C3N4/MOF-based catalyst, ultrasound waves, and visible light irradiation could be potentially applied as a promising strategy for the degradation of various pharmaceuticals on account of high degradation performance, simple operation, excellent reusability, and eco-friendly approach.

Dry powder inhalation containing muco-inert ciprofloxacin and colistin co-loaded liposomes for pulmonary P. Aeruginosa biofilm eradication.

Pseudomonas aeruginosa (PA), a predominant pathogen in lung infections, poses significant challenges due to its biofilm formation, which is the primary cause of chronic and recalcitrant pulmonary infections. Bacteria within these biofilms exhibit heightened resistance to antibiotics compared to their planktonic counterparts, and their secreted toxins exacerbate lung infections. Diverging from traditional antibacterial therapy for biofilm eradication, this study introduces a novel dry powder inhalation containing muco-inert ciprofloxacin and colistin co-encapsulated liposomes (Cipro-Col-Lips) prepared using ultrasonic spray freeze drying (USFD) technique. This USFD dry powder is designed to efficiently deliver muco-inert Cipro-Col-Lips to the lungs. Once deposited, the liposomes rapidly diffuse into the airway mucus, reaching the biofilm sites. The muco-inert Cipro-Col-Lips neutralize the biofilm-secreted toxins and simultaneously trigger the release of their therapeutic payload, exerting a synergistic antibiofilm effect. Our results demonstrated that the optimal USFD liposomal dry powder formulation exhibited satisfactory in vitro aerosol performance in terms of fine particle fraction (FPF) of 44.44 ± 0.78 %, mass median aerodynamic diameter (MMAD) of 4.27 ± 0.21 µm, and emitted dose (ED) of 99.31 ± 3.31 %. The muco-inert Cipro-Col-Lips effectively penetrate the airway mucus and accumulate at the biofilm site, neutralizing toxins and safeguarding lung cells. The triggered release of ciprofloxacin and colistin works synergistically to reduce the biofilm's antibiotic resistance, impede the development of antibiotic resistance, and eliminate 99.99 % of biofilm-embedded bacteria, including persister bacteria. Using a PA-beads induced biofilm-associated lung infection mouse model, the in vivo efficacy of this liposomal dry powder aerosol was tested, and the results demonstrated that this liposomal dry powder aerosol achieved a 99.7 % reduction in bacterial colonization, and significantly mitigated inflammation and pulmonary fibrosis. The USFD dry powder inhalation containing muco-inert Cipro-Col-Lips emerges as a promising therapeutic strategy for treating PA biofilm-associated lung infections.

Efficient photodegradation of antibiotics by g-C3N4 and 3D flower-like Bi2WO6 perovskite structure: Insights into the preparation, evaluation, and potential mechanism.

Antibiotics are emerging organic pollutants that have attracted huge attention owing to their abundant use and associated ecological threats. The aim of this study is to develop and use photocatalysts to degrade antibiotics, including tetracycline (TC), ciprofloxacin (CIP), and amoxicillin (AMOX). Therefore, a novel Z-scheme heterojunction composite of g-C3N4 (gCN) and 3D flower-like Bi2WO6 (BW) perovskite structure was designed and developed, namely Bi2WO6/g-C3N4 (BW/gCN), which can degrade low-concentration of antibiotics in aquatic environments under visible light. According to the Density Functional Theory (DFT) calculation and the characterization results of X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FITR), Scanning electron microscopy - energy spectroscopy (SEM-EDS) and X-ray photoelectron spectroscopy (XPS), this heterojunction was formed in the recombination process. Furthermore, the results of 15 wt%-BW/gCN photocatalytic experiments showed that the photodegradation rates (Rp) of TC, CIP, and AMOX were 92.4%, 90.1% and 82.3%, respectively, with good stability in three-cycle photocatalytic experiments. Finally, the quenching experiment of free radicals showed that the holes (h+) and superoxide radicals (·O2-) play a more important role than the hydroxyl radicals (·OH) in photocatalysis. In addition, a possible antibiotic degradation pathway was hypothesized on the basis of High performance liquid chromatography (HPLC) analysis. In general, we have developed an effective catalyst for photocatalytic degradation of antibiotic pollutants and analyzed its photocatalytic degradation mechanism, which provides new ideas for follow-up research and expands its application in the field of antibiotic composite pollution prevention and control.

Reactive layered hydroxide membrane for advanced water treatment: Micropollutant degradation and antifouling potential.

The effective removal of micropollutants by water treatment technologies remains a significant challenge. Herein, we develop a CoFe layered double hydroxide (CoFeLDH) catalytic membrane for peroxymonosulfate (PMS) activation to achieve efficient micropollutant removal with improved mass transfer rate and reaction kinetics. This study found that the CoFeLDH membrane/PMS system achieved an impressive above 98% degradation of the probe chemical ranitidine at 0.1 mM of PMS including five more micropollutants (Sulfamethoxazole, Ciprofloxacin, Carbamazepine, Acetaminophen and Bisphenol A) at satisfactory level (above 80%). Moreover, significant improvements in water flux and antifouling properties were observed, marking the membrane as a specific advancement in the removal of membrane fouling in water purification technology. The membrane demonstrated consistent degradation efficiency for several micropollutants and across a range of pH (4-9) as well as different anionic environments, thereby showing it suitability for scale-up application. The key role of reactive species such as SO4•-, and O2• - radicals in the degradation process was elucidated. This is followed by the confirmation of the occurrence of redox cycling between Co and Fe, and the presence of CoOH+ that promotes PMS activation. Over the ten cycles, the membrane could be operated with a flux recovery of up to 99.8% and maintained efficient performance over 24 h continuous operation. Finally, the efficiency in degrading micropollutants, coupled with reduced metal leaching, makes the CoFeLDH membrane as a promising technology for application in water treatment.

Bacterial lipase-responsive polydopamine nanoparticles for detection and synergistic therapy of wound biofilms infection.

Wound biofilms represent an elusive conundrum in contemporary treatment and diagnostic options, accredited to their escalating antibiotic resistance and interference in chronic wound healing processes. Here, we developed mesoporous polydopamine (mPDA) nanoparticles, and grafted with rhodamine B (Rb) as biofilm lipase responsive detection probe, followed by π - π stacking mediated ciprofloxacin (CIP) loading to create mP-Rb@CIP nanoparticles. mPDA NPs with a melanin structure could quench fluorescence emissions of Rb. Once encountering biofilm in vivo, the ester bond in Rb and mPDA is hydrolyzed by elevated lipase concentrations, triggering the liberation of Rb and restore fluorescence emissions to achieve real-time imaging of biofilm-infected wounds. Afterwards, the 808 nm near-infrared (NIR) illumination initiates a spatiotemporal controlled antibacterial photothermal therapy (PTT), boosting its effectiveness through photothermal-triggered CIP release for synergistic biofilm eradication. The mP-Rb@CIP platform exhibits dual diagnostic and therapeutic functions, efficaciously treating biofilm-infected wounds in vivo and in vitro. Particularly, the mP-Rb@CIP/NIR procedure expedites wound-healing by alleviating oxidative stress, modulating inflammatory mediators, boosting collagen synthesis, and promoting angiogenesis. Taken together, the theranostic nanosystem strategy holds significant potential for addressing wound biofilm-associated infections.

Preparation of mesoporous biogas residue biochar via a self-template strategy for efficient removal of ciprofloxacin: Effect of pyrolysis temperature.

Biochar preparation and application is an anticipated pathway for the resource utilization of biogas residue. In this study, biochars were prepared by the pyrolysis of biogas residue from food waste anaerobic digestion (named as BRBCs) under various pyrolysis temperatures (300, 500, 700, and 900 °C), and the effect of pyrolysis temperatures on the physicochemical characteristics of BRBCs was examined. The adsorption performance toward ciprofloxacin (CIP), a typical antibiotic in waterbodies, was also investigated. The results showed that pyrolysis temperature significantly changed the physicochemical properties of BRBCs. In addition, the minerals in the biogas residue, especially SiO2, were rearranged to form a mesoporous structure in biochar through a self-template strategy (without activator). BRBC prepared at 900 °C exhibited a high specific surface area and pore volume, well-developed mesopore structure, and more carbon structure defects, and exhibited the largest CIP adsorption capacity with 70.29 mg g-1, which was ascribed to the combined interaction of pore diffusion, π-π interactions, hydrogen bonding, complexation, and electrostatic forces. Furthermore, the adsorption of CIP by BRBC900 was well described by two-compartment kinetic and Langmuir isotherm models. BRBC900 showed good adsorption performance toward CIP at pH 7-9. The adsorption of CIP by BRBC is a spontaneous, exothermic, entropy-increasing process. Moreover, BRBC also presented a good recycling potential. Therefore, the preparation of mesoporous biochar based on a self-template strategy not only provides an option for the resource utilization of biogas residue but also offers a new option for the treatment of antibiotic wastewater.

Striking the balance: Unveiling the interplay between photocatalytic efficiency and toxicity of La-incorporated Ag3PO4.

Persistent molecules, such as pesticides, herbicides, and pharmaceuticals, pose significant threats to both the environment and human health. Advancements in developing efficient photocatalysts for degrading these substances can play a fundamental role in remediating contaminated environments, thereby enhancing safety for all forms of life. This study investigates the enhancement of photocatalytic efficiency achieved by incorporating La3+ into Ag3PO4, using the co-precipitation method in an aqueous medium. These materials were utilized in the photocatalytic degradation of Rhodamine B (RhB) and Ciprofloxacin (CIP) under visible light irradiation, with monitoring conducted through high-performance liquid chromatography (HPLC). The synthesized materials exhibited improved stability and photodegradation levels for RhB. Particularly noteworthy was the 2% La3+-incorporated sample (APL2), which achieved a 32.6% mineralization of CIP, nearly three times higher than pure Ag3PO4. Toxicological analysis of the residue from CIP photodegradation using the microalga Raphidocelis subcapitata revealed high toxicity due to the leaching of Ag + ions from the catalyst. This underscores the necessity for cautious wastewater disposal after using the photocatalyst. The toxicity of the APL2 photocatalysts was thoroughly assessed through comprehensive toxicological tests involving embryo development in Danio rerio, revealing its potential to induce death and malformations in zebrafish embryos, even at low concentrations. This emphasizes the importance of meticulous management. Essentially, this study adeptly delineated a thorough toxicological profile intricately intertwined with the photocatalytic efficacy of newly developed catalysts and the resultant waste produced, prompting deliberations on the disposal of degraded materials post-exposure to photocatalysts.

Field assessment of active ingredient quantity in pharmaceutical tablets with limited calibration of near infrared spectra: An application to ciprofloxacin tablets.

Portable near-infrared (NIR) spectrophotometers have emerged as valuable tools for identifying substandard and falsified pharmaceuticals (SFPs). Integration of these devices with chemometric and machine learning models enhances their ability to provide quantitative chemical insights. However, different NIR spectrophotometer models vary in resolution, sensitivity, and responses to environmental factors such as temperature and humidity, necessitating instrument-specific libraries that hinder the wider adoption of NIR technology. This study addresses these challenges and seeks to establish a robust approach to promote the use of NIR technology in post-market pharmaceutical analysis. We developed support vector machine and partial least squares regression models based on binary mixtures of lab-made ciprofloxacin and microcrystalline cellulose, then applied the models to ciprofloxacin dosage forms that were assayed with high performance liquid chromatography (HPLC). A receiver operating characteristic (ROC) analysis was performed to set spectrophotometer independent NIR metrics to evaluate ciprofloxacin dosage forms as "meets standard," "needs HPLC assay," or "fails standard." Over 200 ciprofloxacin tablets representing 50 different brands were evaluated using spectra acquired from three types of NIR spectrophotometer with 85% of the prediction agreeing with HPLC testing. This study shows that non-brand-specific predictive models can be applied across multiple spectrophotometers for rapid screening of the conformity of pharmaceutical active ingredients to regulatory standard.