Diploid species phylogeny and evolutionary reticulation indicate early radiation of Ephedra in the Tethys coast.

Reconstructing a robust species phylogeny and disentangling the evolutionary and biogeographic history of the gymnosperm genus Ephedra, which has a large genome and rich polyploids, remain a big challenge. Here we reconstructed a transcriptome-based phylogeny of 19 diploid Ephedra species, and explored evolutionary reticulations in this genus represented by 50 diploid and polyploid species, using four low-copy nuclear and nine plastid genes. The diploid species phylogeny indicates that the Mediterranean species diverged first, and the remaining species split into three clades, including the American species (Clade A), E. rhytidosperma, and all other Asian species (Clade B). The single-gene trees placed E. rhytidosperma sister to Clade A, Clade B, or Clades A + B in similar proportions, suggesting that radiation and gene flow likely occurred in the early evolution of Ephedra. In addition, reticulate evolution occurred not only among the deep nodes, but also in the recently evolved South American species, which further caused difficulty in phylogenetic reconstruction. Moreover, we found that allopolyploid speciation was pervasive in Ephedra. Our study also suggests that Ephedra very likely originated in the Tethys coast during the late Cretaceous, and the South American Ephedra species have a single origin by dispersal from Mexico or North America.

Relationship between ephedrine alkaloid profile in Ephedra gerardiana and soil characteristics of glacial landforms in southeastern Tibetan Plateau, China.

In the Kaluxung River catchment of the southeastern Tibetan Plateau in China, we identified three Ephedra gerardiana communities on different soils and glacial landforms from 4842 to 4899 m above sea level: a moraine community located on constantly collapsing sandy gravel alpine steppe slopes with exposed bedrock on the outer slope of the terminal moraine of the Qiangyong Glacier on Mt. Kaluxung; an outwash plain community located on a gentle alpine steppe slope with exposed bedrock at the terminal end of the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang; and a river terrace community located in an alpine meadow on a rock-scattered flat river terrace along a glacier-fed river in the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang. Based on the finding of identical DNA sequences of the intergenic spacers of chloroplast trnT-trnF and trnS-trnfM regions for all Ephedra specimens examined in this study, the E. gerardiana in this study were considered to comprise a genetically homogeneous population. Analysis of the relationship between ephedrine alkaloid profiles of these three communities and soil characteristics showed that the river terrace community in wet alpine meadow had significantly lower ephedrine content than did the moraine and outwash plain communities in dry alpine steppe (moraine community, 1.52 ± 0.44; outwash plain community, 1.42 ± 0.68; river terrace community, 0.33 ± 0.65%DW), but pseudoephedrine content showed the reverse pattern (moraine community, 0.86 ± 0.30; outwash plain community, 0.73 ± 0.60; river terrace community, 1.50 ± 0.71%DW). In addition, total alkaloid (ephedrine and pseudoephedrine) content in the river terrace community (1.83 ± 0.24%DW) was significantly lower than that in the moraine community (2.38 ± 0.64%DW) and outwash plain community (2.15 ± 0.55%DW).

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Ephedra as a gymnosperm evo-devo model lineage.

Established model systems in the flowering plants have greatly advanced our understanding of plant developmental biology, facilitating in turn its investigation across diverse land plants. The reliance on a limited number of model organisms, however, constitutes a barrier for future progress in evolutionary developmental biology (evo-devo). In particular, a more thorough understanding of seed plant character evolution and of its genetic and developmental basis has been hampered in part by a lack of gymnosperm model systems, since most are trees with decades-long generation times. Guided by the premise that future model organisms should be selected based on their character diversity, rather than simply phylogenetic "position," we highlight biological questions of potential interest that can be addressed via comparative studies in Ephedra (Gnetales). In addition to having relatively small genomes and shorter generation times in comparison to most other gymnosperms, Ephedra are amenable to investigations on the evolution of the key reproductive seed plant innovations of pollination and seed dispersal, as well as on polyploidy, and adaptation to extreme environments.

Unbiased Subgenome Evolution in Allotetraploid Species of Ephedra and Its Implications for the Evolution of Large Genomes in Gymnosperms.

The evolutionary dynamics of polyploid genomes and consequences of polyploidy have been studied extensively in angiosperms but very rarely in gymnosperms. The gymnospermous genus Ephedra is characterized by a high frequency of polyploidy, and thus provides an ideal system to investigate the evolutionary mode of allopolyploid genomes and test whether subgenome dominance has occurred in gymnosperms. Here, we sequenced transcriptomes of two allotetraploid species of Ephedra and their putative diploid progenitors, identified expressed homeologs, and analyzed alternative splicing and homeolog expression based on PacBio Iso-Seq and Illumina RNA-seq data. We found that the two subgenomes of the allotetraploids had similar numbers of expressed homeologs, similar percentages of homeologs with dominant expression, and approximately equal numbers of isoforms with alternative splicing, showing an unbiased subgenome evolution as in a few polyploid angiosperms, with a divergence of the two subgenomes at ∼8 Ma. In addition, the nuclear DNA content of the allotetraploid species is almost equal to the sum of two putative progenitors, suggesting limited genome restructuring after allotetraploid speciation. The allopolyploid species of Ephedra might have undergone slow diploidization, and the unbiased subgenome evolution implies that the formation of large genomes in gymnosperms could be attributed to even and slow fractionation following polyploidization.

Polyploidy in gymnosperms - Insights into the genomic and evolutionary consequences of polyploidy in Ephedra.

While polyploidization is recognized as a major evolutionary driver for ferns and angiosperms, little is known about its impact in gymnosperms, where polyploidy is much less frequent. We explore Ephedra to evaluate (i) the extent of genome size diversity in the genus and the influence polyploidy has had on the evolution of nuclear DNA contents, and (ii) identify where shifts in genome size and polyploidy have occurred both temporally and spatially. A phylogenetic framework of all Ephedra species together with genome sizes and karyotypes for 87% and 67% of them respectively, were used to explore ploidy evolution and its global distribution patterns. Polyploidy was shown to be extremely common, with 41 species (83%) being polyploid (up to 8×) or having polyploid cytotypes - the highest frequency and level reported for any gymnosperm. Genome size was also diverse, with values ranging ~5-fold (8.09-38.34 pg/1C) - the largest range for any gymnosperm family - and increasing in proportion to ploidy level (i.e. no genome downsizing). Our findings provide novel data which support the view that gymnosperms have a more conserved mode of genomic evolution compared with angiosperms.

Identification and Phylogenetic Analysis of the Complete Chloroplast Genomes of Three Ephedra Herbs Containing Ephedrine.

Ephedrae Herba and Ephedrae Radix et Rhizoma (Mahuang) have been used as Chinese herbal medicines. Ephedra plants mainly live in deserts and have good governance of desertification. Despite their important medicinal and environmental protection value, dietary supplements containing ephedrine from Ephedra species may threaten the health of people. Morphological resemblance amongst species causes difficulty in identifying the original species of Ephedra herbs. Chloroplast (CP) genome shows good prospects in identification and phylogenetic analysis. This study introduced the structures of the CP genomes of three Ephedra species and analysed their phylogenetic relationships. Three complete CP genomes of Ephedra showed four-part annular structures, namely, two single-copy regions and two inverted repeat regions. The entire CP genomes of three Ephedra species in terms of size were 109,550 bp (E. sinica), 109,667 bp (E. intermedia), and 109,558 bp (E. equisetina). Each CP genome of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes. Eleven high-variation regions were screened through mVISTA to be potential specific DNA barcodes for identifying Ephedra species. Maximum likelihood and maximum parsimony trees showed that CP genomes could be used to identify Ephedra species. The Ephedra species had a close phylogenetic relationship with Gnetum species and Welwitschia mirabilis. This research provided valuable information for the identification and phylogenetic analysis of gymnosperms and drug safety of Ephedra.

Field Survey of Ephedra Plants in Central Asia (1). Characterization of Ephedra equisetina, Ephedra intermedia, and Their Putative Hybrids Collected in the Zaravshan Mountains of Tajikistan.

Field surveys of Ephedra plants were conducted in the Zaravshan Mountains of Tajikistan. E. equisetina, E. intermedia, and their putative hybrids were collected. They were identified based on their phenotypes and their sequences of nuclear ribosomal DNA internal transcribed spacer 1 (ITS1) region. Sequencing and species-specific PCR analyses of their ITS1 sequences revealed six putative hybrids of E. equisetina and E. intermedia. The total ephedrine and pseudoephedrine content of most of the Ephedra samples collected in Tajikistan were higher than the 0.7% lower limit prescribed by the Japanese pharmacopoeia, 17th edition (JP17), and varied from 0.34 to 3.21% by dry weight. The total alkaloid level of E. intermedia (11E08-1) cultivated in Japan varied from 1.77 to 2.30% by dry weight, which was much higher than the 0.7% lower limit prescribed by JP17.

Phylogenic Analysis and Evaluation of Ephedra Plants and Aconites for Medicinal Use.

Although Kampo medicine is now fully integrated into the modern Japanese healthcare system, most Kampo formulations depend on imported crude drugs from limited foreign areas. To prepare for possible shortages of crude drugs in the future, a wider scope for the supply of medicinal plants is necessary. We conducted field research and collaborated with international laboratories for phylogenic analysis and evaluation of medicinal plant resources. Our research on ephedra plants from a wide region of Eurasia has, for example, confirmed their phylogenic structure: based on DNA sequencing analysis of nuclear ribosomal internal transcribed spacer region 1 (ITS1) as well as the chloroplast intergenic spacer between trnL and trnF (trnL-F), the 8 major Chinese species and related plants grown on the continent could be divided into 3 groups. Additionally, Ephredra sinica was found to be synonymous with Ephredra dahurica and was reduced to a subspecies of Ephredra distachya. Furthermore, Ephredra likiangensis and Ephredra gerardiana, which are grouped in separate phylogenic trees, would be good candidates for medicinal material. Aconites from Hokkaido, as an example of domestic plants reviewed, were collected for phylogenic and aconitine alkaloid content analysis. The phylogenic analysis of nr ITSs revealed that the majority of specimens were genetically similar. However, the aconitine alkaloid content of the tuberous roots demonstrated that specimens from different habitats had varying alkaloid profiles. Environmental pressure of each habitat is presumed to have caused the morphology and aconitine alkaloid profiles of these genetically similar specimens to diversify.

Landscape genetic approaches to guide native plant restoration in the Mojave Desert.

Restoring dryland ecosystems is a global challenge due to synergistic drivers of disturbance coupled with unpredictable environmental conditions. Dryland plant species have evolved complex life-history strategies to cope with fluctuating resources and climatic extremes. Although rarely quantified, local adaptation is likely widespread among these species and potentially influences restoration outcomes. The common practice of reintroducing propagules to restore dryland ecosystems, often across large spatial scales, compels evaluation of adaptive divergence within these species. Such evaluations are critical to understanding the consequences of large-scale manipulation of gene flow and to predicting success of restoration efforts. However, genetic information for species of interest can be difficult and expensive to obtain through traditional common garden experiments. Recent advances in landscape genetics offer marker-based approaches for identifying environmental drivers of adaptive genetic variability in non-model species, but tools are still needed to link these approaches with practical aspects of ecological restoration. Here, we combine spatially explicit landscape genetics models with flexible visualization tools to demonstrate how cost-effective evaluations of adaptive genetic divergence can facilitate implementation of different seed sourcing strategies in ecological restoration. We apply these methods to Amplified Fragment Length Polymorphism (AFLP) markers genotyped in two Mojave Desert shrub species of high restoration importance: the long-lived, wind-pollinated gymnosperm Ephedra nevadensis, and the short-lived, insect-pollinated angiosperm Sphaeralcea ambigua. Mean annual temperature was identified as an important driver of adaptive genetic divergence for both species. Ephedra showed stronger adaptive divergence with respect to precipitation variability, while temperature variability and precipitation averages explained a larger fraction of adaptive divergence in Sphaeralcea. We describe multivariate statistical approaches for interpolating spatial patterns of adaptive divergence while accounting for potential bias due to neutral genetic structure. Through a spatial bootstrapping procedure, we also visualize patterns in the magnitude of model uncertainty. Finally, we introduce an interactive, distance-based mapping approach that explicitly links marker-based models of adaptive divergence with local or admixture seed sourcing strategies, promoting effective native plant restoration.

The chloroplast genome of Ephedra foeminea (Ephedraceae, Gnetales), an entomophilous gymnosperm endemic to the Mediterranean area.

This study presents the chloroplast genome of Ephedra foeminea, an entomophilous gymnosperm, sister to the remaining (wind-pollinated) species of Ephedra (Ephedraceae, Gnetales). Based on the reference-guided assembly, the length of the chloroplast genome was estimated to be 109 584 bp, comprising a large single copy region of 60 027 bp, a small single copy 8079 bp, and inverted repeat regions of 20 739 bp. In total, 118 genes were detected, including 73 protein-coding genes, eight ribosomal RNA genes, and 37 transfer RNA genes. The gene density is 1.076 (genes/kb) and the GC content is 36.7%. The genomic sequence of the entomophilous, Mediterranean species E. foeminea, differs from that of the anemophilous, Asian species E. equisetina by 1018 point mutations and 1334 indels. The detected variation is useful for future development of new plastid markers for phylogenetic purposes. Our phylogenetic analysis based on 55 protein-coding chloroplast genes resolve Ephedra as monophyletic and sister to a Gnetum-Welwitschia clade. The Gnetales are sister to Cupressophytes.

Evolutionary History of a Desert Shrub Ephedra przewalskii (Ephedraceae): Allopatric Divergence and Range Shifts in Northwestern China.

Based on two chloroplast DNA sequences, psbA-trnH and trnT-trnF, phylogeographical patterns of a desert shrub, Ephedra przewalskii, were examined across most of its geographic range in northwestern China. A total of sixteen haplotypes were detected. There was a common haplotype in each basin, that was haplotype A in Tarim Basin, haplotype G in Junggar Basin, and haplotype M in Qaidam Basin. Genetic variance mainly occurred among populations, geographic regions, and eleven geographic groups subdivided by SAMOVA analysis. E. przewalskii likely had a smaller and more fragmented geographic range during the Last Glacial Maximum, which was determined based on ecological niche modelling. Three groups of E. przewalskii populations were detected to have experience range expansion, and this was based on significant values of Fu's FS, Tajima's D, and unimodel mismatch distributions. The cold and dry climate during the glacial period of the Quaternary is postulated to have been a driver for significant genetic isolation and divergence among populations or groups in E. przewalskii, whereas the warmer and wetter climate during the interglacial period is speculated to have provided favourable conditions for range expansion of the species.

A high frequency of allopolyploid speciation in the gymnospermous genus Ephedra and its possible association with some biological and ecological features.

The origin and evolution of polyploids have been studied extensively in angiosperms and ferns but very rarely in gymnosperms. With the exception of three species of conifers, all natural polyploid species of gymnosperms belong to Ephedra, in which more than half of the species show polyploid cytotypes. Here, we investigated the origin and evolution of polyploids of Ephedra distributed in the Qinghai-Tibetan Plateau (QTP) and neighbouring areas. Flow cytometry (FCM) was used to measure the ploidy levels of the sampled species that are represented by multiple individuals from different populations, and then, two single-copy nuclear genes (LFY and DDB2) and two chloroplast DNA fragments were used to unravel the possible origins and maternal donors of the polyploids. The results indicate that the studied polyploid species are allopolyploids, and suggest that allotetraploidy is a dominant mode of speciation in Ephedra. The high percentage of polyploids in the genus could be related to some of its biological attributes such as vegetative propagation, a relatively high rate of unreduced gamete formation, and a small genome size relative to most other gymnosperms. Significant ecological divergences between allotetraploids and their putative progenitors were detected by PCAs and anova and Tukey's tests, with the exception of E. saxatilis. The overlap of geographical distributions and ecological niches of some diploid species could have provided opportunities for interspecific hybridization and allopolyploid speciation.

Phylogeographic evidence for a link of species divergence of Ephedra in the Qinghai-Tibetan Plateau and adjacent regions to the Miocene Asian aridification.

The Qinghai-Tibetan Plateau (QTP) has become one of the hotspots for phylogeographical studies due to its high species diversity. However, most previous studies have focused on the effects of the Quaternary glaciations on phylogeographical structures and the locations of glacial refugia, and little is known about the effects of the aridization of interior Asia on plant population structure and speciation. Here the chloroplast DNA (cpDNA) trnT-trnF and trnS-trnfM sequences were used to investigate the differentiation and phylogeographical history of 14 Ephedra species from the QTP and northern China, based on a sampling of 107 populations. The phylogeographical analysis, together with phylogenetic reconstruction based on combined four cpDNA fragments (rbcL, rpl16, rps4, and trnS-trnfM), supports three main lineages (eastern QTP, southern QTP, and northern China) of these Ephedra species. Divergence of each lineage could be dated to the Middle or Late Miocene, and was very likely linked to the uplift of the QTP and the Asian aridification, given the high drought and/or cold tolerance of Ephedra. Most of the Ephedra species had low intraspecific variation and lacked a strong phylogeographical structure, which could be partially attributed to clonal reproduction and a relatively recent origin. In addition, ten of the detected 25 cpDNA haplotypes are shared among species, suggesting that a wide sampling of species is helpful to investigate the origin of observed haplotypes and make reliable phylogeographical inference. Moreover, the systematic positions of some Ephedra species are discussed.

[Genetic relationship analysis of Ephedra intermedia from different habitat in Gansu by ISSR analysis].

OBJECTIVE: To investigate the genetic relationship of Ephedra intermedia from different habitats in Gansu. METHODS: The genetic diversity and genetic relationship of E. intermedia from different habitats in Gansu were studied by ISSR molecular marker technique. RESULTS: Twelve ISSR primers were selected from 70 ISSR primers and used for ISSR amplification. Total 112 loci were amplified, in which 81 were polymorphic loci, the average percentage of polymorphie bands (PPB) was 72.32%. Clustering results indicated that the wild species and cultivating species were clustered into different group. The wild species, which had closer distance, were clustered into a group. CONCLUSION: E. intermedia of different habitats in Gansu have rich genetic diversities among species, it is the reason that E. intermedia has strong adaptability and wide distribution. Further, the genetic distance of E. intermedia is associated with geographical distance, the further distance can hinder the gene flow.

Diversification in North American arid lands: niche conservatism, divergence and expansion of habitat explain speciation in the genus Ephedra.

A lineage of 12 arid land shrubby species in the gymnosperm genus Ephedra (Gnetales) from North America is used to evaluate the influence of climate on speciation. With a long evolutionary history, and a well documented fossil record this lineage is an ideal model for understanding the process of speciation under a niche conservatism scenario. Using seven DNA molecular markers, Bayesian inference is carried out to uncover sister species and to estimate time of divergence of the lineages. Ecological niche models are generated for four parapatric and sympatric sister species and two analyses of niche evolution are performed, one based on ecological niche models and another using raw data and multivariate analysis. As previous analyses suggest, the diversification of North America Ephedra species may be the result of a recent secondary radiation. Both parapatric and sympatric species diverged mostly in a scenario of climatic niche conservatism. However, we also found strong evidence for niche divergence for one of the sister species pairs (E. californica-E. trifurca). Moreover, the multivariate analysis found environmental differences for some variables between sister species. The estimated divergence time of three pairs of sister species distributed in southwestern North America (E. cutleri-E. aspera, E. californica-E. trifurca and E. torreyana-E. viridis) is inferred to have occurred in the Late Miocene to Pliocene and for the sister species pair E. antisyphilitica-E. coryi distributed in the southern United States and northeastern Mexico, it was inferred from the Pliocene to Pleistocene. The orogenetic and climatic changes documented for these regions related to expansion of arid lands, may have contributed to the diversification in North American Ephedra, rather than adaptations to new climatic conditions.

Deep sequencing of plant and animal DNA contained within traditional Chinese medicines reveals legality issues and health safety concerns.

Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when plant reference databases become better established.

Genetic diversity of Ephedra plants in mongolia inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

Ephedrae herba has been used for treating colds, relieving coughs and asthma from ancient times. We previously reported the distribution of Ephedra sinica, E. equisetina, E. przewalskii, E. regeliana, E. monosperma and Ephedra sp. in Mongolia, and among them E. sinica and E. equisetina were potential new resources of Ephedrae herba of Japanese pharmacopoeia grade, based on our field survey and subsequent molecular and chemical assessments. However, the Ephedra population in southwestern areas showed a high possibility of having hybrid origins. Further field surveys in southwestern areas, and sequence analysis of the partial nuclear internal transcribed spacer 1 (ITS1) region, besides trnK and 18S ribosomal RNA (rRNA) gene regions, were conducted in order to obtain detailed evidence of hybridization status. As a result, the distribution of E. glauca in western area and E. lomatolepis in western-most area was confirmed. The ITS sequences from all 8 Ephedra species collected in Mongolia were roughly divided into 5 types (types I-V). Type II sequence, having several additive nucleotides, was found in Ephedra sp., E. glauca, E. regeliana and E. sinica, which provided useful information for tracing hybrid origins. Morphological, genetic and distribution evidence suggested that the hybridization of Ephedra species occurred widely in southwestern Mongolia, and several Ephedra species including E. przewalkskii and E. intermedia were involved in these events. Integrated with our previous report, trnK-, 18S- and ITS-types from pure lines of each species are proposed. In addition, we propose a practicable method for detecting additive peaks on a direct sequencing electropherogram.

A novel Au SINE sequence found in a gymnosperm.

Although many SINE families have been identified in the animal kingdom, only a few SINE families have been identified in plants, and their distribution is somewhat limited. The Au SINE (Au) has been found discontinuously in basal angiosperms, monocots, and eudicots. In this study, we examined the presence of the Au in gymnosperms and ferns by PCR using internal primers for Au. As a result, we found Au in a gymnosperm species, Ephedra ciliata. Therefore, Au was supposed to be present in the common ancestor of angiosperms and gymnosperms. The Au in E. ciliate was 15 bp shorter than the consensus sequence, which is similar to the Au SINE found in Glycine. However, the 3'end of the Au found in E. ciliate was more similar to the 3'end of the Medicago-type Au than that of the Glycine-type Au. A phylogenetic tree indicated that the Au sequence from E. ciliate is more closely related to the sequence found in Glycine than that found in Medicago/Lotus. These results indicated that Au were present in both angiosperms and gymnosperms.

Parallel structural evolution of auxin response factors in the angiosperms.

Here we analyze the structural evolution of the paralogous transcription factors ETTIN (ETT/ARF3) and AUXIN RESPONSE FACTOR 4 (ARF4), which control the development of floral organs and leaves in the model angiosperm Arabidopsis. ETT is truncated at its C terminus, and consequently lacks two regulatory domains present in most other ARFs, including ARF4. Our analysis indicates ETT and ARF4 to have been generated by the duplication of a non-truncated ARF gene prior to the radiation of the extant angiosperms. We furthermore show that either ETT or ARF4 orthologs have become modified to encode truncated ARF proteins, lacking C-terminal regulatory domains, in representatives of three groups that separated early in angiosperm evolution: Amborellales, Nymphaeales and the remaining angiosperm clade. Interestingly, the production of truncated ARF4 transcripts in Amborellales occurs through an alternative splicing mechanism, rather than through a permanent truncation, as in the other groups studied. To gain insight into the potential functional significance of truncations to ETT and ARF4, we tested the capacity of native, truncated and chimeric coding sequences of these genes to restore a wild-type phenotype to Arabidopsis ett mutants. We discuss the results of this analysis in the context of the structural evolution of ARF genes in the angiosperms.