Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 29
Filter
Add more filters










Publication year range
1.
Cell Mol Biol (Noisy-le-grand) ; 70(1): 143-147, 2024 Jan 31.
Article in English | MEDLINE | ID: mdl-38372102

ABSTRACT

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.


Subject(s)
Hirudo medicinalis , Leeches , Animals , Hirudo medicinalis/genetics , DNA, Ribosomal/genetics , Ponds , Leeches/genetics , DNA Primers
2.
Dev Comp Immunol ; 154: 105125, 2024 May.
Article in English | MEDLINE | ID: mdl-38158145

ABSTRACT

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.


Subject(s)
Hirudo medicinalis , Leeches , Animals , Gene Expression Profiling , Hirudo medicinalis/genetics , Hirudo medicinalis/metabolism , Leeches/genetics , Leeches/metabolism , Membrane Proteins/genetics , Neoplasm Proteins/genetics , Nerve Tissue Proteins/genetics , Proteomics , Salivary Glands/metabolism
3.
BMC Genomics ; 23(1): 76, 2022 Jan 24.
Article in English | MEDLINE | ID: mdl-35073842

ABSTRACT

BACKGROUND: Leeches are classic annelids that have a huge diversity and are closely related to people, especially medicinal leeches. Medicinal leeches have been widely utilized in medicine based on the pharmacological activities of their bioactive ingredients. Comparative genomic study of these leeches enables us to understand the difference among medicinal leeches and other leeches and facilitates the discovery of bioactive ingredients. RESULTS: In this study, we reported the genome of Whitmania pigra and compared it with Hirudo medicinalis and Helobdella robusta. The assembled genome size of W. pigra is 177 Mbp, close to the estimated genome size. Approximately about 23% of the genome was repetitive. A total of 26,743 protein-coding genes were subsequently predicted. W. pigra have 12346 (46%) and 10295 (38%) orthologous genes with H. medicinalis and H. robusta, respectively. About 20 and 24% genes in W. pigra showed syntenic arrangement with H. medicinalis and H. robusta, respectively, revealed by gene synteny analysis. Furthermore, W. pigra, H. medicinalis and H. robusta expanded different gene families enriched in different biological processes. By inspecting genome distribution and gene structure of hirudin, we identified a new hirudin gene g17108 (hirudin_2) with different cysteine patterns. Finally, we systematically explored and compared the active substances in the genomes of three leech species. The results showed that W. pigra and H. medicinalis exceed H. robusta in both kinds and gene number of active molecules. CONCLUSIONS: This study reported the genome of W. pigra and compared it with other two leeches, which provides an important genome resource and new insight into the exploration and development of bioactive molecules of medicinal leeches.


Subject(s)
Hirudo medicinalis , Leeches , Animals , Genome , Genomics , Hirudo medicinalis/genetics , Humans , Leeches/genetics
4.
Sci Rep ; 10(1): 9885, 2020 06 18.
Article in English | MEDLINE | ID: mdl-32555498

ABSTRACT

The European medicinal leech has been used for medicinal purposes for millennia, and continues to be used today in modern hospital settings. Its utility is granted by the extremely potent anticoagulation factors that the leech secretes into the incision wound during feeding and, although a handful of studies have targeted certain anticoagulants, the full range of anticoagulation factors expressed by this species remains unknown. Here, we present the first draft genome of the European medicinal leech, Hirudo medicinalis, and estimate that we have sequenced between 79-94% of the full genome. Leveraging these data, we searched for anticoagulation factors across the genome of H. medicinalis. Following orthology determination through a series of BLAST searches, as well as phylogenetic analyses, we estimate that fully 15 different known anticoagulation factors are utilized by the species, and that 17 other proteins that have been linked to antihemostasis are also present in the genome. We underscore the utility of the draft genome for comparative studies of leeches and discuss our results in an evolutionary context.


Subject(s)
Anticoagulants/metabolism , Genome , Hirudo medicinalis/genetics , Animals , Anticoagulants/classification , DNA/chemistry , DNA/genetics , DNA/metabolism , DNA Copy Number Variations/genetics , Hemostasis , Hirudins/classification , Hirudins/genetics , Hirudins/metabolism , Organic Chemicals/classification , Organic Chemicals/metabolism , Phylogeny , Tandem Repeat Sequences/genetics
5.
Parasitol Res ; 119(6): 1767-1775, 2020 Jun.
Article in English | MEDLINE | ID: mdl-32363441

ABSTRACT

The hirudin-like factors 3 (HLF3) and 4 (HLF4) belong to a new class of leech-derived factors and are present in specimens of the three European medicinal leeches, Hirudo medicinalis, Hirudo verbana, and Hirudo orientalis, respectively. Here we describe the functional analysis of natural and synthetic variants of HLF3 and HLF4. Whereas the natural variants display only very low or no detectable anti-coagulatory activities, modifications within the N-termini in combination with an exchange of the central globular domain have the potency to greatly enhance the inhibitory effects of respective HLF3 and HLF4 variants on blood coagulation. Our results support previous observations on the crucial importance of all parts (both the N- and C-termini as well as the central globular domains) of hirudin and HLF molecules for thrombin inhibition.


Subject(s)
Hirudins/metabolism , Leeches/chemistry , Amino Acid Sequence , Animals , Blood Coagulation , Hirudins/chemistry , Hirudins/genetics , Hirudo medicinalis/chemistry , Hirudo medicinalis/genetics , Leeches/classification , Leeches/genetics , Protein Domains , Recombinant Proteins/chemistry , Recombinant Proteins/genetics , Recombinant Proteins/metabolism , Structure-Activity Relationship , Thrombin/antagonists & inhibitors
6.
BMC Genomics ; 21(1): 331, 2020 Apr 29.
Article in English | MEDLINE | ID: mdl-32349672

ABSTRACT

BACKGROUND: Salivary cell secretion (SCS) plays a critical role in blood feeding by medicinal leeches, making them of use for certain medical purposes even today. RESULTS: We annotated the Hirudo medicinalis genome and performed RNA-seq on salivary cells isolated from three closely related leech species, H. medicinalis, Hirudo orientalis, and Hirudo verbana. Differential expression analysis verified by proteomics identified salivary cell-specific gene expression, many of which encode previously unknown salivary components. However, the genes encoding known anticoagulants have been found to be expressed not only in salivary cells. The function-related analysis of the unique salivary cell genes enabled an update of the concept of interactions between salivary proteins and components of haemostasis. CONCLUSIONS: Here we report a genome draft of Hirudo medicinalis and describe identification of novel salivary proteins and new homologs of genes encoding known anticoagulants in transcriptomes of three medicinal leech species. Our data provide new insights in genetics of blood-feeding lifestyle in leeches.


Subject(s)
Genome , Hirudo medicinalis/genetics , Salivary Proteins and Peptides/genetics , Animals , Anticoagulants/metabolism , Gene Expression Profiling , Gene Expression Regulation , Hirudo medicinalis/metabolism , Leeches/classification , Leeches/genetics , Leeches/metabolism , Proteomics , Saliva/metabolism , Salivary Proteins and Peptides/metabolism
7.
Mol Omics ; 14(5): 352-361, 2018 10 08.
Article in English | MEDLINE | ID: mdl-30239540

ABSTRACT

Leeches (family Hirudinidae) are classic model invertebrates used in diverse clinical treatments, such as reconstructive microsurgery, hypertension, and gangrene treatment. The blood-feeding habit is essential for these therapies, yet the molecular mechanisms underlying the process are poorly understood. In the present study, the transcriptome of Poecilobdella javanica from five time points (days 0, 1, 10, 20, and 30 separately) of blood feeding was sequenced with short paired-end reads. After stringent quality control, ∼380 million high-quality reads were assembled using SOAPdenovo-Trans with optimal parameters into a non-redundant set of 48 784 transcripts (≥100 base pairs), representing about 38 Mb of unique transcriptome sequence. The average length of the transcripts was 570 bp with N50 lengths of 5751 to 7413 bp among different time points. We have assessed the effect of sequence quality and various assembly parameters on the final assembly output. Functional categorization revealed the conservation of genes involved in various biological processes, such as basal transcription factors and ribosome biogenesis in eukaryotes. In addition, we found that DNA/RNA related pathways were predominantly expressed in the starving state while fatty acid metabolism, the anticoagulant pathway, and amino acid biosynthesis were activated during blood feeding. The leech transcriptome provides a resource for gene discovery and development of functional molecular markers during clinical applications.


Subject(s)
High-Throughput Nucleotide Sequencing , Hirudo medicinalis/genetics , Plastic Surgery Procedures/methods , Transcriptome/genetics , Animals , Gangrene/therapy , Gene Expression Regulation/genetics , Hypertension/therapy , Molecular Sequence Annotation , Sequence Analysis, RNA
8.
PLoS One ; 13(7): e0201206, 2018.
Article in English | MEDLINE | ID: mdl-30028871

ABSTRACT

The medicinal leech is one of the most venerated model systems for the study of fundamental nervous system principles, ranging from single-cell excitability to complex sensorimotor integration. Yet, molecular analyses have yet to be extensively applied to complement the rich history of electrophysiological study that this animal has received. Here, we generated the first de novo transcriptome assembly from the entire central nervous system of Hirudo verbana, with the goal of providing a molecular resource, as well as to lay the foundation for a comprehensive discovery of genes fundamentally important for neural function. Our assembly generated 107,704 contigs from over 900 million raw reads. Of these 107,704 contigs, 39,047 (36%) were annotated using NCBI's validated RefSeq sequence database. From this annotated central nervous system transcriptome, we began the process of curating genes related to nervous system function by identifying and characterizing 126 unique ion channel, receptor, transporter, and enzyme contigs. Additionally, we generated sequence counts to estimate the relative abundance of each identified ion channel and receptor contig in the transcriptome through Kallisto mapping. This transcriptome will serve as a valuable community resource for studies investigating the molecular underpinnings of neural function in leech and provide a reference for comparative analyses.


Subject(s)
Hirudo medicinalis/metabolism , Transcriptome , Animals , Central Nervous System/metabolism , Gene Expression Profiling , Hirudo medicinalis/genetics
9.
Dokl Biol Sci ; 466: 42-4, 2016.
Article in English | MEDLINE | ID: mdl-27021369

ABSTRACT

The first comparison of the spectra of free amino acids in tissues of the medicinal leeches H. medicinalis from different climatic and geographical Eurasian areas has been performed. Adaptation of H. medicinalis to extreme climatic conditions occurs via intensification of the amino acid metabolism resulting from a significant increase in the content of essential amino acids. Accumulation of arginine, histidine, and lysine (3.6-, 3.9-, and 2.0-fold increases, respectively) has proved to play a special protective role in adaptation of H. medicinalis to the low positive temperatures.


Subject(s)
Acclimatization/physiology , Hirudo medicinalis/physiology , Acclimatization/genetics , Animals , Arginine/metabolism , Hirudo medicinalis/genetics , Hirudo medicinalis/metabolism , Histidine/metabolism , Lysine/metabolism , Sequence Analysis, DNA
10.
Mol Genet Genomics ; 291(1): 227-40, 2016 Feb.
Article in English | MEDLINE | ID: mdl-26267058

ABSTRACT

Blood-sucking leeches like the medicinal leech, Hirudo medicinalis, have been used for medical purposes since ancient times. During feeding, medicinal leeches transfer a broad range of bioactive substances into the host's wound to prevent premature hemostasis and blood coagulation. Hirudin is probably the best known of these substances. Despite its long history of investigation, recombinant production and clinical use, there still exist conflicting data regarding the primary structure of hirudin. Entirely unclear is the potential biological significance of three different subtypes and many isoforms of hirudins that have been characterized so far. Furthermore, there is only incomplete information on their cDNA sequences and no information at all on gene structures and DNA sequences are available in the databases. Our efforts to fill these gaps revealed the presence of multiple hirudin-encoding genes in the genome of Hirudo medicinalis. We have strong evidence for the expression of all three subtypes of hirudin within individual leeches and for the expression of additional hirudins or hirudin-like factors that may have different biological functions and may be promising candidates for new drugs.


Subject(s)
Hirudins/genetics , Hirudo medicinalis/genetics , Leeches/genetics , Amino Acid Sequence , Animals , Molecular Sequence Data , Sequence Alignment
11.
Biologicals ; 43(6): 479-91, 2015 Nov.
Article in English | MEDLINE | ID: mdl-26321653

ABSTRACT

Hirudin is an inhibitor of thrombin and used as an effective anticoagulant, but has a potential to develop unacceptable immune responses. In this study, two computational tools were used to predict T-cell epitopes within Hirudin variant III (HVIII) sequence, and design mutations that would lessen its antigenicity. Homology models of native and mutant HVIII proteins (T4K, S9G, V21G, and V21K) were generated, and further used to assess their interactions with thrombin. The docking experiment showed that all mutants had a suitable pattern of interactions, with similar or lower interaction energies compared with the native protein. These complexes were subsequently subjected to molecular dynamics simulation. All mutants complexes had overall stable structures over simulation time, with RMSD, gyration radius, hydrogen bonds numbers, and accessible surface areas patterns that were comparable with the native HVIII over time. Interestingly, in all mutants, a shorter length was observed for the two salt bridges Arg73-Asp55 and Arg77-Glu57, which are suggested to be important in Hirudin-thrombin complex formation. Best selected mutants expressed in Escherichia coli BL21(DE3), subsequently SDS-PAGE and Western blot analysis confirmed the successful same expression of Hirudin and mutants. In conclusion, we believe that this computational approach could identify potentially safer proteins with preserved or even improved functionality.


Subject(s)
Computational Biology/methods , Epitopes/immunology , Hirudins/genetics , Hirudo medicinalis/immunology , Mutation, Missense , Point Mutation , Amino Acid Substitution , Animals , Blotting, Western , Drug Design , Electrophoresis, Polyacrylamide Gel , Epitopes/chemistry , Epitopes/genetics , Escherichia coli , HLA-DR Antigens/immunology , HLA-DR Antigens/metabolism , Hirudins/chemistry , Hirudins/immunology , Hirudo medicinalis/genetics , Humans , Molecular Docking Simulation , Molecular Dynamics Simulation , Molecular Sequence Data , Partial Thromboplastin Time , Protein Conformation , Protein Engineering , Protein Interaction Mapping , Recombinant Fusion Proteins/immunology , Structure-Activity Relationship , Thrombin/metabolism
12.
Protein Expr Purif ; 116: 50-8, 2015 Dec.
Article in English | MEDLINE | ID: mdl-26277552

ABSTRACT

Destabilase-lysozyme (mlDL) is an enzyme secreted by the salivary gland cells of medicinal leeches. Destabilase-lysozyme possesses lysozyme and isopeptidase activities. We generated recombinant destabilase-lysozyme isoform 2 in three expression systems, i.e., in the bacteria Escherichia coli, in the yeast Pichia pastoris, and in the human cell line Expi293F. In E. coli, we generated both polypeptide in inclusion bodies that was later undergone to the refolding and soluble protein that had been fused with the chaperone SlyD. The chaperone was later cleaved by a specific TEV-protease. In cultures of the yeast P. pastoris and the human cell line Expi293F, the soluble form of destabilase-lysozyme was accumulated in the culture media. For the generated enzymes, we determined the lysozyme, isopeptidase and fibrinolytic activities and tested their general antimicrobial effects. The comparisons of the enzymes generated in the different expression systems revealed that all of the destabilase-lysozymes obtained in the soluble forms possessed equal levels of lysozyme, isopeptidase and fibrinolytic activities that exceeded several to ten times the levels of the same activities of the destabilase-lysozyme renaturated from the inclusion bodies. A similar pattern of the differences in the levels of the general antimicrobial effects was observed for the destabilase-lysozymes generated in the soluble form and as inclusion bodies.


Subject(s)
Endopeptidases/genetics , Hirudo medicinalis/enzymology , Hirudo medicinalis/genetics , Muramidase/genetics , Animals , Anti-Bacterial Agents/chemistry , Anti-Bacterial Agents/metabolism , Anti-Bacterial Agents/pharmacology , Bacteria/drug effects , Bacterial Infections/drug therapy , Cell Line , Cloning, Molecular/methods , Endopeptidases/chemistry , Endopeptidases/metabolism , Escherichia coli/genetics , Fibrinolytic Agents/chemistry , Fibrinolytic Agents/metabolism , Fibrinolytic Agents/pharmacology , Hirudo medicinalis/chemistry , Humans , Muramidase/chemistry , Muramidase/metabolism , Pichia/genetics , Protein Refolding , Recombinant Proteins/chemistry , Recombinant Proteins/genetics , Recombinant Proteins/metabolism , Solubility
13.
Sci Data ; 2: 150015, 2015.
Article in English | MEDLINE | ID: mdl-25977819

ABSTRACT

The study of non-model organisms stands to benefit greatly from genetic and genomic data. For a better understanding of the molecular mechanisms driving neuronal development, and to characterize the entire leech Hirudo medicinalis central nervous system (CNS) transcriptome we combined Trinity for de-novo assembly and Illumina HiSeq2000 for RNA-Seq. We present a set of 73,493 de-novo assembled transcripts for the leech, reconstructed from RNA collected, at a single ganglion resolution, from the CNS. This set of transcripts greatly enriches the available data for the leech. Here, we share two databases, such that each dataset allows a different type of search for candidate homologues. The first is the raw set of assembled transcripts. This set allows a sequence-based search. A comprehensive analysis of which revealed 22,604 contigs with high e-values, aligned versus the Swiss-Prot database. This analysis enabled the production of the second database, which includes correlated sequences to annotated transcript names, with the confidence of BLAST best hit.


Subject(s)
Central Nervous System , Databases, Genetic , Hirudo medicinalis/genetics , Transcriptome , Animals , Base Sequence , Central Nervous System/physiology , Hirudo medicinalis/anatomy & histology
14.
Bioorg Khim ; 38(2): 229-33, 2012.
Article in Russian | MEDLINE | ID: mdl-22792727

ABSTRACT

Based on three-dimensional model of the bifunctional enzyme Destabilase-Lysozyme (mlDL-Ds2) in complex with trimer of N-acetylglucosoamine (NAG)3 the functional role of the stereochemically based group of amino acids (Glu14, Asp26, Ser 29, Ser31, Lys38, His92), in manifestation of glycosidase and isopeptidase activities has been elucidated. By method of site-directed mutagenesis it has been shown that mlDL glycosidase active site includes catalytic Glu14 and Asp26, and isopeptidase site functions as Ser/Lys dyad presented by catalytic residues Lys38 and Ser29. Thus, among the invertebrate lysozymes mlDL presents first example of the bifunctional enzyme with identified position of the isopeptidase active site and localization of the corresponding catalytic residues.


Subject(s)
Endopeptidases/chemistry , Hirudo medicinalis/enzymology , Amino Acid Substitution , Animals , Catalytic Domain , Endopeptidases/genetics , Hirudo medicinalis/genetics , Mutagenesis, Site-Directed , Mutation, Missense , Structure-Activity Relationship
15.
Mol Phylogenet Evol ; 63(2): 475-85, 2012 May.
Article in English | MEDLINE | ID: mdl-22342869

ABSTRACT

Medicinal leeches (Hirudo spp.) are among the best-studied invertebrates in many aspects of their biology. Yet, relatively little is known about their biogeography, ecology and evolution. Previous studies found vast ranges but suggested low genetic diversity for some species. To examine this apparent contradiction, the phylogeny and phylogeography of the widespread Hirudo verbana, Hirudo medicinalis and Hirudo orientalis were investigated in a comparative manner. Populations from across their ranges in Europe, Asia Minor, the Caucasus and Central Asia, were analyzed by various phylogenetic and population genetic approaches using both mitochondrial (COI and 12S) and nuclear DNA sequences (ITS1, 5.8S and ITS2). The populations showed surprisingly little genetic differentiation despite vast ranges. The only clear structure was observed in H. verbana. This species is subdivided into an Eastern (southern Ukraine, North Caucasus, Turkey and Uzbekistan) and a Western phylogroup (Balkans and Italy). The two phylogroups do not overlap, suggesting distinct postglacial colonization from separate refugia. Leeches supplied by commercial facilities belong to the Eastern phylogroup of H. verbana; they originate from Turkey and the Krasnodar Territory in Russia, two leading areas of leech export. H. verbana and H. medicinalis have experienced recent rapid population growth and range expansion, while isolation by distance has shaped the genetic setup of H. orientalis. The habitat of the latter is patchy and scattered about inhospitable arid and alpine areas of Central Asia and Transcaucasia. Centuries of leech collecting and transport across Europe seem not to have affected the natural distribution of genetic diversity, as the observed patterns can be explained by a combination of historical factors and present day climatic influences.


Subject(s)
Hirudo medicinalis/classification , Hirudo medicinalis/genetics , Phylogeny , Phylogeography , Animals , Base Sequence , Biological Evolution , DNA, Intergenic/genetics , DNA, Mitochondrial/genetics , DNA, Ribosomal/genetics , Genetic Drift , Genetic Variation , Genetics, Population , Molecular Sequence Data , RNA, Ribosomal/genetics , Sequence Analysis, DNA
16.
Biotechnol Lett ; 34(1): 61-5, 2012 Jan.
Article in English | MEDLINE | ID: mdl-21901343

ABSTRACT

Hirudin can be used as an oral anticoagulant and antithrombotic agent. The hirudin variant III gene, derived from the medicinal leech, Hirudo medicinalis, was fused to SP310mut2 signal sequence and expressed by a nisin-controlled gene expression system in Lactococcus lactis which was then grown in a 7 l fermenter. After induction with 8 ng nisin ml(-1), the product was secreted into the culture medium and accumulated up to ~2.7 mg l(-1). MALDI-TOF/MS and anticoagulant activity analyses on the purified product confirmed its authenticity. This is the first demonstration that hirudin can be extracellularly secreted and correctly processed in L. lactis.


Subject(s)
Hirudins/metabolism , Lactococcus lactis/metabolism , Protein Sorting Signals , Animals , Hirudins/chemistry , Hirudins/genetics , Hirudo medicinalis/genetics , Lactococcus lactis/genetics , Recombinant Fusion Proteins/chemistry , Recombinant Fusion Proteins/genetics , Recombinant Fusion Proteins/metabolism , Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization
17.
Parasitology ; 138(13): 1815-27, 2011 Nov.
Article in English | MEDLINE | ID: mdl-21729354

ABSTRACT

The evolutionary history of leeches is employed as a general framework for understanding more than merely the systematics of this charismatic group of annelid worms, and serves as a basis for understanding blood-feeding related correlates ranging from the specifics of gut-associated bacterial symbionts to salivary anticoagulant peptides. A variety of medicinal leech families were examined for intraluminal crop bacterial symbionts. Species of Aeromonas and Bacteroidetes were characterized with DNA gyrase B and 16S rDNA. Bacteroidetes isolates were found to be much more phylogenetically diverse and suggested stronger evidence of phylogenetic correlation than the gammaproteobacteria. Patterns that look like co-speciation with limited taxon sampling do not in the full context of phylogeny. Bioactive compounds that are expressed as gene products, like those in leech salivary glands, have 'passed the test' of evolutionary selection. We produced and bioinformatically mined salivary gland EST libraries across medicinal leech lineages to experimentally and statistically evaluate whether evolutionary selection on peptides can identify structure-function activities of known therapeutically relevant bioactive compounds like antithrombin, hirudin and antistasin. The combined information content of a well corroborated leech phylogeny and broad taxonomic coverage of expressed proteins leads to a rich understanding of evolution and function in leech history.


Subject(s)
Bacteria/growth & development , Biological Evolution , Leeches/genetics , Phylogeny , Salivary Proteins and Peptides/metabolism , Symbiosis , Aeromonas/genetics , Aeromonas/isolation & purification , Animals , Bacteria/classification , Bacteria/genetics , Bacteroidetes/genetics , Bacteroidetes/isolation & purification , DNA Gyrase/genetics , DNA, Bacterial/analysis , DNA, Ribosomal/analysis , Gammaproteobacteria/genetics , Gammaproteobacteria/isolation & purification , Gastrointestinal Tract/microbiology , Hirudo medicinalis/chemistry , Hirudo medicinalis/genetics , Hirudo medicinalis/metabolism , Leeches/chemistry , Leeches/classification , Leeches/microbiology , RNA, Ribosomal, 16S/genetics , Salivary Proteins and Peptides/chemistry , Sequence Analysis, DNA
18.
Mitochondrial DNA ; 21(6): 198-205, 2010 Dec.
Article in English | MEDLINE | ID: mdl-21171864

ABSTRACT

Species identifications based on DNA barcoding rely on the correct identity of previously barcoded specimens, but little attention has been given to whether deposited barcodes include correspondence to the species' name-bearing type. The information content associated with COX1 sequences in the two most commonly used repositories of barcodes, GenBank and the Barcode of Life Data System (BOLD), is often insufficient for subsequent evaluation of the robustness of the identification procedure. We argue that DNA barcoding and taxonomy alike will benefit from more information content in the annotations of barcoded specimens as this will allow for validation and re-evaluation of the initial specimen identification. The aim should be to closely connect specimens from which reference barcodes are generated with the holotype through straight-forward taxonomy, and geographical and genetic correlations. Annotated information should also include voucher specimens and collector/identifier information. We examine two case studies based on empirical data, in which barcoding and taxonomy benefit from increased information content. On the basis of data from the first case study, we designate a barcoded neotype of the European medicinal leech, Hirudo medicinalis, on morphological and geographical grounds.


Subject(s)
DNA Barcoding, Taxonomic , Hirudo medicinalis/classification , Hirudo medicinalis/genetics , Animals , Databases, Genetic , Phylogeny , Reference Standards
19.
Protein Expr Purif ; 74(1): 122-8, 2010 Nov.
Article in English | MEDLINE | ID: mdl-20600941

ABSTRACT

The signal recognition particle (SRP) dependent secretion pathway is as an attractive alternative to Sec-dependent export for the production of disulfide-bonded and/or fast-folding recombinant proteins in the Escherichia coli periplasm. SRP, which shares a ribosomal attachment site with the molecular chaperone trigger factor (TF), recognizes highly hydrophobic signal sequence as they emerge from the ribosome and delivers ribosome nascent chain complexes to FtsY for subsequent cotranslational translocation of target proteins across the SecYEG pore. However, like in the case of Sec-dependent export, secretory yields can be limited by the accumulation of precursor proteins in the cytoplasm. Using leech carboxypeptidase inhibitor (LCI) fused to the SRP-dependent DsbA signal sequence as a model system, we show that a null mutation in the gene encoding TF (Deltatig) or SRP co-expression reduce pre-LCI accumulation by half, and that quantitative export can be achieved by combining the two strategies. Interestingly, enhanced precursor processing did not alter periplasmic LCI levels but increased the amount of protein excreted in the growth medium. All mature LCI was nearly fully active and an 80% increase in productivity was achieved in Deltatig cells alone due to their faster growth. Our results show that competition between SRP and TF can interfere with efficient export of recombinant proteins targeted to the SRP pathway and establish TF-deficient strains and SRP co-expression as a simple solution to improve yields.


Subject(s)
Escherichia coli Proteins/metabolism , Escherichia coli/genetics , Hirudo medicinalis/genetics , Peptidylprolyl Isomerase/metabolism , Protein Disulfide-Isomerases/metabolism , Proteins/genetics , Signal Recognition Particle/metabolism , Animals , Escherichia coli Proteins/genetics , Gene Expression , Gene Expression Regulation, Bacterial , Peptidylprolyl Isomerase/genetics , Protein Disulfide-Isomerases/genetics , Protein Transport , Proteins/isolation & purification , Proteins/metabolism , Signal Recognition Particle/genetics
20.
BMC Genomics ; 11: 407, 2010 Jun 25.
Article in English | MEDLINE | ID: mdl-20579359

ABSTRACT

BACKGROUND: The medicinal leech, Hirudo medicinalis, is an important model system for the study of nervous system structure, function, development, regeneration and repair. It is also a unique species in being presently approved for use in medical procedures, such as clearing of pooled blood following certain surgical procedures. It is a current, and potentially also future, source of medically useful molecular factors, such as anticoagulants and antibacterial peptides, which may have evolved as a result of its parasitizing large mammals, including humans. Despite the broad focus of research on this system, little has been done at the genomic or transcriptomic levels and there is a paucity of openly available sequence data. To begin to address this problem, we constructed whole embryo and adult central nervous system (CNS) EST libraries and created a clustered sequence database of the Hirudo transcriptome that is available to the scientific community. RESULTS: A total of approximately 133,000 EST clones from two directionally-cloned cDNA libraries, one constructed from mRNA derived from whole embryos at several developmental stages and the other from adult CNS cords, were sequenced in one or both directions by three different groups: Genoscope (French National Sequencing Center), the University of Iowa Sequencing Facility and the DOE Joint Genome Institute. These were assembled using the phrap software package into 31,232 unique contigs and singletons, with an average length of 827 nt. The assembled transcripts were then translated in all six frames and compared to proteins in NCBI's non-redundant (NR) and to the Gene Ontology (GO) protein sequence databases, resulting in 15,565 matches to 11,236 proteins in NR and 13,935 matches to 8,073 proteins in GO. Searching the database for transcripts of genes homologous to those thought to be involved in the innate immune responses of vertebrates and other invertebrates yielded a set of nearly one hundred evolutionarily conserved sequences, representing all known pathways involved in these important functions. CONCLUSIONS: The sequences obtained for Hirudo transcripts represent the first major database of genes expressed in this important model system. Comparison of translated open reading frames (ORFs) with the other openly available leech datasets, the genome and transcriptome of Helobdella robusta, shows an average identity at the amino acid level of 58% in matched sequences. Interestingly, comparison with other available Lophotrochozoans shows similar high levels of amino acid identity, where sequences match, for example, 64% with Capitella capitata (a polychaete) and 56% with Aplysia californica (a mollusk), as well as 58% with Schistosoma mansoni (a platyhelminth). Phylogenetic comparisons of putative Hirudo innate immune response genes present within the Hirudo transcriptome database herein described show a strong resemblance to the corresponding mammalian genes, indicating that this important physiological response may have older origins than what has been previously proposed.


Subject(s)
Central Nervous System/immunology , Databases, Genetic , Gene Expression Profiling , Hirudo medicinalis/genetics , Hirudo medicinalis/immunology , Immunity, Innate/genetics , Sequence Homology, Nucleic Acid , Adaptive Immunity/genetics , Animals , Antigens, CD/genetics , Antimicrobial Cationic Peptides/genetics , Central Nervous System/metabolism , Central Nervous System/physiology , Cytokines/genetics , Databases, Nucleic Acid , Expressed Sequence Tags/metabolism , Hirudo medicinalis/embryology , Humans , RNA, Messenger/genetics , Receptors, Pattern Recognition/genetics , Regeneration/genetics , Species Specificity , Toll-Like Receptors/genetics
SELECTION OF CITATIONS
SEARCH DETAIL
...