Exploring Barbronia species diversity and phylogenetic relationship within Suborder Erpobdelliformes (Clitellata: Annelida).

Background: Barbronia, a genus of freshwater macrophagous leeches, belongs to Erpobdelliformes (Salifidae: Clitellata: Annelida), and B. weberi, a well-known leech within this genus, has a worldwide distribution. However, the systematics of Barbronia have not yet been adequately investigated, primarily due to a few molecular markers, and only 20 Barbronia sequences available in the GenBank database. This gap significantly limits our understanding of the Barbronia species identification, as well as the phylogenetic placement of the genus Barbronia within Salifidae. Methods: Next-generation sequencing (NGS) was used to simultaneously capture the entire mitochondrial genome and the full-length 18S/28S rDNA sequences. The species boundary of Barbronia species was estimated using bGMYC and bPTP methods, based on all available Barbronia COI sequences. Uncorrected COI p-distance was calculated in MEGA. A molecular data matrix consisting of four loci (COI, 12S, 18S, and 28S rDNA) for outgroups (three Haemopis leeches) and 49 erpobdellid leeches, representing eight genera within the Suborder Erpobdelliformes was aligned using MAFFT and LocARNA. This matrix was used to reconstruct the phylogenetic relationship of Barbronia via Bayesian inference (BI) and the maximum likelihood (ML) method. Results: The full lengths of the mitochondrial genome, 18S and 28S rDNAs of B. cf. gwalagwalensis, are 14847 bp, 1876 bp 1876 bp, and 2863 bp, respectively. Both bGMYC and bPTP results based on COI data are generally congruent, suggesting that the previously proposed taxa (B. arcana, B. weberi formosana, and B. wuttkei or Erpobdella wuttkei) are synonyms of B. weberi. The specimens listed in the B. gwalagwalensis group, however, are split into at least two Primary Species Hypotheses (PSHs). The p-distance of the first PSH is less than 1.3% but increased to 4.5% when including the secondary PSH (i.e., B. cf. gwalagwalensis). In comparison, the interspecific p-distance between the B. weberi group and the B. gwalagwalensis group ranged from 6.4% to 8.7%, and the intraspecific p-distance within the B. weberi group is less than 0.8%. Considering the species delimitation results and the sufficient large p-distance, the specimen sampled in China is treated as B. cf. gwalagwalensis. The monophyly of the four Erpobdelliformes families Salifidae, Orobdellidae, Gastrostomobdellidae sensu stricto and Erpobdellidae is well supported in ML and BI analysis based on a data of four markers. Within the Salifidae, a well-supported Barbronia is closely related to a clade containing Odontobdella and Mimobdella, and these three genera are sister to a clade consisted of Salifa and Linta. According to the results of this study, the strategy of simultaneous obtaining both whole mitochondria and nuclear markers from extensively sampled Salifids species using NGS is expected to fathom both the species diversity of B. gwalagwalensis and the evolutionary relationship of Salifidae.

Leeches Baicalobdella torquata feed on hemolymph but have a low effect on the cellular immune response of amphipod Eulimnogammarus verrucosus from Lake Baikal.

Lake Baikal is one of the largest and oldest freshwater reservoirs on the planet with a huge endemic diversity of amphipods (Amphipoda, Crustacea). These crustaceans have various symbiotic relationships, including the rarely described phenomenon of leech parasitism on amphipods. It is known that leeches feeding on hemolymph of crustacean hosts can influence their physiology, especially under stressful conditions. Here we show that leeches Baicalobdella torquata (Grube, 1871) found on gills of Eulimnogammarus verrucosus (Gerstfeldt, 1858), one of the most abundant amphipods in the Baikal littoral zone, indeed feed on the hemolymph of their host. However, the leech infection had no effect on immune parameters such as hemocyte concentration or phenoloxidase activity and also did not affect glycogen content. The intensity of hemocyte reaction to foreign bodies in a primary culture was identical between leech-free and leech-infected animals. Artificial infection with leeches also had only a subtle effect on the course of a model microbial infection in terms of hemocyte concentration and composition. Despite we cannot fully exclude deleterious effects of the parasites, our study indicates a low influence of a few leeches on E. verrucosus and shows that leech-infected amphipods can be used at least for some types of ecophysiological experiments.

Not that many leech species after all: Myzobdella lugubris and Myzobdella patzcuarensis (Annelida: Hirudinida) are the same species.

The genus Myzobdella groups five species of leeches parasites of fishes mainly of freshwater but with tolerance to brackish waters. Native distribution of these species includes the New World from North to South America. Myzobdella lugubris Leidy, 1851, the type species of the genus, was briefly described based on specimens from the USA, but subsequently their morphology, known distribution and host range were expanded; however, less is known about the other four species of the genus. As part of a survey focusing on characterizing the diversity of leeches from Mexico, specimens of Myzobdella patzcuarensis (Caballero, 1940), from the type locality of the species were included for the first time in a phylogenetic study. In addition, specimens assigned to Myzobdella from the southeast of Mexico as well as from Nicaragua, were also included. In the resulting phylogenetic tree, our newly generated sequences were found nested in the same clade that M. lugubris; with unresolved relationships and relatively low genetic divergence, suggesting conspecificity. In addition, the internal morphology of the specimens of Myzobdella from Mexico is consistent with the description of M. lugubris. Our morphological examination reveals high degrees of variability in the external pigmentation of the specimens. Based on our results we formally synonymize M. patzcuarensis under M. lugubris.

Combined use of Panax notoginseng and leech provides new insights into renal fibrosis: Restoration of mitochondrial kinetic imbalance.

In this study, we aimed to investigate the protective effects of Panax notoginseng and leech (PL) on renal fibrosis and explore the mechanisms underlying their actions. For this study, we created an adenine-induced renal fibrosis model in SD rats to investigate the protective effect of PL on renal fibrosis and explore its underlying mechanism. Initially, we assessed the renal function in RF rats and found that Scr, BUN, and urine protein content decreased after PL treatment, indicating the protective effect of PL on renal function. Histological analysis using HE and Masson staining revealed that PL reduced inflammatory cell infiltration and decreased collagen fiber deposition in renal tissue. Subsequently, we analyzed the levels of α-SMA, Col-IV, and FN, which are the main components of the extracellular matrix (ECM), using IHC, RT-qPCR, and WB. The results demonstrated that PL was effective in reducing the accumulation of ECM, with PL1-2 showing the highest effectiveness. To further understand the underlying mechanisms, we conducted UPLC-MS/MS analysis on the incoming components of the PL1-2 group. The results revealed several associations between the differential components and antioxidant and mitochondrial functions. This was further confirmed by enzyme-linked immunosorbent assay and biochemical indexes, which showed that PL1-2 ameliorated oxidative stress by reducing ROS and MDA production and increasing GSH and SOD levels. Additionally, transmission electron microscopy results indicated that PL1-2 promoted partial recovery of mitochondrial morphology and cristae. Finally, using RT-qPCR and WB, an increase in the expression of mitochondrial fusion proteins Mfn1, Mfn2, and Opa1 after PL1-2 treatment was observed, coupled with a decline in the expression and phosphorylation of mitochondrial cleavage proteins Fis and Drp1. These findings collectively demonstrate that PL1-2 ameliorates renal fibrosis by reducing oxidative stress and restoring mitochondrial balance.

Comparative genomics of two Asian medicinal leeches Hirudo nipponia and Hirudo tianjinensis: With emphasis on antithrombotic genes and their corresponding proteins.

Leeches secrete various biologically active substances which have important medical and pharmaceutical values in antithrombotic treatments. Here, we provide a high quality genome of two Asian medicinal leeches Hirudo nipponia and Hirudo tianjinensis, based on which, we identified 22 antithrombotic gene families, including fourteen coagulation inhibitors, four platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. The total numbers of antithrombotic genes were similar between H. nipponia (N = 86) and H. tianjinensis (N = 83). Molecular evolution analysis showed that no significant differences were detected between the two species in any of the three selection indices (dN, dS, and dN/dS), nor in the number of sites under positive/purifying selection. RNA-Seq based gene expression analysis showed that the overall expression patterns of the antithrombotic gene families were not significantly deviated between the two species. Our results indicated that there were rather close similarities between the two leeches on genomic characteristics, especially for the molecular evolution and expression of antithrombotic genes. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from the two Asian medicinal leeches to date. These results will greatly facilitate the research and application of leech derivatives for medical and pharmaceutical purposes of thrombosis.

MOLECULAR PHYLOGENY OF THE LEECH GENUS PONTOBDELLA (HIRUDINIDA: PISCICOLIDAE) WITH NOTES ON PONTOBDELLA CALIFORNIANA AND PONTOBDELLA MACROTHELA.

Leech specimens of the genus Pontobdella (Hirudinida: Piscicolidae) were found off the coast of the state of Oaxaca (Pacific) as well as in Veracruz and Tabasco (Gulf of Mexico), Mexico. Based on the specimens collected in Oaxaca, a redescription of Pontobdella californiana is provided, with emphasis on the differences in the reproductive organs with the original description of the species. In addition, leech cocoons assigned to P. californiana were found attached to items hauled by gillnets and studied using scanning electron microscopy and molecular approaches. Samples of Pontobdella macrothela were found in both Pacific and Atlantic oceans, representing new geographic records. The phylogenetic position of P. californiana is investigated for the first time, and with the addition of Mexican samples of both species, the phylogenetic relationships within Pontobdella are reinvestigated. Parsimony and maximum-likelihood phylogenetic analysis were based on mitochondrial (cytochrome oxidase subunit I [COI] and 12S rRNA) and nuclear (18S rRNA and 28S rRNA) DNA sequences. Based on our results, we confirm the monophyly of Pontobdella and the pantropical distribution of P. macrothela with a new record in the Tropical Eastern Pacific.

Case report of recurrent epistaxis caused by a live leech in the nasal cavity.

RATIONALE: Epistaxis is one of the common emergencies in otolaryngology. There are many causes of epistaxis, but reports of epistaxis due to nasal foreign bodies like leeches are rare. PATIENT CONCERNS: A 55-year-old male presented with "repeated epistaxis for over 20 days." Nasal endoscopy revealed a live leech in the olfactory area of the left nostril. DIAGNOSES: The patient was diagnosed with epistaxis caused by a live leech in the nasal cavity. INTERVENTIONS: Under nasal endoscopy, the leech was grasped with a vascular clamp and removed from the nasal cavity. The leech measured 8 cm in length. Hemostasis was achieved using a gelatin sponge at the wound site, and the nasal cavity was packed with Vaseline gauze. OUTCOMES: The live leech was removed via nasal endoscopy. Two days later, the Vaseline gauze packing was removed, and the patient experienced no further nasal bleeding. CONCLUSION: Live leeches in the nasal cavity can cause epistaxis. Nasal endoscopic removal of the live leech is an effective treatment. LESSON: There are many causes of epistaxis, which are nonspecific and prone to missed or incorrect diagnosis. In patients with a history of fieldwork or direct contact with leeches who present with recurrent nasal bleeding, the possibility of epistaxis caused by a live leech should be considered, and timely and effective treatment should be provided.

Exploring a Hirudin variant from nonhematophagous leeches: Unraveling full-length sequence, alternative splicing, function, and potential as a novel anticoagulant polypeptide.

ETHNOPHARMACOLOGICAL RELEVANCE: Leeches exhibit robust anticoagulant activity, making them useful for treating cardiovascular diseases in traditional Chinese medicine. Whitmania pigra, the primary source species of leech-derived medicinal compounds in China, has been demonstrated to possess formidable anticoagulant properties. Hirudin-like peptides, recognized as potent thrombin inhibitors, are prevalent in hematophagous leeches. Considering that W. pigra is a nonhematophagic leech, the following question arises: does a hirudin variant exist in this species? AIM OF THE STUDY: In this study we identified the hirudin-encoding gene (WP_HV1) in the W. pigra genome. The goal of this study was to assess its anticoagulant activity and analyze the related mechanisms. MATERIALS AND METHODS: In this study, a hirudin-encoding gene, WP_HV1, was identified from the W. pigra genome, and its accurate coding sequence (CDS) was validated through cloning from cDNA extracted from fresh W. pigra specimens. The structure of WP_HV1 and the amino acids associated with its anticoagulant activity were determined by sequence and structural analysis and prediction of its binding energy to thrombin. E. coli was used for the expression of WP_HV1 and recombinant proteins with various structures and mutants. The anticoagulant activity of the synthesized recombinant proteins was then confirmed using thrombin time (TT). RESULTS: Validation of the WP_HV1 gene was accomplished, and three alternative splices were discovered. The TT of the blank sample exceeded that of the recombinant WP_HV1 sample by 1.74 times (0.05 mg/ml), indicating positive anticoagulant activity. The anticoagulant activity of WP_HV1 was found to be associated with its C-terminal tyrosine, along with the presence of 9 acidic amino acids on both the left and right sides. A significant reduction in the corresponding TT was observed for the mutated amino acids compared to those of the wild type, with decreases of 4.8, 6.6, and 3.9 s, respectively. In addition, the anticoagulant activity of WP_HV1 was enhanced and prolonged for 2.7 s when the lysine-67 residue was mutated to tryptophan. CONCLUSION: Only one hirudin-encoding variant was identified in W. pigra. The active amino acids associated with anticoagulation in WP_HV1 were resolved and validated, revealing a novel source for screening and developing new anticoagulant drugs.

Case Report: Profound Anemia in a 2-Year-Old Boy Associated with a Leech in the Oropharynx.

A 2-year-old boy presented to Kapsowar Mission Hospital in Kenya with a history of general tiredness associated with mild, unilateral epistaxis and one episode of hematemesis. On admission, he had a hemoglobin value of 3.5 g/dL, with a white cell count of 20.6 × 109/L. The child was examined by the physician on call, with no source of bleeding found. Later that day, after a local physician noted that the presentation could be due to an unrecognized leech infestation, a deep examination of the oropharynx was performed with a laryngoscope and revealed a leech attached deep in the oropharynx. The anesthetist visualized the leech with a laryngoscope and removed it with Magill forceps. After the procedure and blood transfusion, the child's hemoglobin level improved to 10.4 g/dL, and on the following day, the child was much improved in energy and was playing outside. He was discharged home on iron supplements and made a full recovery.

Spanish-French leech trade and its consequences: From the increase in medical demand to resource depletion and technical innovation.

This article studies the impact caused by the success and dissemination of Broussais' theories on the use of leeches as a medical supply on Spanish-French trade relations, as well as its consequences for the Spanish market between 1821 and the 1860s. Analysing the documents produced by the different public administrations, together with newspaper and archival sources in both Spain and France and the literature and legislation of that period, allows us to understand the evolution of this trade and the heavy impact it had on the autochthonous population of this animal resource. The article reveals how, at the beginning of the 1820s, leeches became an important medical supply and how the demand for them increased significantly. This gave rise to a trade relation between Spain and France that led to the overexploitation of the resource, the issuing of regulations on the matter, and the search for technological solutions to increase the production of leeches.

Some taxonomic notes on Capila translucida (Leech, 1894) and C. hainana Crowley, 1900 (Hesperiidae, Pyrginae).

Based on a comparison of the 658 bp COI gene sequence and adult morphology, the intraspecific variability of Capila translucida (Leech, 1894) is clarified, and both C. hainana hainana Crowley, 1900 syn. n. and C. hainana sinorientalis Huang & Ding, 1994 syn. n., of which the males are still unknown so far, are considered as junior subjective synonyms of C. translucida. The taxonomic history of the involved taxa is reviewed. Adults and genitalia of both sexes of C. translucida are illustrated.

Terrestrial predatory leeches of the genus Orobdella (Hirudinea: Erpobdelliformes: Orobdellidae) endemic to the Southern Russian Far East: a new species of the genus from Primorsky Krai, Russia.

A quadrannulate species, Orobdella ganini sp. nov., is described from the Lazovsky Nature Reserve in Primorsky Krai, the Southern Russian Far East, Russia. Morphological features of O. ghilarovi Nakano & Prozorova, 2019 from the reserve are also provided leading to an amendment of the species diagnosis. Maximum likelihood and Bayesian inference phylogenetic analyses, which were performed using nuclear 18S rRNA, 28S rRNA, and histone H3, and mitochondrial cytochrome c oxidase subunit I, tRNACys, tRNAMet, 12S rRNA, tRNAVal, 16S rRNA, tRNALeu and NADH dehydrogenase subunit 1 markers, show that O. ganini sp. nov., O. ghilarovi and two species endemic to Hokkaido, Japan form a clade, with the new species sister to a lineage composed of the two Japanese species. A partial cytochrome c oxidase subunit I sequence obtained from a cocoon found in the Lazovsky Nature Reserve reveals that Orobdella leeches deposit cocoons somewhat similar to those deposited by terrestrial blood-sucking leeches of Haemadipsidae.

A new subspecies of Aporia procris Leech, 1890 hidden in Sichuan, China (Lepidoptera, Pieridae).

Further information on the distribution of Aporia procris Leech, 1890 is provided. The population of A. procris from the upper Dadu River, W. Sichuan, previously recognized as ssp. yaozhui Huang, 2021, is treated as a new subspecies, viz., A. p. huangsiyaoi ssp. nov., based upon evidence from external features, with its genital and molecular characters given.

A reevaluation and redescription of the branchiobdellidan Sathodrilus tetrodonta (Pierantoni, 1906) new comb. (Annelida: Clitellata).

The questionable status of Branchiobdella tetrodonta Pierantoni, 1906 is resolved and the species is transferred to the correct genus. The original description was made from specimens removed from signal crayfish collected in California, USA, unfortunately, Pierantoni (1906c) did not designate any type specimens nor where the preparations were deposited; they are now presumed lost. Holt (1967) believed B. tetrodonta possessed unique penial hooks and a chitinous sheath which was due to his mistranslation of the original Italian description. As a result, Sathodrilus attenuatus Holt, 1981, was described even though specimens came from the same area and host and possessed very similar jaw characteristics to B. tetrodonta. In addition, the jaw characteristics of both endemic species are unique in the Pacific Ocean drainage of the USA. A reassessment of the literature and re-examination of Holts type specimens has resulted in the species name becoming a new combination, Sathodrilus tetrodonta (Pierantoni, 1906), with Sathodrilus attenuatus Holt, 1981, as its junior synonym.

Biomechanics of transduction by mechanosensory cilia for prey detection in aquatic organisms.

Surface-feeding aquatic animals navigate towards the source of water disturbances and must differentiate prey from other environmental stimuli. Medicinal leeches locate prey, in part, using a distribution of mechanosensory hairs along their body that deflect under fluid flow. Leech's behavioral responses to surface wave temporal frequency are well documented. However, a surface wave's temporal frequency depends on many underlying environmental and fluid properties that vary substantially in natural habitats (e.g., water depth, temperature). The impact of these variables on neural response and behavior is unknown. Here, we developed a physics-based leech mechanosensor model to examine the impact of environmental and fluid properties on neural response. Our model used the physical properties of a leech cilium and was verified against existing behavioral and electrophysiological data. The model's peak response occurred with waves where the effects of gravity and surface tension were nearly equal (i.e., the phase velocity minimum). This suggests that preferred stimuli are related to the interaction between fundamental properties of the surrounding medium and the mechanical properties of the sensor. This interaction likely tunes the sensor to detect the nondispersive components of the signal, filtering out irrelevant ambient stimuli, and may be a general property of cilia across the animal kingdom.

Species-specific oxylipins and the effects of ontogeny and predation on their emission from freshwater snails.

Chemical cues play important roles in mediating ecological interactions. Oxylipins, oxygenated metabolites of fatty acids, are one signalling molecule type that influences the physiology and function of species, suggesting their broader significance in chemical communication within aquatic systems. Yet, our current understanding of their function is restricted taxonomically and contextually making it difficult to infer their ecological significance. Snails and leeches are ubiquitous in freshwater ecosystems worldwide, yet little is known about their oxylipin profiles and the factors that cause their profiles to change. As snails and leeches differ taxonomically and represent different trophic groups, we postulated oxylipin profile differences. For snails, we hypothesized that ontogeny (non-reproductive vs reproductive) and predation (non-infested vs leech-infested) would affect oxylipin profiles. Oxylipins were characterized from water conditioned with the snail Planorbella duryi and leech Helobdella lineata, and included three treatment types (snails, leeches, and leech-infested snails) with the snails consisting of three size classes: small (5-6 mm, non-reproductive) and medium and large (13-14 and 19-20 mm, reproductive). The two species differed in the composition of their oxylipin profiles both in diversity and amounts. Further, ontogeny and predation affected the diversity of oxylipins emitted by snails. Our experimental profiles of oxylipins show that chemical cues within freshwater systems vary depending upon the species emitting the signals, the developmental stage of the species, as well as from ecological interactions such as predation. We also identified some candidates, like 9-HETE and PGE2, that could be explored more directly for their physiological and ecological roles in freshwater systems.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes.

Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.

Dynamic relationship among extracellular matrix and body wall cells in Hirudo verbana morphogenesis.

A great bulk of recent experimental evidence suggests the key role of the complex crosstalk between the extracellular matrix (ECM) and the cellular component of tissues during morphogenesis and embryogenesis. In particular, remodeling of the ECM and of its physical interactions pattern with surrounding cells represent two crucial processes that might be involved in muscle development. However, little information is available on this topic, especially on invertebrate species. To obtain new insights on how tuning the ECM microenvironment might drive cellular fate during embryonic development, we used the invertebrate medicinal leech Hirudo verbana as a valuable experimental model, due to its simple anatomy and the recapitulation of many aspects of the basic biological processes of vertebrates. Our previous studies on leech post-embryonic development have already shown the pivotal role of ECM changes during the growth of the body wall and the role of Yes-associated protein 1 (YAP1) in mechanotransduction. Here, we suggest that the interactions between stromal cell telocytes and ECM might be crucial in driving the organization of muscle layers during embryogenesis. Furthermore, we propose a possible role of the pleiotropic enzyme HvRNASET2 as a possible modulator of collagen deposition and ECM remodeling not only during regenerative processes (as previously demonstrated) but also in embryogenesis.

Research progress on the treatment of diabetic nephropathy with leech and its active ingredients.

Diabetic nephropathy (DN) is a major microvascular complication of diabetes and a common cause of chronic kidney disease. There is currently a lack of effective treatments for DN, and the prognosis for patients remains poor. Hirudin, one of the primary active components derived from leeches, demonstrates anti-coagulant, anti-fibrotic, anti-thrombotic, and anti-inflammatory properties, exhibiting significant protective effects on the kidneys. In recent years, there has been a surge of interest in studying the potential benefits of hirudin, especially in its role in the management of DN. This article delves into the mechanisms by which hirudin contributes to the treatment of DN and its clinical efficacy.