A novel fluorescence "turn off-on" nanosensor for sensitivity detection acid phosphatase and inhibitor based on glutathione-functionalized graphene quantum dots.

In this paper, we developed a label-free and sensitive fluorescence sensor for acid phosphatase (ACP) and its inhibitor parathion-methyl (PM) detection based on glutathione-functionalized graphene quantum dots (GQDs@GSH). Upon addition of MnO2 nanosheets, the fluorescence of GQDs@GSH could be efficiently quenched via a fluorescence resonance energy transfer. ACP could easily catalyze the hydrolysis of L-Ascorbic acid-2-phosphate (AAP) to ascorbic acid (AA), which could reduce MnO2 nanosheets to Mn2+ in acidic environment, leading to dramatically increase of the fluorescence intensity of GQDs@GSH. Quantitative detection of ACP in a broad range from 0.1 to 9 mU mL-1 with a detection limit of 0.027 mU mL-1 could be achieved. The feasibility of the proposed sensor in real samples analysis was also studied and satisfactory results were obtained. Furthermore, the fluorescence assay strategy could also be used for the detection of parathion-methyl (PM) as ACP inhibitor.

Reduced expression of exocytotic proteins caused by anti-cholinesterase pesticides in Brachionus calyciflorus (Rotifera: Monogononta).

The organophosphate and carbamate pesticides methyl-parathion and carbaryl have a common action mechanism: they inhibit acetylcholinesterase enzyme by blocking the transmission of nerve impulses. However, they can alter the expression of exocytotic membrane proteins (SNARE), by modifying release of neurotransmitters and other substances. This study evaluated the adverse effects of the pesticides methyl-parathion and carbaryl on expression of SNARE proteins: Syntaxin-1, Syntaxin-4 and SNAP-23 in freshwater rotifer Brachionus calyciflorus. Protein expression of these three proteins was analyzed before and after exposure to these two pesticides by Western Blot. The expression of Syntaxin-1, Syntaxin-4 and SNAP-23 proteins in B. calyciflorussignificantly decreases with increasing concentration of either pesticides. This suggests that organophosphates and carbamates have adverse effects on expression of membrane proteins of exocytosis by altering the recognition, docking and fusion of presynaptic and vesicular membranes involved in exocytosis of neurotransmitters. Our results demonstrate that the neurotoxic effect of anticholinesterase pesticides influences the interaction of syntaxins and SNAP-25 and the proper assembly of the SNARE complex.

Reduced expression of exocytotic proteins caused by anti-cholinesterase pesticides in Brachionus calyciflorus (Rotifera: Monogononta) / Redução da expressão de proteínas de exocitose causados por pesticidas anti-colinesterase em Brachionus calyciflorus (Rotifera: Monogononta)

AbstractThe organophosphate and carbamate pesticides methyl-parathion and carbaryl have a common action mechanism: they inhibit acetylcholinesterase enzyme by blocking the transmission of nerve impulses. However, they can alter the expression of exocytotic membrane proteins (SNARE), by modifying release of neurotransmitters and other substances. This study evaluated the adverse effects of the pesticides methyl-parathion and carbaryl on expression of SNARE proteins: Syntaxin-1, Syntaxin-4 and SNAP-23 in freshwater rotifer Brachionus calyciflorus. Protein expression of these three proteins was analyzed before and after exposure to these two pesticides by Western Blot. The expression of Syntaxin-1, Syntaxin-4 and SNAP-23 proteins in B. calyciflorussignificantly decreases with increasing concentration of either pesticides. This suggests that organophosphates and carbamates have adverse effects on expression of membrane proteins of exocytosis by altering the recognition, docking and fusion of presynaptic and vesicular membranes involved in exocytosis of neurotransmitters. Our results demonstrate that the neurotoxic effect of anticholinesterase pesticides influences the interaction of syntaxins and SNAP-25 and the proper assembly of the SNARE complex.

ResumoOs pesticidas organofosforados e carbamatos metil- paration e carbaril tem um mecanismo de ação comum: eles inibem a enzima acetilcolinesterase, bloqueando a transmissão dos impulsos nervosos. No entanto, eles podem alterar a expressão de proteínas de membrana de exocitose (SNARE), através da modificação da libertação de neurotransmissores e outras substâncias. Este estudo avaliou os efeitos adversos dos pesticidas metil- paration e carbaril sobre a expressão de proteínas SNARE: Sintaxina -1, Sintaxina-4 e SNAP-23 em rotíferos de água doce Brachionus calyciflorus. A expressão destas três proteínas foi analisada antes e depois da exposição a estes dois pesticidas por Western Blot. A expressão das proteínas Sintaxina-1, Sintaxina-4 e SNAP-23 em B. calyciflorus diminui significativamente com o aumento da concentração de ambos os pesticidas. Isto sugere que os organofosfatos e carbamatos têm efeitos adversos sobre a expressão de proteínas de membrana de exocitose, alterando o reconhecimento, de encaixe e fusão de membranas pré-sinápticas e vesiculares envolvidas na exocitose de neurotransmissores. Nossos resultados demonstram que o efeito neurotóxico de pesticidas anticolinesterásicos influencia a interação de sintaxinas e SNAP-25 e a montagem correta do complexo SNARE.

Methyl parathion inhibits the nuclear maturation, decreases the cytoplasmic quality in oocytes and alters the developmental potential of embryos of Swiss albino mice.

Methyl parathion (MP) is one of the most commonly used and extremely toxic organophosphorous group of pesticide. A large number of studies in the literature suggest that it has adverse effects on the male reproductive system. However, there is limited information about its toxicity to the female reproductive system. In the present study we report the toxic effects of methyl parathion on the female reproductive system using Swiss albino mice as the experimental model. The female mice were administered orally with 5, 10 and 20mg/kg of MP. One week later, the mice were superovulated with pregnant mare serum gonadotrophin (PMSG) and human chorionic gonadotrophin (hCG) to study the quality of the oocytes, spindle organization, developmental potential of early embryos and the DNA integrity in blastocysts. MP exposure resulted in a non-significant decrease in the number of primordial follicles and increased DNA damage in granulosa cells. Though MP did not have any effect on the ovulation it had a significant inhibitory effect on the nuclear maturity of oocytes which was associated with spindle deformity. In addition, the oocytes had higher cytoplasmic abnormalities with depleted glutathione level. Even though it did not have any effect on the fertilization and blastocyst rate at lower doses, at 20 mg/kg MP it resulted in a significant decrease in blastocyst hatching, decrease in cell number and high DNA damage. While low body weight gain was observed in F1 generation from 5mg/kg group, at higher dose, the body weight in F1 generation was marginally higher than control. Post-natal death in F1 generation was observed only in mice treated with 20mg/kg MP. In conclusion, we report that MP has adverse effects on the oocyte quality, developmental potential of the embryo and reproductive outcome.

An electrochemical platform for acetylcholinesterase activity assay and inhibitors screening based on Michael addition reaction between thiocholine and catechol-terminated SAMs.

An electrochemical platform for acetylcholinesterase (AChE) activity assay and its inhibitors screening is developed based on the Michael addition reaction of thiocholine, the hydrolysis product of acetylthiocholine (AsCh) in the presence of AChE, with the electrogenerated o-quinone of catechol-terminated SAMs on a gold electrode. For understanding and confirming the mechanism of the reaction, the electrochemical behaviors of Michael addition reaction of two model compounds, cysteine (CYS) and glutathione (GSH), towards the catechol-terminated SAMs have been studied. The enzyme kinetics and the inhibition effects of three types of AChE inhibitors, which are tacrine, carbofuran and parathion-methyl, have been investigated using an amperometric method. Among these three inhibitors, tacrine exhibits the strongest inhibiting effect, which is reinforced by the resulting data of kinetic studies on each inhibitor's influence upon the enzyme activity.

Differential expression profile of membrane proteins in zebrafish (Danio rerio) brain exposed to methyl parathion.

Methyl parathion (MP) is a widely used organophosphorus pesticide, which has been related to a broad spectrum of toxic effects on environmental organisms. The present study investigated the changes in the protein profile of enriched membrane fraction from zebrafish (Danio rerio) brain exposed to three concentrations (0.5, 1 and 2 mg/L) of MP. 2-DE revealed that the abundance of 21 protein spots was significantly changed by MP stress. By matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and database search, 16 protein spots were identified as membrane proteins, among which 8 were down-regulated, while 8 were up-regulated. These proteins are mainly involved in oxidative stress response, signal transduction, metabolism, protein synthesis and degradation, neuroplasticity and regeneration as well as synaptic transmission. These results may aid our understanding of the mechanism of MP-induced neurotoxicity and provide the possibility of the establishment of candidate biomarkers of MP.

Inhibition of two enzyme systems in Euchlanis dilatata (Rotifera: Monogononta) as biomarker of effect of metals and pesticides.

The inhibitory effects on esterases and phospholipase A2 (PLA2) in the freshwater rotifer Euchlanis dilatata, native to Mexico, were assessed by fluorimetry after in vivo exposure (30 min) in laboratory conditions to sublethal concentrations of metals and pesticides. EC(50) values for esterases ranged from 7.9 × 10(-7) for DDT to 61.9 µg l(-1) for methyl parathion, while corresponding values for PLA2 ranged from 0.96 × 10(-6) for mercury to 69.2 µg l(-1) for lead. These enzyme systems in E. dilatata are very sensitive to the tested agents and suggest they would be suitable biomarkers. However, sensitivity to other environmental contaminants should be investigated in laboratory conditions and field studies to assess their potential as environmental biomarkers.

Effects of methyl parathion exposure on development and reproduction in the viviparous fish Girardinichthys multiradiatus.

Methyl parathion (MeP), an insecticide commonly used in Mexico, has been detected in water bodies adjacent to agricultural crops and is accumulated in the tissue of the amarillo (Girardinichthys multiradiatus), a viviparous fish unique to Central Mexico. Evidence of MeP accumulation in a G. multiradiatus population prompted assessment of the consequences of exposure to MeP during the gestation period and adult life. We exposed adult fish to MeP in the diet at concentrations ranging from 0.001 to 0.165 microg/g dry weight of food. Fish accumulated MeP at concentrations from 0.21 to 5.87 microg/g of fish and exhibited a significant reduction in weight and growth rate. We also evaluated the effects on broods of pregnant females exposed to 0.005, 0.01, and 0.1 microg/g dry weight of food. Although these pregnant females were not affected, their offspring showed an increase in spinal cord malformation and a reduction in survival to adulthood. Finally, we sampled seven localities inhabited by G. multiradiatus; this revealed the presence of MeP in two water bodies at concentrations of 0.0036 and 0.037 microg/mL respectively. Our results suggest that low MeP concentrations affect immature fish with possible consequences later in life.

Assessing risk of resistance to aerial applications of methyl-parathion in western corn rootworm (Coleoptera: Chrysomelidae).

We validated a stochastic model of the evolution of resistance to adulticidal sprays of methyl-parathion in western corn rootworm, Diabrotica virgifera virgifera LeConte, populations in Nebraska. The population dynamics predicted by the model resembled that reported for field populations, and time until control failures occurred closely matched reports by commercial crop consultants. We incorporated uncertainty about the values used for 18 model parameters by replacing default values with random draws taken from a normal distribution. One parameter, the initial resistance allele frequency, was no longer measurable because of the evolution of resistance. We therefore proposed five candidate initial allele frequencies and developed probability distributions for the time to resistance for each by running 1000 simulations with parameters randomly varied. These distributions included variation because of stochastic effects as well as parameter uncertainty. We used Bayesian inference to estimate the candidate frequency most likely, given reported times to field control failures. The initial allele frequency of 10(-4) was most likely (29%), 10(-3) was less likely (28%), whereas 10(-6) was relatively unlikely (5%). Results from sensitivity analysis depended upon how evolution of resistance was measured. When resistance was examined as a genetic phenomenon, the rate of increase of the resistance allele depended almost entirely on genetic factors (LC50 values), the characteristics of the pesticide (residual activity), and the variance associated with emergence of adults. When resistance was measured as failure of methyl-parathion to reduce populations below threshold levels (0.5 gravid females per plant), parameters that contributed to population growth rate (mortality and fecundity) were also important. These data suggest two important phases in resistance evolution in corn rootworms: a genetic phase associated with negative growth rates and rapid changes in resistance allele frequencies and a rebound phase associated with positive growth rates and near fixation of the resistance allele.

Methyl parathion increases neuronal activities in the rat locus coeruleus.

Exposure to organophosphate insecticides induces undesirable behavioral changes in humans, including anxiety and irritability, depression, cognitive disturbances and sleep disorders. Little information currently exists concerning the neural mechanisms underlying such behavioral changes. The brain stem locus coeruleus (LC) could be a mediator of organophosphate insecticide-induced behavioral toxicities since it contains high levels of acetylcholinesterase and is involved in the regulation of the sleep-wake cycle, attention, arousal, memory, and pathological processes, including anxiety and depression. In the present study, using a multi-wire recording technique, we examined the effects of methyl parathion, a commonly used organophosphate insecticide, on the firing patterns of LC neurons in rats. Systemic administration of a single dose of methyl parathion (1 mg/kg, i.v.) increased the spontaneous firing rates of LC neurons by 240% but did not change the temporal relationships among the activities of multiple LC neurons. This dose of methyl parathion induced a 50% decrease in blood acetylcholinesterase activity and a 48% decrease in LC acetylcholinesterase activity. The methyl parathion-induced excitation of LC neurons was reversed by administration of atropine sulfate, a muscarinic receptor antagonist, indicating an involvement of muscarinic receptors. The methyl parathion-induced increase in LC neuronal activity returned to normal within 30 min while the blood acetylcholinesterase activity remained inhibited for over 1 h. These data indicate that methyl parathion treatment can elicit excitation of LC neurons. Such excitation could contribute to the neuronal basis of organophosphate insecticide-induced behavioral changes in human.

Effect of methyl parathion on the susceptibility of shrimp Litopenaeus vannamei to experimental vibriosis.

Following increasing calls for environmental safety over the past 2 decades, persistent pesticides are being replaced by more rapidly degradable products. However, even these pesticides can affect non-target species, and may be associated with slow growth and increased susceptibility to viral and bacterial infections. In this study, juvenile white shrimp Litopenaeus vannamei (also named Penaeus vannamei) were challenged by intramuscular injection with Vibrio parahaemolyticus after 4 d prior exposure to methyl parathion in feed pellets at 0.080 microg g(-1). The bacterial injection control group consisted of shrimp fed pellets containing the methyl parathion-carrier solvent acetonitrile. Three additional control groups comprised 2 sterile saline-injection groups fed pellets containing methyl parathion or acetonitrile prior to injection, and 1 uninjected group fed normal pellets. Cumulative mortalities were recorded on the 4th and 8th days, and the presence of histological lesions was recorded on the 8th day. Cumulative mortalities were significantly higher in the group exposed to methyl parathion and bacteria on Day 8. Histological lesions, typical of vibriosis, were significantly associated with the injection of V. parahaemolyticus. The study provides strong experimental evidence that prior exposure to methyl parathion can increase the severity of Vibrio infections.

Pharmacokinetics and pharmacodynamics of methyl parathion.

Methyl parathion and other organophosphorus insecticides are widely used in agriculture. Poisonings to this class of compounds are common and exerted primarily through inhibition of acetylcholinesterase. Methyl parathion became a major health concern when it was illegally sprayed in private homes. Since there are limited data with which to predict the long-term effects resulting from a pattern of exposure to methyl parathion that may have occurred in domestic settings, studies were performed to compare its pharmacokinetics and pharmacodynamics after intravenous, oral or dermal exposure. Methyl parathion was given to adult female rats as a single dose intravenously (2.5 mg/kg) through a femoral catheter, orally (2.5 mg/kg) by gavage, or dermally (< or = 50 mg/kg) by application to shaved skin at the nape of the neck. Blood (200 microl) was collected at increasing times from a separate catheter or from the retro-orbital sinus. Cholinesterase activity was measured in blood and normalized to hemoglobin content, whereas activities in brain and peripheral tissues were normalized to protein. Blood methyl parathion was quantitated by gas chromatography-electron capture. The pharmacokinetics of methyl parathion after intravenous exposure best fit a model in which it was distributed between two compartments and rapidly eliminated. Maximal concentrations of methyl parathion ranged from 200 to 350 ng/ml. The half-life of methyl parathion was 51 minutes, its volume of distribution was 10.1 L/kg, and clearance was 108 ml/min/kg. The kinetics of methyl parathion after single oral exposure contrasted with those after intravenous exposure. Despite a high absorption coefficient, oral bioavailability of methyl parathion was less than 5%, and concentrations in blood were 2% or less of those after intravenous exposure. After single dermal exposure (25 or 50 mg/kg), blood methyl parathion levels increased during the first 6 h and then remained constant for the next 42 h at about 150 ng/ml. Despite differences in its pharmacokinetics, methyl parathion caused similar time-dependent changes in blood and brain cholinesterase activities after intravenous or oral administration. Maximal inhibition of blood cholinesterase occurred within 15-60 min, and activities recovered within 30 - 48 h. In contrast, inhibition of blood cholinesterase caused by single dermal exposure (> or = 25 mg/kg) to methyl parathion developed gradually over 24 h, but was sustained. Cholinesterase inhibited by a lower dose (< or = 12 mg/kg) of methyl parathion required up to 21 days to recover fully. The pharmacokinetics and pharmacodynamics of methyl parathion are complex, and the complexity varies with the route of exposure. A significant 'first pass' effect for methyl parathion is seen with oral administration. Dermal exposure to methyl parathion, as likely occurred with the illegal spraying of private homes and businesses, may exacerbate toxicity and increase the potential for long-term adverse health effects.

Insecticide use and organophosphate resistance in the coffee leaf miner Leucoptera coffeella (Lepidoptera: Lyonetiidae).

Increasing rates of insecticide use against the coffee leaf minerLeucoptera coffeella(Guérin-Méneville) and field reports on insecticide resistance led to an investigation of the possible occurrence of resistance of this species to some of the oldest insecticides used against it in Brazil: chlorpyrifos, disulfoton, ethion and methyl parathion. Insect populations were collected from ten sites in the state of Minas Gerais, Brazil and these populations were subjected to discriminating concentrations established from insecticide LC99s estimated for a susceptible standard population. Eight of the field-collected populations showed resistance to disulfoton, five showed resistance to ethion, four showed resistance to methyl parathion, and one showed resistance to chlorpyrifos. The frequency of resistant individuals in each population ranged from 10 to 93% for disulfoton, 53 to 75% for ethion, 23 to 76% for methyl parathion, and the frequency of resistant individuals in the chlorpyrifos resistant population was 35%. A higher frequency of individuals resistant to chlorpyrifos, disulfoton and ethion was associated with greater use of insecticides, especially other organophosphates. This finding suggests that cross-selection, mainly between organophosphates, played a major role in the evolution of insecticide resistance in Brazilian populations of L. coffeella. Results from insecticide bioassays with synergists (diethyl maleate, piperonyl butoxide and triphenyl phosphate) suggested that cytochrome P450-dependent monooxygenases may play a major role in resistance with minor involvement of esterases and glutathione S-transferases.

Mechanisms of resistance to organophosphates in Tetranychus urticae (Acari: Tetranychidae) from Greece.

We investigated the mechanisms conferring resistance to methyl-parathion (44-fold) and to methomyl (8-fold) in Tetranychus urticae from Greece by studying the effect of synergists on the resistance and the kinetic characteristics of various enzymes in a resistant strain (RLAB) and a susceptible reference strain (SAMB). It is shown that S,S,S-tributyl phosphorotrithioate, a synergist that inhibits esterases and glutathione S-transferases, and piperonyl butoxide, a synergist that inhibits cytochrome P450 mediated monooxygenases, did not affect the level of methyl-parathion or methomyl resistance in RLAB and that resistance ratios to both insecticides did not change significantly in the presence of either synergist. Isoelectric focusing of esterase allozymes on single mites revealed no differences in staining intensity and glutathione S-transferase activity was not significantly different in the two strains. The activity of two cytochrome P450 monooxygenase groups was compared. No significant difference of 7-ethoxyresorufin-O-diethylase activity was observed between strains that were two-fold higher in RLAB than in SAMB. The kinetic characteristics of acetylcholinesterase, the target enzyme of organophosphates and carbamates, revealed that acetylcholinesterase in RLAB was less sensitive to inhibition by paraoxon and methomyl in comparison with SAMB. I(50), the inhibitor concentration inducing 50% decrease of acetylcholinesterase activity was greater (119- and 50-fold with paraoxon and methomyl, respectively) and the bimolecular constant k(i) was lower (39- and 47-fold with paraoxon and methomyl, respectively) in RLAB compared to SAMB.

A comparison of cholinesterase activity after intravenous, oral or dermal administration of methyl parathion.

Time-dependent changes in blood cholinesterase activity caused by single intravenous, oral or dermal administration of methyl parathion to adult female rats were defined. Intravenous and oral administration of 2.5 mg/kg methyl parathion resulted in rapid (<60 min) decreases in cholinesterase activity which recovered fully in vivo within 30-48 h. In contrast, spontaneous reactivation of cholinesterase in vitro was complete within 6 h at 37 degrees C. Dermal administration of methyl parathion caused dose-dependent inhibition of cholinesterase activity which developed slowly (> or =6 h) and was prolonged (> or =48 h). Time- and route-dependent effects of methyl parathion on cholinesterase activity in brain and other tissues generally paralleled its effects on activity in blood. In conclusion, pharmacodynamics of methyl parathion differ substantially with route of exposure. Recovery of cholinesterase in vivo after intravenous or oral exposure may partially reflect spontaneous reactivation and suggests a rapid clearance of methyl parathion or its active metabolite methyl paraoxon. The more gradual and prolonged inhibition of cholinesterase caused by dermal administration is consistent with disposition of methyl parathion at a site from which it or methyl paraoxon is only slowly distributed. Thus, dermal exposure to methyl parathion may pose the greatest risk for long-term adverse effects.

Cytochrome P450 2B (CYP2B)-mediated activation of methyl-parathion in rat brain extracts.

The role of cytochrome P450 (CYP) and the CYP isoform involved in the activation of the widely used pesticide methyl-parathion (MePA) were investigated in rat brain extracts by measuring the effect of different CYP inhibitors on acetylcholinesterase (AChE) inhibition by MePA. Brain extracts provide a useful tool to study the activation mechanisms of organophosphorus compounds (OP) since they contain both the activating enzyme(s) and the molecular target for OP toxicity. As expected, in incubations of rat brain extract supplemented with NADPH, AChE activity was non-competitively inhibited by the presence of MePA, indicating that MePA was activated to its reactive metabolite methyl-paraoxon (MePO). Indeed, Vmax(app) decreased from 13.4 to 8.7 micromol thionitrobenzoic acid (TNB)/min per mg protein. MePA activation by rat brain extracts, as measured by the AChE inhibition produced by the presence of the pesticide in the incubation, was fully prevented by previously bubbling the incubation mix with CO, by the presence of monoclonal anti-rat CYP2B1/2B2 antibodies and by the addition of phenobarbital (PB), a CYP2B substrate. Interestingly, MePA showed a greater affinity for CYP2B than PB. CYP1A1 antibodies showed no effect on MePA activation. The presence of cytochrome P450 2B (CYP2B) in the rat brain extracts was confirmed by immunoblotting. These results demonstrate indisputably the responsibility of CYP2B in MePA activation in the rat brain in vitro, suggesting that metabolic activation of OP compounds in situ might be crucial for their organ specific toxicity to the central nervous system also in vivo.

Comparison of the action of an organophosphorus insecticide and its metabolite on chloride and sulfate transport in erythrocyte membrane.

The effect of the organophosphorus insecticide methylparathion and its main metabolite methylparaoxon on chloride and sulfate equilibrium exchange in pig erythrocytes was investigated using an isotope labelling technique. Efflux of both radioactive isotopes with time followed a single exponential. Methylparathion and methylparaoxon inhibited the chloride equilibrium exchange in erythrocyte ghosts in a dose- and time-dependent manner. There was no difference between effects evoked by these two compounds. Methylparathion and methylparaoxon inhibited sulfate efflux from resealed ghosts. The effect was also dose- and time-dependent. Again, there was no difference between the action of both agents. Dixon analysis revealed a non-competitive character of the inhibition of the exchange of both anions with apparent Ki values 183 and 184 microM for methylparathion and methylparaoxon, respectively in the case of chloride transport; for sulfate exchange these values were 675 and 648 microM. It was suggested that structural similarity between the parent agent and its metabolite accounts for their identical effects. Methylparathion and methylparaoxon might inhibit the anion exchange indirectly by changing the fluidity of the erythrocyte membrane or directly by binding to the band 3 protein and evoking conformational changes that lead to the inhibition of the anion transport. The insecticides, due to their ability to phosphorylate, might also disturb some regulation processes in the band 3 protein and affect anion transport in this way.

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.

The effect of dimethoate, dichlorvos, and parathion-methyl on bone marrow cell chromosomes of rats in subchronic experiments in vivo.

The three organophosphorous insecticides dimethoate, dichlorvos, and parathion-methyl were investigated in subchronic experiments on bone marrow cell chromosomes. In the literature these compounds were reported to exhibit both positive and negative results in mutagenicity tests demanding further investigations in subchronic tests. The treatment of different groups of male Wistar rats lasted for 6 weeks with 5 treatment days per week at doses of 1/100, 1/75, and 1/50 of the LD50. Following the last treatment, bone marrow cell chromosomes were prepared. The frequency of cells revealing any aberrations as well as numeric and structural aberrations were evaluated. In this test both dimethoate and dichlorvos demonstrated mutagenic effects following subchronic treatment of Wistar rats, while parathion-methyl at doses of 1/100, 1/75, and 1/50 of LD50 displayed no significant mutagenicity.