Differences of ocular oscillations and neuro-retinal structures in patients with nystagmus caused by GPR143 and FRMD7 gene variants.

PURPOSE: Mutations of G protein-coupled receptor 143 (GPR143) and FERM domain containing 7 (FRMD7) may result in congenital nystagmus (CN) in the first 6 months of life. We aimed to compare the differences in ocular oscillations between patients with these two gene mutations as well as the functional and structural changes in their retinas and visual pathways. METHODS: Medical records were retrospectively reviewed to identify patients of congenital nystagmus with confirmed mutations in either GPR143 or FMRD7 genes from January 2018 to May 2023. The parameters of the ocular oscillations were recorded using Eyelink 1000 Plus. The retinal structure and function were evaluated using optical coherence tomography and multi-focal electroretinography (mERG). The visual pathway and optical nerve projection were evaluated using visual evoked potentials. The next-generation sequencing technique was used to identify the pathogenic variations in the disease-causing genes for CN. RESULTS: Twenty nystagmus patients of GPR143 and 21 patients of FMRD7 who had been confirmed by molecular testing between January 2018 and May 2023 were included. Foveal hypoplasia was detected only in patients with the GPR143 pathogenic variant. mERG examination showed a flat response topography in the GPR143 group compared to the FRMD7 group. VEP showed that bilateral amplitude inconsistency was detected only in the patients with GPR143 gene mutation. The amplitude and frequency of the ocular oscillations were not found to differ between patients with two different genetic mutations. CONCLUSIONS: Although the etiology and molecular mechanisms are completely different between CN patients, they may have similar ocular oscillations. A careful clinical examination and electrophysiological test will be helpful in making a differential diagnosis. Our novel identified variants will further expand the spectrum of the GPR143 and FRMD7 variants.

Electroretinography in congenital nystagmus patients with a normal fundus examination.

PURPOSE: To identify the ophthalmic causes of congenital nystagmus with normal eye examination by electroretinography (ERG). STUDY DESIGN: Retrospective observational study. METHODS: We reviewed the medical records of patients younger than 6 months of age who presented between June 2008 and November 2011 with nystagmus and no other neurological signs following an otherwise normal eye examination. A complete ophthalmic examination and ERG (Nicolet Bravo system; Nicolet Biomedial & RETIscan; Roland Instruments), fundus photography, and Ishihara color test were performed to identify any ophthalmic causes of congenital nystagmus. RESULTS: Thirty-three patients met the criteria. Rod dysfunction was diagnosed in 4 patients (12.1%), cone dysfunction in 2 patients (6.1%), and cone-rod dysfunction in 1 patient (3.0%). The results of ERG were negative in 2 patients (6.1%). Idiopathic infantile nystagmus was diagnosed in the remaining 24 patients (72.7%) based on their normal ERG examination. CONCLUSIONS: In Korean congenital nystagmus patients with a normal fundus examination, achromatopsia and Leber's congenital amaurosis are uncommon causes. ERG is needed to make a definite diagnosis and provide prognostic information in congenital idiopathic nystagmus patients with a normal fundus examination.

Best-corrected visual acuity results facilitate molecular diagnosis of infantile nystagmus patients harboring FRMD7 mutations.

The visual function of patients with infantile nystagmus (IN) can be significantly decreased owing to constant eye movement. While, reaching a definitive diagnosis becomes a challenge due to genetic heterozygous of this disease. To address it, we investigated whether best-corrected visual acuity (BCVA) results can facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations. 200 patients with IN from 55 families and 133 sporadic cases were enrolled. Mutations were comprehensively screened by direct sequencing using gene-specific primers for FRMD7. We also retrieved related literature to verify the results based on our data. We found that the BCVA of patients with IN harboring FRMD7 mutations was between 0.5 and 0.7, which was confirmed by data retrieved from the literature. Our results showed that BCVA results facilitate the molecular diagnosis of patients with IN harboring FRMD7 mutations. In addition, we identified 31 FRMD7 mutations from the patients, including six novel mutations, namely, frameshift mutation c.1492_1493insT (p.Y498LfsTer14), splice-site mutation c.353C > G, three missense mutations [c.208C > G (p.P70A), c.234G > A (p.M78I), and c.1109G > A (p.H370R)], and nonsense mutation c.1195G > T (p.E399Ter). This study demonstrates that BCVA results may facilitate the molecular diagnosis of IN patients harboring FRMD7 mutations.

[Nystagmus in Children - a Survey]. / Nystagmus bei Kindern ­ eine Übersicht.

Nystagmus describes an involuntary, periodic movement of one or both eyes. About 1/600 children and adolescents have nystagmus, most of them idiopathic infantile nystagmus (IIN), also called "congenital nystagmus", which can be caused by mutations in the FRMD7 gene. Other frequent forms of nystagmus are latent nystagmus, which is usually associated with infantile strabismus, and nystagmus associated with albinism. Sometimes difficult to distinguish in young infants is a sensory nystagmus, where a defect in the visual system reduces vision and causes nystagmus. Causes include retinal dystrophies, congenital stationary night blindness and structural ocular defects including optic nerve hypoplasia or dense bilateral congenital cataracts. Unilateral nystagmus can be the sign of an anterior visual pathway lesion. Seesaw nystagmus may be associated with suprasellar and mesodiencephalic lesions and - rarely - with retinal dystrophies.The ophthalmology plays a key role in identifying the form of nystagmus. Children with new onset nystagmus, with spasmus nutans, with vertical or unilateral nystagmus and those with seesaw nystagmus require neurologic evaluation including imaging of the brain.The treatment of nystagmus depends on the underlying cause. Even minor refractive errors should be corrected, contact lenses offer advantages over glasses.Gabapentin and memantine, possibly also carbonic anhydrase inhibitors, are effective in treating IIN, nystagmus in albinism and sensory nystagmus. Nevertheless, pharmacologic treatment of nystagmus is rarely used in children; the reasons are the limited effects on vision, the need for lifelong therapy, and potential side effects. Eye muscle surgery (Anderson procedure, Kestenbaum procedure) can correct a nystagmus-related anomalous head posture. The concept of "artifical divergence" of Cüppers may help to decrease nystagmus intensity in patients whose nystagmus dampens with convergence. The four-muscle-tenotomy, which involves disinsertion and reinsertion of the horizontal muscles at the original insertion of both eyes, has a proven but limited positive effect on visual acuity.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

PhenoApt leverages clinical expertise to prioritize candidate genes via machine learning.

In recent years, exome sequencing (ES) has shown great utility in the diagnoses of Mendelian disorders. However, after rigorous filtering, a typical ES analysis still involves the interpretation of hundreds of variants, which greatly hinders the rapid identification of causative genes. Since the interpretations of ES data require comprehensive clinical analyses, taking clinical expertise into consideration can speed the molecular diagnoses of Mendelian disorders. To leverage clinical expertise to prioritize candidate genes, we developed PhenoApt, a phenotype-driven gene prioritization tool that allows users to assign a customized weight to each phenotype, via a machine-learning algorithm. Using the ability to rank causative genes in top-10 lists as an evaluation metric, baseline analysis demonstrated that PhenoApt outperformed previous phenotype-driven gene prioritization tools by a relative increase of 22.7%-140.0% in three independent, real-world, multi-center cohorts (cohort 1, n = 185; cohort 2, n = 784; and cohort 3, n = 208). Additional trials showed that, by adding weights to clinical indications, which should be explained by the causative gene, PhenoApt performance was improved by a relative increase of 37.3% in cohort 2 (n = 471) and 21.4% in cohort 3 (n = 208). Moreover, PhenoApt could assign an intrinsic weight to each phenotype based on the likelihood of its being a Mendelian trait using term frequency-inverse document frequency techniques. When clinical indications were assigned with intrinsic weights, PhenoApt performance was improved by a relative increase of 23.7% in cohort 2 and 15.5% in cohort 3. For the integration of PhenoApt into clinical practice, we developed a user-friendly website and a command-line tool.

GPR143 genotypic and ocular phenotypic characterisation in a Chinese cohort with ocular albinism.

PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Longitudinal genotype-phenotype analysis in 86 patients with PAX6-related aniridia.

Aniridia is most commonly caused by haploinsufficiency of the PAX6 gene, characterized by variable iris and foveal hypoplasia, nystagmus, cataracts, glaucoma, and aniridia-related keratopathy (ARK). Genotype-phenotype correlations have previously been described; however, detailed longitudinal studies of aniridia are less commonly reported. We identified 86 patients from 62 unrelated families with molecularly confirmed heterozygous PAX6 variants from a UK-based single-center ocular genetics service. They were categorized into mutation groups, and a retrospective review of clinical characteristics (ocular and systemic) from baseline to most recent was recorded. One hundred and seventy-two eyes were evaluated, with a mean follow-up period of 16.3 ± 12.7 years. Nystagmus was recorded in 87.2% of the eyes, and foveal hypoplasia was found in 75%. Cataracts were diagnosed in 70.3%, glaucoma in 20.6%, and ARK in 68.6% of eyes. Prevalence, age of diagnosis and surgical intervention, and need for surgical intervention varied among mutation groups. Overall, the missense mutation subgroup had the mildest phenotype, and surgically naive eyes maintained better visual acuity. Systemic evaluation identified type 2 diabetes in 12.8% of the study group, which is twice the UK prevalence. This is the largest longitudinal study of aniridia in the UK, and as such, it can provide insights into prognostic indicators for patients and guiding clinical management of both ocular and systemic features.

Diagnostic yield of targeted next-generation sequencing in infantile nystagmus syndrome.

Background: Infantile nystagmus syndrome (INS) is a genetically heterogeneous disorder. Identifying genetic causes of INS would help clinicians to facilitate clinical diagnosis and provide appropriate treatment. The aim of this study was to determine the diagnostic utility of targeted next-generation sequencing (NGS) for INS.Materials and methods: We recruited 37 patients who were referred to the Neuro-ophthalmology clinics for evaluations of INS. NGS was performed using a targeted panel that included 98 candidate genes associated with INS. We identified pathogenic variants according to guidelines of the American College of Medical Genetics and Genomics. We also calculated the sensitivity and specificity of each clinical sign to assess the diagnostic yield of our gene panel.Results: After variant filtering, annotation, and interpretation, the potential pathogenic variants were detected in 13 of the 37 patients, achieving a molecular diagnostic rate of 35%. The identified genes were PAX6 (n = 4), FRMD7 (n = 4), GPR143 (n = 2), CACNA1F (n = 1), CNGA3 (n = 1) and GUCY2D (n = 1). In approximately 30% (n = 4) of the patients, the initial clinical diagnosis was revised after a molecular diagnosis was performed. The presence of a family history had the highest predictive power for a molecular diagnosis (sensitivity = 61.5%, specificity = 91.7%), and the sensitivity increased when the family history was considered together with one of two clinical signs such as pendular nystagmus waveforms or anterior segment dysgenesis.Conclusions: Our study shows that targeted NGS can be useful to determine a molecular diagnosis for patients with INS. Targeted NGS also helps to confirm a clinical diagnosis in atypical phenotypes or unresolved cases.

Biallelic mutations in L-dopachrome tautomerase (DCT) cause infantile nystagmus and oculocutaneous albinism.

Infantile nystagmus syndrome (INS) denominates early-onset, involuntary oscillatory eye movements with different etiologies. Nystagmus is also one of the symptoms in oculocutaneus albinism (OCA), a heterogeneous disease mainly caused by defects in melanin synthesis or melanosome biogenesis. Dopachrome tautomerase (DCT, also called TYRP2) together with tyrosinase (TYR) and tyrosin-related protein 1 (TYRP1) is one of the key enzymes in melanin synthesis. Although DCT´s role in pigmentation has been proven in different species, until now only mutations in TYR and TYRP1 have been found in patients with OCA. Detailed ophthalmological and orthoptic investigations identified a consanguineous family with two individuals with isolated infantile nystagmus and one family member with subtle signs of albinism. By whole-exome sequencing and segregation analysis, we identified the missense mutation c.176G > T (p.Gly59Val) in DCT in a homozygous state in all three affected family members. We show that this mutation results in incomplete protein maturation and targeting in vitro compatible with a partial or total loss of function. Subsequent screening of a cohort of patients with OCA (n = 85) and INS (n = 25) revealed two heterozygous truncating mutations, namely c.876C > A (p.Tyr292*) and c.1407G > A (p.Trp469*), in an independent patient with OCA. Taken together, our data suggest that mutations in DCT can cause a phenotypic spectrum ranging from isolated infantile nystagmus to oculocutaneous albinism.

A New Clinical Method for Visual Function Evaluation Including Estimation and Measurement of Therapeutic Effectiveness: Lessons From Infantile Nystagmus Research.

PURPOSE: To translate infantile nystagmus system (INS) research into easily understood, clinically relevant terminology and suggest modifications to research and clinical testing, data and clinical interpretation, and therapeutic choices and evaluation. METHODS: A clinical method is presented using only three best-corrected visual acuity measurements of patients with INS, whereby (1) a measure of the quality of visual acuity across the visual field is possible; (2) pre-therapy estimates of post-therapy improvements in peak acuity and the high-acuity range of gaze angles are possible; and (3) more realistic visual function outcome measures of therapy are available to the practitioner. RESULTS: The application of the high-acuity field quality spreadsheet to the analyses of patients with INS (before and after therapy) results in a quantitative measure of visual function based on three visual acuity measurements. CONCLUSIONS: The clinician can now duplicate adequate functional visual acuity descriptions in patients with INS along with their pre-therapy estimates and outcome measures. Previously, these have only been available to researchers or the rare clinicians who have access to both eye movement data and the expanded nystagmus acuity function analysis of INS waveforms. [J Pediatr Ophthalmol Strabismus. 2021;58(3):188-195.].

Genetic causes of nystagmus, foveal hypoplasia and subnormal visual acuity- other than albinism.

Background: To describe genetic molecular findings in individuals with congenital nystagmus, foveal hypoplasia, and subnormal vision, with normal ocular pigmentation (absence of diffuse transillumination or transparent retinal pigment typical for albinism).Methods: This is a retrospective, multicenter study of ophthalmic, systemic, and genetic features, as collected from medical records of patients diagnosed with infantile nystagmus and foveal hypoplasia. Ophthalmic findings include best-corrected visual acuity (BCVA), biomicroscopic examination, cycloplegic refraction, retinal examination, macular optical coherence tomography, and electroretinography. Genetic information was retrieved from the participating genetic clinics and included ethnicity and molecular diagnosis.Results: Thirty-one individuals met the inclusion criteria and had a secure molecular diagnosis. Mutations in two genes predominated, constituting 77.4% of all the represented genes: SLC38A8 (45.1%) and PAX6 (32.3%). Seventy-eight percent of the subjects who had a measurable BCVA had moderate and severe visual impairment (range 20/80 to 20/270). Most patients with a mutation in SLC38A8 had mild to moderate astigmatism, while most patients with PAX6 mutation had moderate and severe myopia. Patients in the PAX6 group had variable degrees of anterior segment manifestations.Conclusion: In our cohort, the main causative genes for congenital nystagmus and foveal hypoplasia in normally pigmented eyes were SLC38A8 and PAX6. A mild phenotype in PAX6 mutations may be an under-diagnosed cause of nystagmus and foveal hypoplasia. Reaching an accurate genetic diagnosis is essential for both the patients and their family members. This enables predicting disease prognosis, tailoring correct follow-up, and providing genetic counseling and family planning to affected families.

Pseudo-Gaze Deviation Resulting From Positive Angle Kappa and Esotropia.

ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.

Multimodal Imaging of Isolated Foveal Hypoplasia: A Case Report.

Fovea hipoplazisi, normal foveanin gelismemesi ile karakterizedir. Izole veya baska oküler durumlarda sekonder olarak gelisebilmektedir. Optik koherens tomografi (OKT), floresein anjiyografi, fundus otofloresans ve OKT anjiyografi tanida kullanilabilir. Bu olgu sunumunda multimodal görüntüleme ile tani konulan, foveal hipoplazili bir hastayi sunmaktayiz.

Autosomal dominant foveal hypoplasia without visible macular abnormalities and PAX6 mutations.

PURPOSE: Autosomal dominant foveal hypoplasia (FVH1) is a rare disorder associated with mutations in the PAX6 gene. As an isolated disease entity, FVH1 does not include ocular disorders such as aniridia, microphthalmia, albinism, and achromatopsia. However, it only includes isolated foveal hypoplasia and foveal hypoplasia with presenile cataract. The purpose of this report is to present our findings in four patients from two families with FVH1 without visible ophthalmic macular abnormalities. STUDY DESIGN: A review of the medical records of two families with FVH1 and genetic confirmation of mutations in the PAX6 gene. METHODS: Fundus photographs, optical coherence tomographic (OCT) and OCT angiographic (OCTA) images, and slit-lamp anterior segment findings were determined. The type of mutation of the PAX6 gene was determined. RESULTS: A 3-year-old girl (Patient 1) had signs and symptoms of an impairment in the development of vision without other retinal abnormalities OU. OCT images showed a shallow foveal pit, and OCTA showed the absence of the foveal avascular zone. The second patient (Patient 2) was a 6-year-old girl with unilateral mild cataract and shallow foveal pits OU. Similar shallow foveal pits were found in her asymptomatic mother (Patient 3) and maternal grandfather (Patient 4). Although the iris and posterior fundus were normal, all patients with FVH1 had goniodysgenesis. Genetic testing of the PAX6 gene revealed that Patient 1 had a novel heterozygous mutation (p.Asn365Lys) as a de novo mutation, and Patients 2, 3 and 4 had a novel heterozygous mutation (p.Pro20Ser). CONCLUSIONS: Heterozygous mutations in the PAX6 gene can cause FVH1 with nearly normal appearing macula. FVH1 is difficult to diagnose, but detailed observations of the foveal structure and vasculature, and detecting the presence of goniodysgenesis can be helpful in identifying patients with FVH1.

Molecular diagnostic challenges for non-retinal developmental eye disorders in the United Kingdom.

Overall, approximately one-quarter of patients with genetic eye diseases will receive a molecular diagnosis. Patients with developmental eye disorders face a number of diagnostic challenges including phenotypic heterogeneity with significant asymmetry, coexisting ocular and systemic disease, limited understanding of human eye development and the associated genetic repertoire, and lack of access to next generation sequencing as regarded not to impact on patient outcomes/management with cost implications. Herein, we report our real world experience from a pediatric ocular genetics service over a 12 month period with 72 consecutive patients from 62 families, and that from a cohort of 322 patients undergoing whole genome sequencing (WGS) through the Genomics England 100,000 Genomes Project; encompassing microphthalmia, anophthalmia, ocular coloboma (MAC), anterior segment dysgenesis anomalies (ASDA), primary congenital glaucoma, congenital cataract, infantile nystagmus, and albinism. Overall molecular diagnostic rates reached 24.9% for those recruited to the 100,000 Genomes Project (73/293 families were solved), but up to 33.9% in the clinic setting (20/59 families). WGS was able to improve genetic diagnosis for MAC patients (15.7%), but not for ASDA (15.0%) and congenital cataracts (44.7%). Increased sample sizes and accurate human phenotype ontology (HPO) terms are required to improve diagnostic accuracy. The significant mixed complex ocular phenotypes distort these rates and lead to missed variants if the correct gene panel is not applied. Increased molecular diagnoses will help to explain the genotype-phenotype relationships of these developmental eye disorders. In turn, this will lead to improved integrated care pathways, understanding of disease, and future therapeutic development.

Nistagmo secundario a albinismo con compromiso ocular en paciente femenina: un desafío diagnóstico / Nystagmus secondary to albinism with ocular involvement in a female: a diagnostic challenge

INTRODUCCIÓN: El nistagmo infantil es infrecuente y representa un desafío diagnóstico para el pediatra. El albinismo es una de sus principales causas, siendo difícil de sospechar en ausencia de compromiso cutáneo evidente, especialmente en pacientes femeninas, debido a que tipo de herencia del albinismo ocular. OBJETIVO: Describir un caso de nistagmo secundario a albinismo con compromiso ocular aislado en paciente femenina, para discutir el enfoque diagnóstico pediátrico. CASO CLÍNICO: Paciente fe menino de 3 semanas de vida, sin antecedentes mórbidos, derivada a neuropediatra y oftalmólogo por movimientos oculares paroxísticos desde las 2 semanas, con estudio con electroencefalograma e imágenes cerebrales normales. A los 3 meses se confirmó translucencia iridiana, nistagmo y astigmatismo hipermetrópico. La valuación dermatológica descartó compromiso cutáneo. Evolucionó con inclinación cefálica hacia abajo y retraso del desarrollo de la coordinación, fue manejada con lentes de corrección y kinesioterapia. A los 3 años, destacaba mejoría de la agudeza visual, disminución del nistagmo y neurodesarrollo normal. La evaluación oftalmológica de ambos padres fue normal y no había antecedentes de nistagmo o albinismo en la familia. Por decisión de los padres no se realizó estudio genético. CONCLUSIÓN: El diagnóstico de nistagmo secundario a compromiso ocular del albinismo, aún en ausencia de afección cutánea, es clínico; el estudio genético permite confirmar la etiología, sin ser un examen imprescindible, a menos que se considere la planificación familiar. La pesquisa oportuna e intervención multidisciplinaria determinan un mejor pronóstico.

INTRODUCTION: Infantile nystagmus is an infrequent condition that represents a diagnostic challenge for the pediatri cian. Albinism is one of its main causes, being difficult to suspect in the absence of evident cutaneous involvement, especially in female patients, due to the inheritance type of ocular albinism. OBJECTIVE: To describe a case of nystagmus secondary to albinism with isolated ocular involvement in a female patient, in order to provide tools for pediatric approach and diagnosis. CLINICAL CASE: Three- weeks-old female patient, without morbid history, referred to a pediatric neurosurgeon and ophthal mologist due to paroxysmal eye movements since 2 weeks of age. The electroencephalogram and brain images were normal. In follow-up monitoring at 3 months, iris translucency, nystagmus, and hypermetropic astigmatism were confirmed. Dermatologic evaluation ruled out cutaneous invol vement. The patient developed cephalic downward inclination and coordination development de lay was confirmed, the patient was handled with corrective lenses and kinesiotherapy. In follow-up monitoring at 3 years, there was an improvement in visual acuity, decreased nystagmus and normal neurodevelopment. The ophthalmological evaluation of both parents was normal and there was no history of nystagmus or albinism in the family. Upon her parents' decision, no genetic study was ca rried out. CONCLUSION: The diagnosis of nystagmus secondary to ocular albinism, even in the absence of cutaneous involvement, is clinical. The genetic study allows confirming the etiology, without being an essential examination, unless family planning is considered. Timely research and multidisciplinary intervention determine a better prognosis.