Origins of tissue and cell-type specificity in mitochondrial DNA (mtDNA) disease.

Mutations of mitochondrial (mt)DNA are a major cause of morbidity and mortality in humans, accounting for approximately two thirds of diagnosed mitochondrial disease. However, despite significant advances in technology since the discovery of the first disease-causing mtDNA mutations in 1988, the comprehensive diagnosis and treatment of mtDNA disease remains challenging. This is partly due to the highly variable clinical presentation linked to tissue-specific vulnerability that determines which organs are affected. Organ involvement can vary between different mtDNA mutations, and also between patients carrying the same disease-causing variant. The clinical features frequently overlap with other non-mitochondrial diseases, both rare and common, adding to the diagnostic challenge. Building on previous findings, recent technological advances have cast further light on the mechanisms which underpin the organ vulnerability in mtDNA diseases, but our understanding is far from complete. In this review we explore the origins, current knowledge, and future directions of research in this area.

Temporal dynamics of the multi-omic response to endurance exercise training.

Regular exercise promotes whole-body health and prevents disease, but the underlying molecular mechanisms are incompletely understood1-3. Here, the Molecular Transducers of Physical Activity Consortium4 profiled the temporal transcriptome, proteome, metabolome, lipidome, phosphoproteome, acetylproteome, ubiquitylproteome, epigenome and immunome in whole blood, plasma and 18 solid tissues in male and female Rattus norvegicus over eight weeks of endurance exercise training. The resulting data compendium encompasses 9,466 assays across 19 tissues, 25 molecular platforms and 4 training time points. Thousands of shared and tissue-specific molecular alterations were identified, with sex differences found in multiple tissues. Temporal multi-omic and multi-tissue analyses revealed expansive biological insights into the adaptive responses to endurance training, including widespread regulation of immune, metabolic, stress response and mitochondrial pathways. Many changes were relevant to human health, including non-alcoholic fatty liver disease, inflammatory bowel disease, cardiovascular health and tissue injury and recovery. The data and analyses presented in this study will serve as valuable resources for understanding and exploring the multi-tissue molecular effects of endurance training and are provided in a public repository ( https://motrpac-data.org/ ).

Housekeeping protein-coding genes interrogated with tissue and individual variations.

Housekeeping protein-coding genes are stably expressed genes in cells and tissues that are thought to be engaged in fundamental cellular biological functions. They are often utilized as normalization references in molecular biology research and are especially important in integrated bioinformatic investigations. Prior studies have examined human housekeeping protein-coding genes by analyzing various gene expression datasets. The inclusion of different tissue types significantly impacted the discovery of housekeeping genes. In this report, we investigated particularly individual human subject expression differences in protein-coding genes across different tissue types. We used GTEx V8 gene expression datasets obtained from more than 16,000 human normal tissue samples. Furthermore, the Gini index is utilized to investigate the expression variations of protein-coding genes between tissue and individual donor subjects. Housekeeping protein-coding genes found using Gini index profiles may vary depending on the tissue subtypes investigated, particularly given the diverse sample size collections across the GTEx tissue subtypes. We subsequently selected major tissues and identified subsets of housekeeping genes with stable expression levels among human donors within those tissues. In this work, we provide alternative sets of housekeeping protein-coding genes that show more consistent expression patterns in human subjects across major solid organs. Weblink: https://hpsv.ibms.sinica.edu.tw .

TAD border deletion at the Kit locus causes tissue-specific ectopic activation of a neighboring gene.

Topologically associated domains (TADs) restrict promoter-enhancer interactions, thereby maintaining the spatiotemporal pattern of gene activity. However, rearrangements of the TADs boundaries do not always lead to significant changes in the activity pattern. Here, we investigated the consequences of the TAD boundaries deletion on the expression of developmentally important genes encoding tyrosine kinase receptors: Kit, Kdr, Pdgfra. We used genome editing in mice to delete the TADs boundaries at the Kit locus and characterized chromatin folding and gene expression in pure cultures of fibroblasts, mast cells, and melanocytes. We found that although Kit is highly active in both mast cells and melanocytes, deletion of the TAD boundary between the Kit and Kdr genes results in ectopic activation only in melanocytes. Thus, the epigenetic landscape, namely the mutual arrangement of enhancers and actively transcribing genes, is important for predicting the consequences of the TAD boundaries removal. We also found that mice without a TAD border between the Kit and Kdr genes have a phenotypic manifestation of the mutation - a lighter coloration. Thus, the data obtained shed light on the principles of interaction between the 3D chromatin organization and epigenetic marks in the regulation of gene activity.

Seasonal tissue-specific gene expression in wild crown-of-thorns starfish reveals reproductive and stress-related transcriptional systems.

Animals are influenced by the season, yet we know little about the changes that occur in most species throughout the year. This is particularly true in tropical marine animals that experience relatively small annual temperature and daylight changes. Like many coral reef inhabitants, the crown-of-thorns starfish (COTS), well known as a notorious consumer of corals and destroyer of coral reefs, reproduces exclusively in the summer. By comparing gene expression in 7 somatic tissues procured from wild COTS sampled on the Great Barrier Reef, we identified more than 2,000 protein-coding genes that change significantly between summer and winter. COTS genes that appear to mediate conspecific communication, including both signalling factors released into the surrounding sea water and cell surface receptors, are up-regulated in external secretory and sensory tissues in the summer, often in a sex-specific manner. Sexually dimorphic gene expression appears to be underpinned by sex- and season-specific transcription factors (TFs) and gene regulatory programs. There are over 100 TFs that are seasonally expressed, 87% of which are significantly up-regulated in the summer. Six nuclear receptors are up-regulated in all tissues in the summer, suggesting that systemic seasonal changes are hormonally controlled, as in vertebrates. Unexpectedly, there is a suite of stress-related chaperone proteins and TFs, including HIFa, ATF3, C/EBP, CREB, and NF-κB, that are uniquely and widely co-expressed in gravid females. The up-regulation of these stress proteins in the summer suggests the demands of oogenesis in this highly fecund starfish affects protein stability and turnover in somatic cells. Together, these circannual changes in gene expression provide novel insights into seasonal changes in this coral reef pest and have the potential to identify vulnerabilities for targeted biocontrol.

Organ-delimited gene regulatory networks provide high accuracy in candidate transcription factor selection across diverse processes.

Organ-specific gene expression datasets that include hundreds to thousands of experiments allow the reconstruction of organ-level gene regulatory networks (GRNs). However, creating such datasets is greatly hampered by the requirements of extensive and tedious manual curation. Here, we trained a supervised classification model that can accurately classify the organ-of-origin for a plant transcriptome. This K-Nearest Neighbor-based multiclass classifier was used to create organ-specific gene expression datasets for the leaf, root, shoot, flower, and seed in Arabidopsis thaliana. A GRN inference approach was used to determine the: i. influential transcription factors (TFs) in each organ and, ii. most influential TFs for specific biological processes in that organ. These genome-wide, organ-delimited GRNs (OD-GRNs), recalled many known regulators of organ development and processes operating in those organs. Importantly, many previously unknown TF regulators were uncovered as potential regulators of these processes. As a proof-of-concept, we focused on experimentally validating the predicted TF regulators of lipid biosynthesis in seeds, an important food and biofuel trait. Of the top 20 predicted TFs, eight are known regulators of seed oil content, e.g., WRI1, LEC1, FUS3. Importantly, we validated our prediction of MybS2, TGA4, SPL12, AGL18, and DiV2 as regulators of seed lipid biosynthesis. We elucidated the molecular mechanism of MybS2 and show that it induces purple acid phosphatase family genes and lipid synthesis genes to enhance seed lipid content. This general approach has the potential to be extended to any species with sufficiently large gene expression datasets to find unique regulators of any trait-of-interest.

Cis-eQTLs in seven duck tissues identify novel candidate genes for growth and carcass traits.

BACKGROUND: Expression quantitative trait loci (eQTL) studies aim to understand the influence of genetic variants on gene expression. The colocalization of eQTL mapping and GWAS strategy could help identify essential candidate genes and causal DNA variants vital to complex traits in human and many farm animals. However, eQTL mapping has not been conducted in ducks. It is desirable to know whether eQTLs within GWAS signals contributed to duck economic traits. RESULTS: In this study, we conducted an eQTL analysis using publicly available RNA sequencing data from 820 samples, focusing on liver, muscle, blood, adipose, ovary, spleen, and lung tissues. We identified 113,374 cis-eQTLs for 12,266 genes, a substantial fraction 39.1% of which were discovered in at least two tissues. The cis-eQTLs of blood were less conserved across tissues, while cis-eQTLs from any tissue exhibit a strong sharing pattern to liver tissue. Colocalization between cis-eQTLs and genome-wide association studies (GWAS) of 50 traits uncovered new associations between gene expression and potential loci influencing growth and carcass traits. SRSF4, GSS, and IGF2BP1 in liver, NDUFC2 in muscle, ELF3 in adipose, and RUNDC1 in blood could serve as the candidate genes for duck growth and carcass traits. CONCLUSIONS: Our findings highlight substantial differences in genetic regulation of gene expression across duck primary tissues, shedding light on potential mechanisms through which candidate genes may impact growth and carcass traits. Furthermore, this availability of eQTL data offers a valuable resource for deciphering further genetic association signals that may arise from ongoing extensive endeavors aimed at enhancing duck production traits.

Emergence of enhancers at late DNA replicating regions.

Enhancers are fast-evolving genomic sequences that control spatiotemporal gene expression patterns. By examining enhancer turnover across mammalian species and in multiple tissue types, we uncover a relationship between the emergence of enhancers and genome organization as a function of germline DNA replication time. While enhancers are most abundant in euchromatic regions, enhancers emerge almost twice as often in late compared to early germline replicating regions, independent of transposable elements. Using a deep learning sequence model, we demonstrate that new enhancers are enriched for mutations that alter transcription factor (TF) binding. Recently evolved enhancers appear to be mostly neutrally evolving and enriched in eQTLs. They also show more tissue specificity than conserved enhancers, and the TFs that bind to these elements, as inferred by binding sequences, also show increased tissue-specific gene expression. We find a similar relationship with DNA replication time in cancer, suggesting that these observations may be time-invariant principles of genome evolution. Our work underscores that genome organization has a profound impact in shaping mammalian gene regulation.

A first complete catalog of highly expressed genes in eight chicken tissues reveals uncharacterized gene families specific for the chicken testis.

Based on next-generation sequencing, we established a repertoire of differentially overexpressed genes (DoEGs) in eight adult chicken tissues: the testis, brain, lung, liver, kidney, muscle, heart, and intestine. With 4,499 DoEGs, the testis had the highest number and proportion of DoEGs compared with the seven somatic tissues. The testis DoEG set included the highest proportion of long noncoding RNAs (lncRNAs; 1,851, representing 32% of the lncRNA genes in the whole genome) and the highest proportion of protein-coding genes (2,648, representing 14.7% of the protein-coding genes in the whole genome). The main significantly enriched Gene Ontology terms related to the protein-coding genes were "reproductive process," "tubulin binding," and "microtubule cytoskeleton." Using real-time quantitative reverse transcription-polymerase chain reaction, we confirmed the overexpression of genes that encode proteins already described in chicken sperm [such as calcium binding tyrosine phosphorylation regulated (CABYR), spermatogenesis associated 18 (SPATA18), and CDK5 regulatory subunit associated protein (CDK5RAP2)] but whose testis origin had not been previously confirmed. Moreover, we demonstrated the overexpression of vertebrate orthologs of testis genes not yet described in the adult chicken testis [such as NIMA related kinase 2 (NEK2), adenylate kinase 7 (AK7), and CCNE2]. Using clustering according to primary sequence homology, we found that 1,737 of the 2,648 (67%) testis protein-coding genes were unique genes. This proportion was significantly higher than the somatic tissues except muscle. We clustered the other 911 testis protein-coding genes into 495 families, from which 47 had all paralogs overexpressed in the testis. Among these 47 testis-specific families, eight contained uncharacterized duplicated paralogs without orthologs in other metazoans except birds: these families are thus specific for chickens/birds.NEW & NOTEWORTHY Comparative next-generation sequencing analysis of eight chicken tissues showed that the testis has highest proportion of long noncoding RNA and protein-coding genes of the whole genome. We identified new genes in the chicken testis, including orthologs of known mammalian testicular genes. We also identified 47 gene families in which all the members were overexpressed, if not exclusive, in the testis. Eight families, organized in duplication clusters, were unknown, without orthologs in metazoans except birds, and are thus specific for chickens/birds.

A single-cell time-lapse of mouse prenatal development from gastrula to birth.

The house mouse (Mus musculus) is an exceptional model system, combining genetic tractability with close evolutionary affinity to humans1,2. Mouse gestation lasts only 3 weeks, during which the genome orchestrates the astonishing transformation of a single-cell zygote into a free-living pup composed of more than 500 million cells. Here, to establish a global framework for exploring mammalian development, we applied optimized single-cell combinatorial indexing3 to profile the transcriptional states of 12.4 million nuclei from 83 embryos, precisely staged at 2- to 6-hour intervals spanning late gastrulation (embryonic day 8) to birth (postnatal day 0). From these data, we annotate hundreds of cell types and explore the ontogenesis of the posterior embryo during somitogenesis and of kidney, mesenchyme, retina and early neurons. We leverage the temporal resolution and sampling depth of these whole-embryo snapshots, together with published data4-8 from earlier timepoints, to construct a rooted tree of cell-type relationships that spans the entirety of prenatal development, from zygote to birth. Throughout this tree, we systematically nominate genes encoding transcription factors and other proteins as candidate drivers of the in vivo differentiation of hundreds of cell types. Remarkably, the most marked temporal shifts in cell states are observed within one hour of birth and presumably underlie the massive physiological adaptations that must accompany the successful transition of a mammalian fetus to life outside the womb.

Ataxia-Telangiectasia Mutated Loss-of-Function Displays Variant and Tissue-Specific Differences across Tumor Types.

PURPOSE: Mutations in the ATM gene are common in multiple cancers, but clinical studies of therapies targeting ATM-aberrant cancers have yielded mixed results. Refinement of ATM loss of function (LOF) as a predictive biomarker of response is urgently needed. EXPERIMENTAL DESIGN: We present the first disclosure and preclinical development of a novel, selective ATR inhibitor, ART0380, and test its antitumor activity in multiple preclinical cancer models. To refine ATM LOF as a predictive biomarker, we performed a comprehensive pan-cancer analysis of ATM variants in patient tumors and then assessed the ATM variant-to-protein relationship. Finally, we assessed a novel ATM LOF biomarker approach in retrospective clinical data sets of patients treated with platinum-based chemotherapy or ATR inhibition. RESULTS: ART0380 had potent, selective antitumor activity in a range of preclinical cancer models with differing degrees of ATM LOF. Pan-cancer analysis identified 10,609 ATM variants in 8,587 patient tumors. Cancer lineage-specific differences were seen in the prevalence of deleterious (Tier 1) versus unknown/benign (Tier 2) variants, selective pressure for loss of heterozygosity, and concordance between a deleterious variant and ATM loss of protein (LOP). A novel ATM LOF biomarker approach that accounts for variant classification, relationship to ATM LOP, and tissue-specific penetrance significantly enriched for patients who benefited from platinum-based chemotherapy or ATR inhibition. CONCLUSIONS: These data help to better define ATM LOF across tumor types in order to optimize patient selection and improve molecularly targeted therapeutic approaches for patients with ATM LOF cancers.

Chromosome evolution screens recapitulate tissue-specific tumor aneuploidy patterns.

Whole chromosome and arm-level copy number alterations occur at high frequencies in tumors, but their selective advantages, if any, are poorly understood. Here, utilizing unbiased whole chromosome genetic screens combined with in vitro evolution to generate arm- and subarm-level events, we iteratively selected the fittest karyotypes from aneuploidized human renal and mammary epithelial cells. Proliferation-based karyotype selection in these epithelial lines modeled tissue-specific tumor aneuploidy patterns in patient cohorts in the absence of driver mutations. Hi-C-based translocation mapping revealed that arm-level events usually emerged in multiples of two via centromeric translocations and occurred more frequently in tetraploids than diploids, contributing to the increased diversity in evolving tetraploid populations. Isogenic clonal lineages enabled elucidation of pro-tumorigenic mechanisms associated with common copy number alterations, revealing Notch signaling potentiation as a driver of 1q gain in breast cancer. We propose that intrinsic, tissue-specific proliferative effects underlie tumor copy number patterns in cancer.

Autonomous transposons tune their sequences to ensure somatic suppression.

Transposable elements (TEs) are a major constituent of human genes, occupying approximately half of the intronic space. During pre-messenger RNA synthesis, intronic TEs are transcribed along with their host genes but rarely contribute to the final mRNA product because they are spliced out together with the intron and rapidly degraded. Paradoxically, TEs are an abundant source of RNA-processing signals through which they can create new introns1, and also functional2 or non-functional chimeric transcripts3. The rarity of these events implies the existence of a resilient splicing code that is able to suppress TE exonization without compromising host pre-mRNA processing. Here we show that SAFB proteins protect genome integrity by preventing retrotransposition of L1 elements while maintaining splicing integrity, via prevention of the exonization of previously integrated TEs. This unique dual role is possible because of L1's conserved adenosine-rich coding sequences that are bound by SAFB proteins. The suppressive activity of SAFB extends to tissue-specific, giant protein-coding cassette exons, nested genes and Tigger DNA transposons. Moreover, SAFB also suppresses LTR/ERV elements in species in which they are still active, such as mice and flies. A significant subset of splicing events suppressed by SAFB in somatic cells are activated in the testis, coinciding with low SAFB expression in postmeiotic spermatids. Reminiscent of the division of labour between innate and adaptive immune systems that fight external pathogens, our results uncover SAFB proteins as an RNA-based, pattern-guided, non-adaptive defence system against TEs in the soma, complementing the RNA-based, adaptive Piwi-interacting RNA pathway of the germline.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Affinity-optimizing enhancer variants disrupt development.

Enhancers control the location and timing of gene expression and contain the majority of variants associated with disease1-3. The ZRS is arguably the most well-studied vertebrate enhancer and mediates the expression of Shh in the developing limb4. Thirty-one human single-nucleotide variants (SNVs) within the ZRS are associated with polydactyly4-6. However, how this enhancer encodes tissue-specific activity, and the mechanisms by which SNVs alter the number of digits, are poorly understood. Here we show that the ETS sites within the ZRS are low affinity, and identify a functional ETS site, ETS-A, with extremely low affinity. Two human SNVs and a synthetic variant optimize the binding affinity of ETS-A subtly from 15% to around 25% relative to the strongest ETS binding sequence, and cause polydactyly with the same penetrance and severity. A greater increase in affinity results in phenotypes that are more penetrant and more severe. Affinity-optimizing SNVs in other ETS sites in the ZRS, as well as in ETS, interferon regulatory factor (IRF), HOX and activator protein 1 (AP-1) sites within a wide variety of enhancers, cause gain-of-function gene expression. The prevalence of binding sites with suboptimal affinity in enhancers creates a vulnerability in genomes whereby SNVs that optimize affinity, even slightly, can be pathogenic. Searching for affinity-optimizing SNVs in genomes could provide a mechanistic approach to identify causal variants that underlie enhanceropathies.

Targeted design of synthetic enhancers for selected tissues in the Drosophila embryo.

Enhancers control gene expression and have crucial roles in development and homeostasis1-3. However, the targeted de novo design of enhancers with tissue-specific activities has remained challenging. Here we combine deep learning and transfer learning to design tissue-specific enhancers for five tissues in the Drosophila melanogaster embryo: the central nervous system, epidermis, gut, muscle and brain. We first train convolutional neural networks using genome-wide single-cell assay for transposase-accessible chromatin with sequencing (ATAC-seq) datasets and then fine-tune the convolutional neural networks with smaller-scale data from in vivo enhancer activity assays, yielding models with 13% to 76% positive predictive value according to cross-validation. We designed and experimentally assessed 40 synthetic enhancers (8 per tissue) in vivo, of which 31 (78%) were active and 27 (68%) functioned in the target tissue (100% for central nervous system and muscle). The strategy of combining genome-wide and small-scale functional datasets by transfer learning is generally applicable and should enable the design of tissue-, cell type- and cell state-specific enhancers in any system.

Investigating the tissue specificity and prognostic impact of cis-regulatory cancer risk variants.

The tissue-specific incidence of cancers and their genetic basis are poorly understood. Although prior studies have shown global correlation across tissues for cancer risk single-nucleotide polymorphisms (SNPs) identified through genome-wide association studies (GWAS), any shared functional regulation of gene expression on a per SNP basis has not been well characterized. We set to quantify cis-mediated gene regulation and tissue sharing for SNPs associated with eight common cancers. We identify significant tissue sharing for individual SNPs and global enrichment for breast, colorectal, and Hodgkin lymphoma cancer risk SNPs in multiple tissues. In addition, we observe increasing tissue sharing for cancer risk SNPs overlapping with super-enhancers for breast cancer and Hodgkin lymphoma providing further evidence of tissue specificity. Finally, for genes under cis-regulation by breast cancer SNPs, we identify a phenotype characterized by low expression of tumor suppressors and negative regulators of the WNT pathway associated with worse freedom from progression and overall survival in patients who eventually develop breast cancer. Our results introduce a paradigm for functionally annotating individual cancer risk SNPs and will inform the design of future translational studies aimed to personalize assessment of inherited cancer risk across tissues.

Transcriptome variation in human tissues revealed by long-read sequencing.

Regulation of transcript structure generates transcript diversity and plays an important role in human disease1-7. The advent of long-read sequencing technologies offers the opportunity to study the role of genetic variation in transcript structure8-16. In this Article, we present a large human long-read RNA-seq dataset using the Oxford Nanopore Technologies platform from 88 samples from Genotype-Tissue Expression (GTEx) tissues and cell lines, complementing the GTEx resource. We identified just over 70,000 novel transcripts for annotated genes, and validated the protein expression of 10% of novel transcripts. We developed a new computational package, LORALS, to analyse the genetic effects of rare and common variants on the transcriptome by allele-specific analysis of long reads. We characterized allele-specific expression and transcript structure events, providing new insights into the specific transcript alterations caused by common and rare genetic variants and highlighting the resolution gained from long-read data. We were able to perturb the transcript structure upon knockdown of PTBP1, an RNA binding protein that mediates splicing, thereby finding genetic regulatory effects that are modified by the cellular environment. Finally, we used this dataset to enhance variant interpretation and study rare variants leading to aberrant splicing patterns.

Tissue Specificity of Gene Expression Evolves Across Mammal Species.

Tissue specificity of gene expression sheds light on the tissue-selective manifestation of hereditary disease despite the same DNA across all tissues. The evolutionary path of such tissue specificity provides essential information about the tissue-specific function of genes and the validity of disease animal models. With recent improvements of the sequencing technology, more and more large-scale transcriptomics studies have been conducted among different species across multiple tissues. In this study, we exploit existing transcriptomics resources of humans, cynomolgus macaques, rats, mice, and dogs across 13 tissues. We find that although tissue specificity of homologous gene expression is largely well conserved across species, a total of 380 genes shift or are in the process of shifting their tissue specificity. The tissue-specificity-shifting genes are less conserved than those preserving their tissue specificity or housekeeping genes. Interestingly, tissue-specificity-shifting genes tend to be less conserved at the third codon positions, likely due to their relaxed synonymous codon usage bias. Moreover, compared with genes, cassette exons are more likely to shift their tissue specificity of splicing across the five species.