Synthesis and Multiple Incorporations of 2'-O-Methyl-5-hydroxymethylcytidine, 5-Hydroxymethylcytidine and 5-Formylcytidine Monomers into RNA Oligonucleotides.

The synthesis of 2'-O-methyl-5-hydroxymethylcytidine (hm5 Cm), 5-hydroxymethylcytidine (hm5 C) and 5-formylcytidine (f5 C) phosphoramidite monomers has been developed. Optimisation of mild post-synthetic deprotection conditions enabled the synthesis of RNA containing all four naturally occurring cytosine modifications (hm5 Cm, hm5 C, f5 C plus 5-methylcytosine). Given the considerable interest in RNA modifications and epitranscriptomics, the availability of synthetic monomers and RNAs containing these modifications will be valuable for elucidating their biological function(s).

Chiral selection in oligoadenylate formation in the presence of a metal ion catalyst or poly(U) template.

The lead ion-catalyzed oligomerization of 5'-phosphorimidazolides of D-, L- or racemic DL-adenosine (D-ImpA, L-ImpA and DL-ImpA) gave oligoadenylates up to a pentamer. The oligomers resulting from racemic ImpA were comparable in yields and length to those from chiral D- or L-ImpA. A complex mixture of homochiral and heterochiral oligomers was formed in the reaction from racemic ImpA. Total dimer product from racemic ImpA by the lead ion catalyst showed homochiral selectivity. The reaction catalyzed by uranyl ion yielded oligoadenylates up to 15mer from chiral D- or L-ImpA in over 95% yield. A complex mixture of isomeric oligoadenylates was formed from racemic DL-ImpA in the presence of uranyl ion catalyst in comparable yields to those from D- or L-ImpA. The analysis of the dimer product from DL-ImpA showed that the homochiral 2' -5' linked dimer was selectively formed. D-ImpA polymerized effectively on a poly(U) template, which is exclusively composed of D-uridine, yielding oligoadenylates up to a pentamer. In contrast, L-ImpA or racemic DL-ImpA polymerized far less efficiently on the poly(U) template, demonstrating that chiral selection takes place in the poly(U) template-directed oligoadenylate formation.

Antiviral oligo- and polyribonucleotides containing selected triazolo[2,3-a]purines.

Several amphipathic (hydrophobic base, hydrophilic backbone) polyribonucleotides have recently been shown to have potent antiviral activity against HIV and human cytomegalovirus (HCMV). The working hypothesis developed during these studies was that the ability to form an ordered, non-hydrogen-bonded array in solution was an important criterion for activity. To explore further the role of structure and molecular size on the inhibition of virus replication, one new polynucleotide and two 32-mer oligonucleotides based on the triazolo[2,3-a]purine ring system have now been prepared. High-molecular-weight polynucleotide 4a (PTPR) and sulfur-containing 32-mer 5b (TTPR) were moderately active against HIV but showed greater potency against HDMV than ganciclovir. Both 4a and 5b gave clear evidence of cooperative melting behavior, whereas inactive 32-mer 5a showed no such behavior.

Comparison of base inclination of ribo-GC and deoxyribo-GC polymers, and synthesis of poly(rGrC)-poly(rGrC).

The inclination angle between the base normal and the helix axis, and the axes around which the bases incline, are measured for ribo-GC polymers in buffer by using flow linear dichroism (LD), and compared to measurements for deoxyribo-GC polymers in buffer and under dehydrating conditions. A new method is designed to synthesize poly(rGrC)-poly(rGrC), which is not available commercially, in large quantities. The LD of this RNA reveals inclination angles that are similar to the B-form DNA in buffer, although the axes are different. The CD of poly(dGdC)-poly(dGdC) under the dehydrating conditions is similar to poly(rGrC)-poly(rGrC), indicating it is in the A form, and the LD gives larger inclination angles than either the B form or the corresponding RNA. Poly(dG)-poly(dC) is in the A form in buffer. Comparison among poly(rG)-poly(rC) in buffer, and poly(dG)-poly(dC) in buffer under dehydrating conditions, reveals similar inclination angles and axes, although the LD shows that the DNA has the largest inclination angles. Except for poly(rGrC)-poly(rGrC), which has a unique reduced dichroism, all the axes for G are similar, as are the axes for C.

DNA and RNA-DNA annealing activity associated with the tau subunit of the Escherichia coli DNA polymerase III holoenzyme.

The DNA polymerase III (pol III)holoenzyme is the 10 subunit replicase of Escherichia coli. The 71 kDa tau subunit, encoded by dnaX, dimerizes the core polymerase (alpha epsilon theta) to form pol III'[(alpha epsilon theta)2 tau 2]. tau is also a single-stranded DNA-dependent ATPase and can substitute for the gamma subunit during initiation complex formation. We show here that tau also possesses a DNA-DNA and RNA-DNA annealing activity that is stimulated by Mg2+, but neither requires ATP nor is inhibited by non-hydrolyzable ATP analogs. This suggests the tau may act to stabilize the primer-template interaction during DNA replication.

Recognition of duplex DNA by RNA polynucleotides.

We are interested in creating artificial gene repressors based on duplex DNA recognition by nucleic acids. Homopyrimidine RNA oligonucleotides bind to duplex DNA at homopurine/homopyrimidine sequences under slightly acidic conditions. Recognition is sequence-specific, involving rU.dA.dT and rC+.dG.dC base triplets. Affinities were determined for folded polymeric RNAs (ca. 100-200 nt) containing 0, 1 or 3 copies of a 21 nt RNA sequence that binds duplex DNA by triple helix formation. When this recognition sequence was inserted into the larger folded RNAs, micromolar concentrations of the resulting RNA ligands bound a duplex DNA target at pH 5. However, these binding affinities were at least 20-fold lower than the affinity of an RNA oligonucleotide containing only the recognition sequence. Enzymatic probing of folded RNAs suggests that reduced affinity arises from unfavorable electrostatic, structural and topological considerations. The affinity of a polymeric RNA with three copies of the recognition sequence was greater than that of a polymeric RNA with a single copy of the sequence. This affinity difference ranged from 2.6- to 13-fold, depending on pH. Binding of duplex DNA by polymeric RNA might be improved by optimizing the RNA structure to efficiently present the recognition sequence.

Selective deuteration of RNA for NMR signal assignment.

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.

Oligonucleotides with novel, cationic backbone substituents: aminoethylphosphonates.

Oligonucleotide (2-aminoethyl)phosphonates in which the backbone consisted of isomerically pure, alternating (2-aminoethyl)-phosphonate and phosphodiester linkages have been prepared and characterized. One of these single isomer oligonucleotides (Rp) formed a more stable duplex with DNA or RNA than its corresponding natural counterpart. Hybrid stability was more pH-dependent, but less salt-dependent than a natural duplex. The specificity of hybridization was examined by hybridization of an oligonucleotide containing one (2-aminoethyl)phosphonate to oligonucleotides possessing mismatches in the region opposite to the aminoethyl group. In contrast to oligonucleotides containing (aminomethyl)-phosphonate linkages, oligonucleotide (2-aminoethyl)phosphonates were completely stable to hydrolysis in aqueous solution. These oligonucleotides were resistant to nuclease activity but did not induce RNase H mediated cleavage of a complementary RNA strand. Incubation in a serum-containing medium resulted in minimal degradation over 24 hours. Studies of cell uptake by flow cytometry and confocal microscopy demonstrated temperature dependent uptake and intracellular localization. (2-Aminoethyl)phosphonates represent a novel approach to the introduction of positive charges into the backbone of oligonucleotides.

Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA.

Exclusion of RNA strands from a purine motif triple helix.

Research concerning oligonucleotide-directed triple helix formation has mainly focused on the binding of DNA oligonucleotides to duplex DNA. The participation of RNA strands in triple helices is also of interest. For the pyrimidine motif (pyrimidine.purine.pyrimidine triplets), systematic substitution of RNA for DNA in one, two, or all three triplex strands has previously been reported. For the purine motif (purine.purine.pyrimidine triplets), studies have shown only that RNA cannot bind to duplex DNA. To extend this result, we created a DNA triple helix in the purine motif and systematically replaced one, two, or all three strands with RNA. In dramatic contrast to the general accommodation of RNA strands in the pyrimidine triple helix motif, a stable triplex forms in the purine motif only when all three of the substituent strands are DNA. The lack of triplex formation among any of the other seven possible strand combinations involving RNA suggests that: (i) duplex structures containing RNA cannot be targeted by DNA oligonucleotides in the purine motif; (ii) RNA strands cannot be employed to recognize duplex DNA in the purine motif; and (iii) RNA tertiary structures are likely to contain only isolated base triplets in the purine motif.

Photochemically and chemically activatable antisense oligonucleotides: comparison of their reactivities towards DNA and RNA targets.

Dodecadeoxyribonucleotides derivatized with 1,10-phenanthroline or psoralen were targeted to the point mutation (G<-->U) in codon 12 of the Ha-ras mRNA. DNA and RNA fragments, 27 nucleotides in length, and containing the complementary sequence of the 12mers, were used to compare the reactivity of the activatable dodecamers (cleavage of the target by the phenanthroline-12mer conjugates; photo-induced cross-linking of psoralen-12mer conjugates to the target). The reactivity of the RNA with the dodecamers was weaker than that of the DNA target. With psoralen-substituted oligonucleotides, it was possible to obtain complete discrimination between the mutated target (which contained a psoralen-reactive T(U) in the 12th codon) and the normal target (which contained G at the same position). When longer Ha-ras RNA fragments were used as targets (120 and 820 nucleotides), very little reactivity was observed. Part of the reactivity could be recovered by using 'helper' oligonucleotides that hybridized to adjacent sites on the substrate. A 'helper' chain length greater than 13 was required to improve the reactivity of dodecamers. However, the dodecanucleotides induced RNase H cleavage of the target RNA in the absence of 'helper' oligonucleotide. Therefore, in the absence of the RNase H enzyme, long oligonucleotides are needed to compete with the secondary structures of the mRNA. In contrast, formation of a ternary complex oligonucleotide-mRNA-RNase H led to RNAT cleavage with shorter oligonucleotides.

Arabidopsis heat shock factor: isolation and characterization of the gene and the recombinant protein.

We have isolated the Arabidopsis heat shock factor gene Athsf1 as genomic and corresponding cDNA sequences via cross-hybridization with tomato clones. Sequence analysis indicates only a partial homology with the HSFs from tomato and other organisms which is confined to the DNA-binding and the oligomerization domains. The gene is constitutively expressed but the level of mRNA for Athsf1 increases two-fold upon heat shock. However, the putative promoter region lacks the canonical heat shock elements. After expression in Escherichia coli the recombinant Athsf1 protein binds specifically to a synthetic oligonucleotide containing five heat shock elements. The native size of recombinant ATHSF1 in vitro is consistent with a trimer as demonstrated by chemical cross-linking and pore exclusion limit analysis.

Nuclear protein 780BP from cauliflower binds an element in the 780 gene promoter of T-DNA.

A 16 bp site of protein binding has been identified in the promoter of the 780 gene of T-DNA. Specific DNA-protein interactions were demonstrated between a double-stranded oligonucleotide containing this element (5'-TTGAAAAATCAACGCT-3') and a protein isolated from nuclear extracts of cauliflower inflorescences. Specific bases required for this binding activity (780 binding protein; 780BP) were defined by kinetic competition studies with mutated oligonucleotides, methylation interference assays and DNAse I footprinting. 780BP binding was not competed with up to 1000-fold excess of previously characterized plant regulatory elements such as as-1, the LRE, and the ocs, G-box, and AT-rich elements. In addition, 780BP was shown to bind sequences overlapping a mammalian hormone receptor element with greater affinity than the 780 element.

Lipofectin-aided cell delivery of ribozyme targeted to human urokinase receptor mRNA.

A 37-mer hammerhead ribozyme has been designed to efficiently cleave the 1.4 kb mRNA of the urokinase plasminogen activator receptor (uPAR). Under in vitro conditions, the chemically synthesized ribozyme cleaved uPAR mRNA and inhibited its translation in a concentration-dependent fashion. The ribozymes were 5'-[35S]thiophosphorylated and used as a model to analyze conditions for RNA delivery in a cultured human osteosarcoma cell system. Ribozymes degraded immediately in cell-conditioned medium but ribozymes complexed with lipofectin were protected from RNases for up to 22 h. Lipofectin rapidly transported ribozyme into the cell, where it accumulated almost exclusively in the cytoplasm. Thus, lipofectin dramatically enhances stability and cytoplasmic delivery of ribozymes, potentially enabling targeting of mRNA in vivo.

Structure of influenza virus RNP. I. Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent.

The influenza virus genome consists of eight segments of negative-sense RNA, i.e. the viral (v) RNA forms the template for the mRNA. Each segment is encapsidated by the viral nucleoprotein to form a ribonucleoprotein (RNP) particle and each RNP carries its own polymerase complex. We studied the interaction of purified nucleoprotein with RNA in vitro, by using a variety of enzymatic and chemical probes for RNA conformation. Our results suggest that the nucleoprotein binds to the vRNA backbone without apparent sequence specificity, exposing the bases to the outside and melting all secondary structure. In this way, the viral polymerase may transcribe the RNA without the need for dissociating the nucleoprotein and without being stopped by RNA secondary structure, and the viral RNPs are ready to start transcription as soon as they enter the host cell.

Studies on the structure and stabilizing factor of the CUUCGG hairpin RNA using chemically synthesized oligonucleotides.

A tridecaribonucleotide, r-UGAGCUUCGGCUC, and two analogues r(UGAGC)d(UUCG)r(GCUC) and r-UGAGCUUCIGCUC, which form a hairpin structure with a four-base-paired stem and a UUCG loop, were synthesized by the solid-phase phosphoramidite method. Properties of these three oligomers and d-TGAGCTTCGGCTC, the DNA analogue, were studied by UV, CD and NMR spectroscopy. The melting temperature (Tm) data suggest that the 2'-hydroxy1 groups and the 2-amino group of guanosine in the loop (9G) stabilize the CUUCGG hairpin which is known to have an unusually high Tm. NMR studies show that this 9G takes a syn conformation and the phosphodiester backbone has a turn at 9G-10G which is a junction of the stem and loop.

Mixed deoxyribo- and ribo-oligonucleotides with catalytic activity.

The RNA of viroids and virusoids in plants, and the RNA transcripts of some tandemly repeated DNA sequences in the newt, can undergo self-catalysed cleavage to generate RNA with 5'-OH and 2',3'-cyclic-phosphate termini. These catalytic RNAs, or ribozymes, form a stem-loop secondary structure called a 'hammerhead' in which the catalytic (ribozyme) and substrate sequences are brought close together. Catalytically active mimics of hammerhead ribozymes can be readily made using oligoribonucleotides. Consequently, hammerhead analogues in which certain ribonucleotides are replaced by different ones have been constructed both to identify consensus residues required for cleavage activity and to determine the details of the cleavage mechanism. But these ribonucleotide-replacements tend to alter the conformation of the hammerhead by changing hydrogen-bonding and stacking potential at the position of substitution. We have now constructed structurally less-disrupted hammerhead analogues in which deoxyribonucleotides, which lack 2'-OH groups, are substituted for ribonucleotides. These mixed RNA-DNA polymers were synthesized using a strategy for the chemical synthesis of RNA that is compatible with DNA synthesis. Analysis of the cleavage products of several of these hammerhead analogues confirms the involvement in the reaction of the 2'-OH adjacent to the cleavage site in the substrate, and demonstrates that some 2'-OH groups in the catalytic region strongly affect activity. The results also indicate that the three-dimensional structure producing nucleic acid-type catalysis is not restricted to RNA.

Cyclization of nucleotide analogues as an obstacle to polymerization.

Cyclization of activated nucleotide analogues by intramolecular phosphodiester-bond formation is likely to compete very effectively with template-directed condensation except in the cases of ribo- and arabinonucleotides. This could have excluded derivatives of most sugars from growing polyribonucleotide chains and thus reduced chain-termination in prebiotic polynucleotide synthesis.