Elucidating the functional role of Mycobacterium smegmatis recX in stress response.

The RecX protein has attracted considerable interest because the recX mutants exhibit multiple phenotypes associated with RecA functions. To further our understanding of the functional relationship between recA and recX, the effect of different stress treatments on their expression profiles, cell yield and viability were investigated. A significant correlation was found between the expression of Mycobacterium smegmatis recA and recX genes at different stages of growth, and in response to different stress treatments albeit recX exhibiting lower transcript and protein abundance at the mid-log and stationary phases of the bacterial growth cycle. To ascertain their roles in vivo, a targeted deletion of the recX and recArecX was performed in M. smegmatis. The growth kinetics of these mutant strains and their sensitivity patterns to different stress treatments were assessed relative to the wild-type strain. The deletion of recA affected normal cell growth and survival, while recX deletion showed no significant effect. Interestingly, deletion of both recX and recA genes results in a phenotype that is intermediate between the phenotypes of the ΔrecA mutant and the wild-type strain. Collectively, these results reveal a previously unrecognized role for M. smegmatis recX and support the notion that it may regulate a subset of the yet unknown genes involved in normal cell growth and DNA-damage repair.

Human RAD51 paralogue SWSAP1 fosters RAD51 filament by regulating the anti-recombinase FIGNL1 AAA+ ATPase.

RAD51 assembly on single-stranded (ss)DNAs is a crucial step in the homology-dependent repair of DNA damage for genomic stability. The formation of the RAD51 filament is promoted by various RAD51-interacting proteins including RAD51 paralogues. However, the mechanisms underlying the differential control of RAD51-filament dynamics by these factors remain largely unknown. Here, we report a role for the human RAD51 paralogue, SWSAP1, as a novel regulator of RAD51 assembly. Swsap1-deficient cells show defects in DNA damage-induced RAD51 assembly during both mitosis and meiosis. Defective RAD51 assembly in SWSAP1-depleted cells is suppressed by the depletion of FIGNL1, which binds to RAD51 as well as SWSAP1. Purified FIGNL1 promotes the dissociation of RAD51 from ssDNAs. The dismantling activity of FIGNL1 does not require its ATPase but depends on RAD51-binding. Purified SWSAP1 inhibits the RAD51-dismantling activity of FIGNL1. Taken together, our data suggest that SWSAP1 protects RAD51 filaments by antagonizing the anti-recombinase, FIGNL1.

Nonfilament-forming RecA dimer catalyzes homologous joint formation.

Homologous recombination is essential to genome maintenance, and also to genome diversification. In virtually all organisms, homologous recombination depends on the RecA/Rad51-family recombinases, which catalyze ATP-dependent formation of homologous joints-critical intermediates in homologous recombination. RecA/Rad51 binds first to single-stranded (ss) DNA at a damaged site to form a spiral nucleoprotein filament, after which double-stranded (ds) DNA interacts with the filament to search for sequence homology and to form consecutive base pairs with ssDNA ('pairing'). How sequence homology is recognized and what exact role filament formation plays remain unknown. We addressed the question of whether filament formation is a prerequisite for homologous joint formation. To this end we constructed a nonpolymerizing (np) head-to-tail-fused RecA dimer (npRecA dimer) and an npRecA monomer. The npRecA dimer bound to ssDNA, but did not form continuous filaments upon binding to DNA; it formed beads-on-string structures exclusively. Although its efficiency was lower, the npRecA dimer catalyzed the formation of D-loops (a type of homologous joint), whereas the npRecA monomer was completely defective. Thus, filament formation contributes to efficiency, but is not essential to sequence-homology recognition and pairing, for which a head-to-tail dimer form of RecA protomer is required and sufficient.

Management of E. coli sister chromatid cohesion in response to genotoxic stress.

Aberrant DNA replication is a major source of the mutations and chromosomal rearrangements associated with pathological disorders. In bacteria, several different DNA lesions are repaired by homologous recombination, a process that involves sister chromatid pairing. Previous work in Escherichia coli has demonstrated that sister chromatid interactions (SCIs) mediated by topological links termed precatenanes, are controlled by topoisomerase IV. In the present work, we demonstrate that during the repair of mitomycin C-induced lesions, topological links are rapidly substituted by an SOS-induced sister chromatid cohesion process involving the RecN protein. The loss of SCIs and viability defects observed in the absence of RecN were compensated by alterations in topoisomerase IV, suggesting that the main role of RecN during DNA repair is to promote contacts between sister chromatids. RecN also modulates whole chromosome organization and RecA dynamics suggesting that SCIs significantly contribute to the repair of DNA double-strand breaks (DSBs).

[Role of double strand DNA break repair for quinolone sensitivity in Escherichia coli: therapeutic implications]. / El papel de la reparación de roturas de doble cadena de ADN en Escherichia coli en la sensibilidad a quinolonas: implicaciones terapéuticas.

INTRODUCTION: Quinolones are one of the types of antibiotics with higher resistance rates in the last years. At molecular level, quinolones block type II topoisomerases producing double strand breaks (DSBs). These DSBs could play a double role, as inductors of the quinolone bactericidal effects but also as mediators of the resistance and tolerance mechanisms. MATERIAL AND METHODS: In this work we have studied the molecular pathways responsible for DSBs repair in the quinolone susceptibility: the stalled replication fork reversal (recombination-dependent) (RFR), the SOS response induction, the translesional DNA synthesis (TLS) and the nucleotide excision repair mechanisms (NER). For this reason, at the European University in Madrid, we analysed the minimal inhibitory concentration (MIC) to three different quinolones in Escherichia coli mutant strains coming from different type culture collections. RESULTS: recA, recBC, priA and lexA mutants showed a significant reduction on the MIC values for all quinolones tested. No significant changes were observed on mutant strains for TLS and NER. DISCUSSION: These data indicate that in the presence of quinolones, RFR mechanisms and the SOS response could be involved in the quinolone susceptibility.

Mycobacterium tuberculosis RecA is indispensable for inhibition of the mitogen-activated protein kinase-dependent bactericidal activity of THP-1-derived macrophages in vitro.

Our knowledge about the mechanisms utilized by Mycobacterium tuberculosis to survive inside macrophages is still incomplete. One of the mechanism that protects M. tuberculosis from the host's microbicidal products and allows bacteria to survive involves DNA repair systems such as the homologous recombination (HR) and nonhomologous end-joining (NHEJ) pathways. It is accepted that any pathway that contributes to genome maintenance should be considered as potentially important virulence factor. In these studies, we investigated reactive oxygen species, nitric oxide and tumor necrosis factor-α production by macrophages infected with wild-type M. tuberculosis, with an HR-defective mutant (∆recA), with an NHEJ-defective mutant [∆(ku,ligD)], with a mutant defective for both HR and NHEJ [∆(ku,ligD,recA)], or with appropriate complemented strains. We also assessed the involvement of extracellular signal-regulated kinases (ERKs) 1 and 2 in the response of macrophages to infection with the above-mentioned strains, and ERK1/2 phosphorylation in M. tuberculosis-infected macrophages. We found that mutants lacking RecA induced a greater bactericidal response by macrophages than did the wild-type strain or an NHEJ-defective mutant, and activated ERK1/2 was involved only in the response of macrophages to recA deletion mutants [∆(ku,ligD,recA) and ∆recA]. We also demonstrated that only the triple mutant induced ERK1/2 phosphorylation in phorbol-12-myristate-13-acetate-stimulated macrophages. Moreover, HR-defective mutants induced lower amounts of tumor necrosis factor-α secretion than did the wild-type or ∆(ku,ligD). Our results indicate that RecA contributes to M. tuberculosis virulence, and also suggest that diminished ERK1/2 activation in macrophages infected with M. tuberculosis possessing recA may be an important mechanism by which wild-type mycobacteria escape intracellular killing.

Rad51/Dmc1 paralogs and mediators oppose DNA helicases to limit hybrid DNA formation and promote crossovers during meiotic recombination.

During meiosis programmed DNA double-strand breaks (DSBs) are repaired by homologous recombination using the sister chromatid or the homologous chromosome (homolog) as a template. This repair results in crossover (CO) and non-crossover (NCO) recombinants. Only CO formation between homologs provides the physical linkages guiding correct chromosome segregation, which are essential to produce healthy gametes. The factors that determine the CO/NCO decision are still poorly understood. Using Schizosaccharomyces pombe as a model we show that the Rad51/Dmc1-paralog complexes Rad55-Rad57 and Rdl1-Rlp1-Sws1 together with Swi5-Sfr1 play a major role in antagonizing both the FANCM-family DNA helicase/translocase Fml1 and the RecQ-type DNA helicase Rqh1 to limit hybrid DNA formation and promote Mus81-Eme1-dependent COs. A common attribute of these protein complexes is an ability to stabilize the Rad51/Dmc1 nucleoprotein filament, and we propose that it is this property that imposes constraints on which enzymes gain access to the recombination intermediate, thereby controlling the manner in which it is processed and resolved.

Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break.

Bacillus subtilis RecA is important for spore resistance to DNA damage, even though spores contain a single non-replicating genome. We report that inactivation of RecA or its accessory factors, RecF, RecO, RecR and RecX, drastically reduce survival of mature dormant spores to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs). The presence of non-cleavable LexA renders spores less sensitive to DSBs, and spores impaired in DSB recognition or end-processing show sensitivities to X-rays similar to wild-type. In vitro RecA cannot compete with SsbA for nucleation onto ssDNA in the presence of ATP. RecO is sufficient, at least in vitro, to overcome SsbA inhibition and stimulate RecA polymerization on SsbA-coated ssDNA. In the presence of SsbA, RecA slightly affects DNA replication in vitro, but addition of RecO facilitates RecA-mediated inhibition of DNA synthesis. We propose that repairing of the DNA lesions generates a replication stress to germinating spores, and the RecA·ssDNA filament might act by preventing potentially dangerous forms of DNA repair occurring during replication. RecA might stabilize a stalled fork or prevent or promote dissolution of reversed forks rather than its cleavage that should require end-processing.

Sufficient amounts of functional HOP2/MND1 complex promote interhomolog DNA repair but are dispensable for intersister DNA repair during meiosis in Arabidopsis.

During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The homologous-pairing protein2/meiotic nuclear division protein1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases radiation sensitive51 (RAD51) and disrupted meiotic cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair.

Monitoring bypass of single replication-blocking lesions by damage avoidance in the Escherichia coli chromosome.

Although most deoxyribonucleic acid (DNA) lesions are accurately repaired before replication, replication across unrepaired lesions is the main source of point mutations. The lesion tolerance processes, which allow damaged DNA to be replicated, entail two branches, error-prone translesion synthesis (TLS) and error-free damage avoidance (DA). While TLS pathways are reasonably well established, DA pathways are poorly understood. The fate of a replication-blocking lesion is generally explored by means of plasmid-based assays. Although such assays represent efficient tools to analyse TLS, we show here that plasmid-borne lesions are inappropriate models to study DA pathways due to extensive replication fork uncoupling. This observation prompted us to develop a method to graft, site-specifically, a single lesion in the genome of a living cell. With this novel assay, we show that in Escherichia coli DA events massively outweigh TLS events and that in contrast to plasmid, chromosome-borne lesions partially require RecA for tolerance.

Mechanism of homology recognition in DNA recombination from dual-molecule experiments.

In E. coli homologous recombination, a filament of RecA protein formed on DNA searches and pairs a homologous sequence within a second DNA molecule with remarkable speed and fidelity. Here, we directly probe the strength of the two-molecule interactions involved in homology search and recognition using dual-molecule manipulation, combining magnetic and optical tweezers. We find that the filament's secondary DNA-binding site interacts with a single strand of the incoming double-stranded DNA during homology sampling. Recognition requires opening of the helix and is strongly promoted by unwinding torsional stress. Recognition is achieved upon binding of both strands of the incoming dsDNA to each of two ssDNA-binding sites in the filament. The data indicate a physical picture for homology recognition in which the fidelity of the search process is governed by the distance between the DNA-binding sites.

Antibiotic-induced bacterial cell death exhibits physiological and biochemical hallmarks of apoptosis.

Programmed cell death is a gene-directed process involved in the development and homeostasis of multicellular organisms. The most common mode of programmed cell death is apoptosis, which is characterized by a stereotypical set of biochemical and morphological hallmarks. Here we report that Escherichia coli also exhibit characteristic markers of apoptosis-including phosphatidylserine exposure, chromosome condensation, and DNA fragmentation-when faced with cell death-triggering stress, namely bactericidal antibiotic treatment. Notably, we also provide proteomic and genetic evidence for the ability of multifunctional RecA to bind peptide sequences that serve as substrates for eukaryotic caspases, and regulation of this phenotype by the protease, ClpXP, under conditions of cell death. Our findings illustrate that prokaryotic organisms possess mechanisms to dismantle and mark dying cells in response to diverse noxious stimuli and suggest that elaborate, multilayered proteolytic regulation of these features may have evolved in eukaryotes to harness and exploit their deadly potential.

Mycobacterium leprae RecA is structurally analogous but functionally distinct from Mycobacterium tuberculosis RecA protein.

Mycobacterium leprae is closely related to Mycobacterium tuberculosis, yet causes a very different illness. Detailed genomic comparison between these two species of mycobacteria reveals that the decaying M. leprae genome contains less than half of the M. tuberculosis functional genes. The reduction of genome size and accumulation of pseudogenes in the M. leprae genome is thought to result from multiple recombination events between related repetitive sequences, which provided the impetus to investigate the recombination-like activities of RecA protein. In this study, we have cloned, over-expressed and purified M. leprae RecA and compared its activities with that of M. tuberculosis RecA. Both proteins, despite being 91% identical at the amino acid level, exhibit strikingly different binding profiles for single-stranded DNA with varying GC contents, in the ability to catalyze the formation of D-loops and to promote DNA strand exchange. The kinetics and the extent of single-stranded DNA-dependent ATPase and coprotease activities were nearly equivalent between these two recombinases. However, the degree of inhibition exerted by a range of ATP:ADP ratios was greater on strand exchange promoted by M. leprae RecA compared to its M. tuberculosis counterpart. Taken together, our results provide insights into the mechanistic aspects of homologous recombination and coprotease activity promoted by M. lepare RecA, and further suggests that it differs from the M. tuberculosis counterpart. These results are consistent with an emerging concept of DNA-sequence influenced structural differences in RecA nucleoprotein filaments and how these differences reflect on the multiple activities associated with RecA protein.

Does RecA have a role in Borrelia recurrentis?

Genomic sequencing of two relapsing fever spirochaetes showed truncation of recA in Borrelia recurrentis, but not in Borrelia duttonii. RecA has an important role among bacteria; we investigated whether this characteristic was representative of B. recurrentis, or an artefact following in vitro cultivation. We sequenced recA directly from samples of patient with louse-borne relapsing fever (B. recurrentis) or tick-borne relapsing fever (B. duttonii). We confirmed the premature stop codon in seven louse-borne relapsing fever samples, and its absence from three tick-borne relapsing fever samples. Furthermore, specific signature polymorphisms were found that could differentiate between these highly similar spirochaetes.

Mycobacterium tuberculosis UvrD1 and UvrA proteins suppress DNA strand exchange promoted by cognate and noncognate RecA proteins.

DNA helicases are present in all kingdoms of life and play crucial roles in processes of DNA metabolism such as replication, repair, recombination, and transcription. To date, however, the role of DNA helicases during homologous recombination in mycobacteria remains unknown. In this study, we show that Mycobacterium tuberculosis UvrD1 more efficiently inhibited the strand exchange promoted by its cognate RecA, compared to noncognate Mycobacterium smegmatis or Escherichia coli RecA proteins. The M. tuberculosis UvrD1(Q276R) mutant lacking the helicase and ATPase activities was able to block strand exchange promoted by mycobacterial RecA proteins but not of E. coli RecA. We observed that M. tuberculosis UvrA by itself has no discernible effect on strand exchange promoted by E. coli RecA but impedes the reaction catalyzed by the mycobacterial RecA proteins. Our data also show that M. tuberculosis UvrA and UvrD1 can act together to inhibit strand exchange promoted by mycobacterial RecA proteins. Taken together, these findings raise the possibility that UvrD1 and UvrA might act together in vivo to counter the deleterious effects of RecA nucleoprotein filaments and/or facilitate the dissolution of recombination intermediates. Finally, we provide direct experimental evidence for a physical interaction between M. tuberculosis UvrD1 and RecA on one hand and RecA and UvrA on the other hand. These observations are consistent with a molecular mechanism, whereby M. tuberculosis UvrA and UvrD1, acting together, block DNA strand exchange promoted by cognate and noncognate RecA proteins.

RecA4142 causes SOS constitutive expression by loading onto reversed replication forks in Escherichia coli K-12.

Escherichia coli initiates the SOS response when single-stranded DNA (ssDNA) produced by DNA damage is bound by RecA and forms a RecA-DNA filament. recA SOS constitutive [recA(Con)] mutants induce the SOS response in the absence of DNA damage. It has been proposed that recA(Con) mutants bind to ssDNA at replication forks, although the specific mechanism is unknown. Previously, it had been shown that recA4142(F217Y), a novel recA(Con) mutant, was dependent on RecBCD for its high SOS constitutive [SOS(Con)] expression. This was presumably because RecA4142 was loaded at a double-strand end (DSE) of DNA. Herein, it is shown that recA4142 SOS(Con) expression is additionally dependent on ruvAB (replication fork reversal [RFR] activity only) and recJ (5'-->3' exonuclease), xonA (3'-->5' exonuclease) and partially dependent on recQ (helicase). Lastly, sbcCD mutations (Mre11/Rad50 homolog) in recA4142 strains caused full SOS(Con) expression in an ruvAB-, recBCD-, recJ-, and xonA-independent manner. It is hypothesized that RuvAB catalyzes RFR, RecJ and XonA blunt the DSE (created by the RFR), and then RecBCD loads RecA4142 onto this end to produce SOS(Con) expression. In sbcCD mutants, RecA4142 can bind other DNA substrates by itself that are normally degraded by the SbcCD nuclease.

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis.

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

From meiosis to postmeiotic events: uncovering the molecular roles of the meiosis-specific recombinase Dmc1.

In meiosis, the accurate segregation of maternal and paternal chromosomes is accomplished by homologous recombination. A central player in meiotic recombination is the Dmc1 recombinase, a member of the RecA/Rad51 recombinase superfamily, which is widely conserved from viruses to humans. Dmc1 is a meiosis-specific protein that functions with the ubiquitously expressed homolog, the Rad51 recombinase, which is essential for both mitotic and meiotic recombination. Since its discovery, it has been speculated that Dmc1 is important for unique aspects of meiotic recombination. Understanding the distinctive properties of Dmc1, namely, the features that distinguish it from Rad51, will further clarify the mechanisms of meiotic recombination. Recent structural, biochemical, and genetic findings are now revealing the molecular mechanisms of Dmc1-mediated homologous recombination and its regulation by various recombination mediators.

Roles of PprA, IrrE, and RecA in the resistance of Deinococcus radiodurans to germicidal and environmentally relevant UV radiation.

To study the role of different DNA repair genes in the resistance of Deinococcus radiodurans to mono- and polychromatic UV radiation, wild-type strain and knockout mutants in RecA, PprA, and IrrE of D. radiodurans were irradiated with UV-C (254 nm), UV-(A + B) (280-400 nm) and UV-A (315-400 nm) radiation, and survival was monitored. The strain deficient in recA was highly sensitive to UV-C radiation compared to the wild-type, but showed no loss of resistance against irradiation with UV-(A + B) and UV-A, while pprA and irrE-deficient strains exhibited elevated sensitivity to UV-A and UV-(A + B) radiation. These results suggest that the repair of DNA double-strand breaks is essential after treatment with highly energetic UV-C radiation, whereas protection from oxidative stress may play a greater role in resistance to environmentally relevant UV radiation.

Directed evolution of ionizing radiation resistance in Escherichia coli.

We have generated extreme ionizing radiation resistance in a relatively sensitive bacterial species, Escherichia coli, by directed evolution. Four populations of Escherichia coli K-12 were derived independently from strain MG1655, with each specifically adapted to survive exposure to high doses of ionizing radiation. D(37) values for strains isolated from two of the populations approached that exhibited by Deinococcus radiodurans. Complete genomic sequencing was carried out on nine purified strains derived from these populations. Clear mutational patterns were observed that both pointed to key underlying mechanisms and guided further characterization of the strains. In these evolved populations, passive genomic protection is not in evidence. Instead, enhanced recombinational DNA repair makes a prominent but probably not exclusive contribution to genome reconstitution. Multiple genes, multiple alleles of some genes, multiple mechanisms, and multiple evolutionary pathways all play a role in the evolutionary acquisition of extreme radiation resistance. Several mutations in the recA gene and a deletion of the e14 prophage both demonstrably contribute to and partially explain the new phenotype. Mutations in additional components of the bacterial recombinational repair system and the replication restart primosome are also prominent, as are mutations in genes involved in cell division, protein turnover, and glutamate transport. At least some evolutionary pathways to extreme radiation resistance are constrained by the temporally ordered appearance of specific alleles.