ß-SNAP activity in the outer segment growth period is critical for preventing BNip1-dependent apoptosis in zebrafish photoreceptors.

BNip1, which functions as a t-SNARE component of the syntaxin18 complex, is localized on the ER membrane and regulates retrograde transport from Golgi to the ER. BNip1 also has a BH3 domain, which generally releases pro-apoptotic proteins from Bcl2-mediated inhibition. Previously we reported that retinal photoreceptors undergo BNip1-dependent apoptosis in zebrafish ß-snap1 mutants. Here, we investigated physiological roles of BNip1-dependent photoreceptor apoptosis. First, we examined the spatio-temporal profile of photoreceptor apoptosis in ß-snap1 mutants, and found that apoptosis occurs only during a small developmental window, 2-4 days-post-fertilization (dpf), in which an apical photoreceptive membrane structure, called the outer segment (OS), grows rapidly. Transient expression of ß-SNAP1 during this OS growing period prevents photoreceptor apoptosis in ß-snap1 mutants, enabling cone to survive until at least 21 dpf. These observations suggest that BNip1-mediated apoptosis is linked to excessive activation of vesicular transport associated with rapid growth of the OS. Consistently, knockdown of Ift88 and Kif3b, which inhibits protein transport to the OS, rescued photoreceptor apoptosis in ß-snap1 mutants. Treatment with rapamycin, which inhibits protein synthesis via the mTOR pathway, also rescued photoreceptor apoptosis in ß-snap1 mutants. These data suggest that BNip1 performs risk assessment to detect excessive vesicular transport in photoreceptors.

Sec17 (α-SNAP) and Sec18 (NSF) restrict membrane fusion to R-SNAREs, Q-SNAREs, and SM proteins from identical compartments.

Membrane fusion at each organelle requires conserved proteins: Rab-GTPases, effector tethering complexes, Sec1/Munc18 (SM)-family SNARE chaperones, SNAREs of the R, Qa, Qb, and Qc families, and the Sec17/α-SNAP and ATP-dependent Sec18/NSF SNARE chaperone system. The basis of organelle-specific fusion, which is essential for accurate protein compartmentation, has been elusive. Rab family GTPases, SM proteins, and R- and Q-SNAREs may contribute to this specificity. We now report that the fusion supported by SNAREs alone is both inefficient and promiscuous with respect to organelle identity and to stimulation by SM family proteins or complexes. SNARE-only fusion is abolished by the disassembly chaperones Sec17 and Sec18. Efficient fusion in the presence of Sec17 and Sec18 requires a tripartite match between the organellar identities of the R-SNARE, the Q-SNAREs, and the SM protein or complex. The functions of Sec17 and Sec18 are not simply negative regulation; they stimulate fusion with either vacuolar SNAREs and their SM protein complex HOPS or endoplasmic reticulum/cis-Golgi SNAREs and their SM protein Sly1. The fusion complex of each organelle is assembled from its own functionally matching pieces to engage Sec17/Sec18 for fusion stimulation rather than inhibition.

Munc18-1 is crucial to overcome the inhibition of synaptic vesicle fusion by αSNAP.

Munc18-1 and Munc13-1 orchestrate assembly of the SNARE complex formed by syntaxin-1, SNAP-25 and synaptobrevin, allowing exquisite regulation of neurotransmitter release. Non-regulated neurotransmitter release might be prevented by αSNAP, which inhibits exocytosis and SNARE-dependent liposome fusion. However, distinct mechanisms of inhibition by αSNAP were suggested, and it is unknown how such inhibition is overcome. Using liposome fusion assays, FRET and NMR spectroscopy, here we provide a comprehensive view of the mechanisms underlying the inhibitory functions of αSNAP, showing that αSNAP potently inhibits liposome fusion by: binding to syntaxin-1, hindering Munc18-1 binding; binding to syntaxin-1-SNAP-25 heterodimers, precluding SNARE complex formation; and binding to trans-SNARE complexes, preventing fusion. Importantly, inhibition by αSNAP is avoided only when Munc18-1 binds first to syntaxin-1, leading to Munc18-1-Munc13-1-dependent liposome fusion. We propose that at least some of the inhibitory activities of αSNAP ensure that neurotransmitter release occurs through the highly-regulated Munc18-1-Munc13-1 pathway at the active zone.

Soluble N-Ethylmaleimide-Sensitive Factor Attachment Protein Receptor-Derived Peptides for Regulation of Mast Cell Degranulation.

Vesicle-associated V-soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins and target membrane-associated T-SNAREs (syntaxin 4 and SNAP-23) assemble into a core trans-SNARE complex that mediates membrane fusion during mast cell degranulation. This complex plays pivotal roles at various stages of exocytosis from the initial priming step to fusion pore opening and expansion, finally resulting in the release of the vesicle contents. In this study, peptides with the sequences of various SNARE motifs were investigated for their potential inhibitory effects against SNARE complex formation and mast cell degranulation. The peptides with the sequences of the N-terminal regions of vesicle-associated membrane protein 2 (VAMP2) and VAMP8 were found to reduce mast cell degranulation by inhibiting SNARE complex formation. The fusion of protein transduction domains to the N-terminal of each peptide enabled the internalization of the fusion peptides into the cells equally as efficiently as cell permeabilization by streptolysin-O without any loss of their inhibitory activities. Distinct subsets of mast cell granules could be selectively regulated by the N-terminal-mimicking peptides derived from VAMP2 and VAMP8, and they effectively decreased the symptoms of atopic dermatitis in mouse models. These results suggest that the cell membrane fusion machinery may represent a therapeutic target for atopic dermatitis.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

α-SNAP interferes with the zippering of the SNARE protein membrane fusion machinery.

Neuronal exocytosis is mediated by soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins. Before fusion, SNARE proteins form complexes bridging the membrane followed by assembly toward the C-terminal membrane anchors, thus initiating membrane fusion. After fusion, the SNARE complex is disassembled by the AAA-ATPase N-ethylmaleimide-sensitive factor that requires the cofactor α-SNAP to first bind to the assembled SNARE complex. Using chromaffin granules and liposomes we now show that α-SNAP on its own interferes with the zippering of membrane-anchored SNARE complexes midway through the zippering reaction, arresting SNAREs in a partially assembled trans-complex and preventing fusion. Intriguingly, the interference does not result in an inhibitory effect on synaptic vesicles, suggesting that membrane properties also influence the final outcome of α-SNAP interference with SNARE zippering. We suggest that binding of α-SNAP to the SNARE complex affects the ability of the SNARE complex to harness energy or transmit force to the membrane.

An essential and NSF independent role for α-SNAP in store-operated calcium entry.

Store-operated calcium entry (SOCE) by calcium release activated calcium (CRAC) channels constitutes a primary route of calcium entry in most cells. Orai1 forms the pore subunit of CRAC channels and Stim1 is the endoplasmic reticulum (ER) resident Ca(2+) sensor. Upon store-depletion, Stim1 translocates to domains of ER adjacent to the plasma membrane where it interacts with and clusters Orai1 hexamers to form the CRAC channel complex. Molecular steps enabling activation of SOCE via CRAC channel clusters remain incompletely defined. Here we identify an essential role of α-SNAP in mediating functional coupling of Stim1 and Orai1 molecules to activate SOCE. This role for α-SNAP is direct and independent of its known activity in NSF dependent SNARE complex disassembly. Importantly, Stim1-Orai1 clustering still occurs in the absence of α-SNAP but its inability to support SOCE reveals that a previously unsuspected molecular re-arrangement within CRAC channel clusters is necessary for SOCE. DOI:http://dx.doi.org/10.7554/eLife.00802.001.

A membrane fusion protein αSNAP is a novel regulator of epithelial apical junctions.

Tight junctions (TJs) and adherens junctions (AJs) are key determinants of the structure and permeability of epithelial barriers. Although exocytic delivery to the cell surface is crucial for junctional assembly, little is known about the mechanisms controlling TJ and AJ exocytosis. This study was aimed at investigating whether a key mediator of exocytosis, soluble N-ethylmaleimide sensitive factor (NSF) attachment protein alpha (αSNAP), regulates epithelial junctions. αSNAP was enriched at apical junctions in SK-CO15 and T84 colonic epithelial cells and in normal human intestinal mucosa. siRNA-mediated knockdown of αSNAP inhibited AJ/TJ assembly and establishment of the paracellular barrier in SK-CO15 cells, which was accompanied by a significant down-regulation of p120-catenin and E-cadherin expression. A selective depletion of p120 catenin effectively disrupted AJ and TJ structure and compromised the epithelial barrier. However, overexpression of p120 catenin did not rescue the defects of junctional structure and permeability caused by αSNAP knockdown thereby suggesting the involvement of additional mechanisms. Such mechanisms did not depend on NSF functions or induction of cell death, but were associated with disruption of the Golgi complex and down-regulation of a Golgi-associated guanidine nucleotide exchange factor, GBF1. These findings suggest novel roles for αSNAP in promoting the formation of epithelial AJs and TJs by controlling Golgi-dependent expression and trafficking of junctional proteins.

Identifying candidate genes for Parkinson's disease by integrative genomics method.

INTRODUCTION: The recent studies of Parkinson's disease (PD) indicate that genetics and environmental factors may play an important role in developing of PD. Nowadays, the cell death and cell adhesion are pathogenetic mechanisms which could be related with PD. On the basis of relationship of those mechanisms with PD, the aim of this study was to identify new candidate genes for PD by integration of results of transcriptomics studies and results obtained by Biomedical Discovery Support System (BITOLA). MATERIALS AND METHODS: For the detection of functional relationship between potential candidate gene and pathogenetic mechanisms associated with PD, we designed strategy of integration of results of transcriptomics studies with discovery approach in bibliographic data bases and BITOLA. Data of chromosome location, tissue-specific expression, function of potential candidate genes and their association with genetics disorders were obtained from Medline, Locus Link, Gene Cards and OMIM. RESULTS: Integration and comparison of results obtained using the BITOLA system and analysis of transcriptomics studies identified six genes (MAPT, UCHL1, NSF, CDC42, PARK2 and GFPT1) that occur simultaneously in both group of results. The function of genes NSF, CDC42 and GFPT1 in the pathogenesis of PD has not been studied yet. CONCLUSIONS: According to our result that aforementioned genes appeared in both groups of results and partially match the criteria set for the selection of candidate genes and their potential role in the development of PD, they should be tested by methods specifically intended for those three genes.

SNARE protein recycling by αSNAP and ßSNAP supports synaptic vesicle priming.

Neurotransmitter release proceeds by Ca(2+)-triggered, SNARE-complex-dependent synaptic vesicle fusion. After fusion, the ATPase NSF and its cofactors α- and ßSNAP disassemble SNARE complexes, thereby recycling individual SNAREs for subsequent fusion reactions. We examined the effects of genetic perturbation of α- and ßSNAP expression on synaptic vesicle exocytosis, employing a new Ca(2+) uncaging protocol to study synaptic vesicle trafficking, priming, and fusion in small glutamatergic synapses of hippocampal neurons. By characterizing this protocol, we show that synchronous and asynchronous transmitter release involve different Ca(2+) sensors and are not caused by distinct releasable vesicle pools, and that tonic transmitter release is due to ongoing priming and fusion of new synaptic vesicles during high synaptic activity. Our analysis of α- and ßSNAP deletion mutant neurons shows that the two NSF cofactors support synaptic vesicle priming by determining the availability of free SNARE components, particularly during phases of high synaptic activity.

NSF independent fusion of Salmonella-containing late phagosomes with early endosomes.

Initial characterizations of live-Salmonella-containing early (LSEP) and late phagosomes (LSLP) in macrophages show that both phagosomes retain Rab5 and EEA1. In addition, LSEP specifically contain transferrin receptor whereas LSLP possess relatively more rabaptin-5. In contrast to LSLP, late-Salmonella-containing vacuoles in epithelial cells show significantly reduced levels of Rab5 and EEA1. Subsequent results demonstrate that both phagosomes efficiently fuse with early endosomes (EE). In contrast to LSEP, fusion between LSLP and EE is insensitive to ATPgammaS treatment. Furthermore, LSLP fuses with EE in absence of NEM-sensitive fusion factor (NSF) as well as in the presence of NSF:D1EQ mutant demonstrating that LSLP fusion with EE is NSF independent.