[Effect of rapamycin and chloroquine on osteosarcoma].

Objective: To investigate the combination effect of anti-tumor agent rapamycin and anti-autophagy agent chloroquine on osteosarcoma. Methods: The inhibition effect of rapamycin or chloroquine and combination of both on human osteosarcoma cell line 143B measured with CCK-8 box.The combination index at different concentration was calculated, and the synergism effect range was analysed.The effect of combined therapy on cell cycle and apoptosis via flow cytometric was analyzted.Setting up murine subcutaneous xenograft model, the combination effect of antitumor in vivo observed. Results: Either of them, rapamycin or chloroquine had an antitumor effect in vitro (RAPA: IC50=1.5 nmol/L; CQ: IC50=400 µmol/L). When the inhibition rate 40%

Reason and treatment of failure of proximal femoral nail antirotation internal fixation for femoral intertrochanteric fractures of senile patients.

The cause of postoperative failure after the treatment of femoral intertrochanteric fracture with proximal femoral nail antirotation (PFNA) was analyzed, and the reoperative methods were examined. Nine failures of 308 femoral intertrochanteric fracture patients with PFNA were treated with femoral prosthesis total hip replacement (THR) and reoperative internal fixation. All nine patients were analyzed to determine the cause of failure. The causes of failed internal fixation in the intertrochanteric-fractured patients included perforation of the helical blade into the hip joint in three cases, cutting-out of the helical blade exit outside in two cases, and hip varus as a result of cutting-out the helical blade in two cases. Seven patients with failed internal fixation were treated with THR. Two patients who had femoral shaft fractures at the end of the nail were treated with longer PFNA. Faulty operative procedures, unsatisfactory reductions, serious osteoporosis, and incorrect positioning of the helical blade were the most important factors responsible for the failed internal fixation. Satisfactory results were achieved with THR and refixation relative to the causes of the failed internal fixation.

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

A comparison of regional and general anaesthesia for total replacement of the hip or knee: a meta-analysis.

We performed a meta-analysis to evaluate the relative efficacy of regional and general anaesthesia in patients undergoing total hip or knee replacement. A comprehensive search for relevant studies was performed in PubMed (1966 to April 2008), EMBASE (1969 to April 2008) and the Cochrane Library. Only randomised studies comparing regional and general anaesthesia for total hip or knee replacement were included. We identified 21 independent, randomised clinical trials. A random-effects model was used to calculate all effect sizes. Pooled results from these trials showed that regional anaesthesia reduces the operating time (odds ratio (OR) -0.19; 95% confidence interval (CI) -0.33 to -0.05), the need for transfusion (OR 0.45; 95% CI 0.22 to 0.94) and the incidence of thromboembolic disease (deep-vein thrombosis OR 0.45, 95% CI 0.24 to 0.84; pulmonary embolism OR 0.46, 95% CI 0.29 to 0.80). Regional anaesthesia therefore seems to improve the outcome of patients undergoing total hip or knee replacement.