Intratumoral gene delivery of anti-cathepsin L single-chain variable fragment by lentiviral vector inhibits tumor progression induced by human melanoma cells.

We previously demonstrated that the switch from non- to highly tumorigenic phenotype of human melanoma cells is directly related to procathepsin L secretion, which increased cell resistance to complement-mediated cell lysis. Involvement of procathepsin L secretion in tumor growth was clearly demonstrated by three different strategies: (1) inhibition of secreted procathepsin L activity; (2) increase of procathepsin L secretion; and (3) inhibition of procathepsin L secretion. This latter strategy was triggered by intracellular expression of anti-human cathepsin L single-chain variable fragment (ScFv). These previous experiments were performed by processing melanoma cells before their injection into nude mice. We herein designed a new lentiviral vector in which this anti-cathepsin L ScFv was cloned. This lentiviral vector was optimized to allow the highest intracellular expression of anti-cathepsin L ScFv in transduced melanoma cells. In these transduced cells, procathepsin L secretion was strongly inhibited. In addition, injection of this anti-cathepsin L ScFv lentiviral vector into tumors already induced in nude mice inhibited tumor growth and associated angiogenesis. This is the first report to demonstrate that targeting procathepsin L secretion with anti-cathepsin L ScFv lentiviral construct constitutes a new gene therapy in the challenge to inhibit the growth of tumors induced by human melanoma cells.

Expression of cathepsin L in human tumor cells is under the control of distinct regulatory mechanisms.

Cathepsin L, a cysteine protease, is overexpressed in human tumor cells and plays a major role in melanoma progression. Our aim was herein to identify molecular mechanisms, which contribute to its overexpression. We found that cathepsin L protein expression correlated with mRNA level in tumor cells. Therefore, we focused on mechanisms involved in cathepsin L mRNA regulation. CpG island was localized in the 5' region of cathepsin L gene that encompassed regulatory regions identified as essential for promoter activity. CpG dinucleotides, not methylated in any melanoma cells analysed, were methylated in a B lymphoma cell line, which poorly express cathepsin L. Our data demonstrate that in lymphoma cells, cathepsin L silencing was methylation-dependent. Furthermore, gene amplification was involved in cathepsin L overexpression in one melanoma cell line, while transcriptional mechanisms but not mRNA stability are responsible of cathepsin L overexpression in others melanoma cells. In addition, NF-Y, Sp1, Sp2 and Sp3 transcription factors, essential to basal cathepsin L transcription, are not directly involved in overexpression. Thus, our data provides the first demonstration that cathepsin L expression in tumor cells is under the control of distinct molecular mechanisms.

Activation of the EBV/C3d receptor (CR2, CD21) on human B lymphocyte surface triggers tyrosine phosphorylation of the 95-kDa nucleolin and its interaction with phosphatidylinositol 3 kinase.

We previously demonstrated that CR2 activation on human B lymphocyte surface triggered tyrosine phosphorylation of a p95 component and its interaction with p85 subunit of phosphatidylinositol 3' (PI 3) kinase. Despite identical molecular mass of 95 kDa, this tyrosine phosphorylated p95 molecule was not CD19, the proto-oncogene Vav, or the adaptator Gab1. To identify this tyrosine phosphorylated p95 component, we first purified it by affinity chromatography on anti-phosphotyrosine mAb covalently linked to Sepharose 4B, followed by polyacrylamide gel electrophoresis. Then, the isolated 95-kDa tyrosine phosphorylated band was submitted to amino acid analysis by mass spectrometry; the two different isolated peptides were characterized by amino acid sequences 100% identical with two different domains of nucleolin, localized between aa 411--420 and 611--624. Anti-nucleolin mAb was used to confirm the antigenic properties of this p95 component. Functional studies demonstrated that CR2 activation induced, within a brief span of 2 min, tyrosine phosphorylation of nucleolin and its interaction with Src homology 2 domains of the p85 subunit of PI 3 kinase and of 3BP2 and Grb2, but not with Src homology 2 domains of Fyn and Gap. These properties of nucleolin were identical with those of the p95 previously described and induced by CR2 activation. Furthermore, tyrosine phosphorylation of nucleolin was also induced in normal B lymphocytes by CR2 activation but neither by CD19 nor BCR activation. These data support that tyrosine phosphorylation of nucleolin and its interaction with PI 3 kinase p85 subunit constitute one of the earlier steps in the specific intracellular signaling pathway of CR2.

RB18A, whose gene is localized on chromosome 17q12-q21.1, regulates in vivo p53 transactivating activity.

Among the different cellular factors that regulated p53 functions, we previously identified (P. Drane et al., Oncogene, 15: 3013-3024, 1997) RB18A, a new gene whose encoded Mr 205,000 protein interacted in vitro, through its COOH-terminal domain, with p53. Therefore, we analyzed the in vivo role of RB18A by measuring its effect on the transactivating activity of p53 on physiological promoters. We herein demonstrated that RB18A, which interacted also in vivo with p53, activated Bax promoter and inhibited p21Waf1 or IGF-BP3 promoters. In addition, fluorescence in situ hybridization mapping led to localizing the RB18A gene on chromosome 17q12-q21.1, loci associated with human cancers. This is the first demonstration that in vivo RB18A, in a protein-protein interaction, regulates p53 transactivating activity.

p56lck activity and expression in peripheral blood lymphocytes from patients with systemic lupus erythematosus.

In this study we analyzed the activity and the expression of p56lck protein tyrosine kinase in peripheral blood lymphocytes (PBLs) from systemic lupus erythematosus (SLE) patients and from healthy donors. The p56lck activity, determined by a non-radioactive Tyrosine Kinase Assay Kit, was significantly higher in active SLE PBLs and discriminated this group of patients from inactive SLE patients (p = 0.002) and healthy donors (p = 0.009). p56lck level decreased in SLE lymphocytes (especially for inactive SLE lymphocytes, p = 0.005) when compared to healthy donors. These differences were also reflected by the specific activity of p56lck that was clearly elevated in active SLE lymphocytes when compared to inactive SLE (p = 0.022) or healthy donors lymphocytes (p = 0.006). A positive correlation between the activity of p56lck and the tyrosine phosphorylation level in active SLE lymphocytes was found.

Structure and functions of proteases which cleave human C3 and are expressed on normal or tumor human cells: some are involved in tumorigenic and metastatic properties of human melanoma cells.

Human C3 is a multipotent molecule which participates to different events involved in immune response as complement activation, antigen presentation, cell-cell interactions and cell proliferation. Thus, proteinases which cleave C3 may modify C3-dependent cellular functions. This led us to identify two membrane-associated proteinases which cleave human C3: (a) A p57 serine proteinase expressed on human erythrocyte membranes--This p57 proteinase shared antigenic determinants with ankyrine and may be involved in clearance of immune complexes; (b) A p41 cysteine proteinase, which shares antigenic determinants, amino-acid sequence and specific activity with procathepsin-L--This p41 C3-cleaving cyteine proteinase is also involved in tumorigenic and metastatic properties of human melanoma in nude mice. Indeed, pretreatment of highly tumorigenic and metastatic melanoma cells with anti-p39 Ab totally abolished their tumorigenicity and significantly decreased the number of experimental lung metastases in nude mice. Furthermore, overexpression of procathepsin-L in nonmetastatic melanoma cells increased their tumorigenicity and switched their phenotype to highly metastatic cells in nude mice. Altogether, these data support that expression and secretion of procathepsin-L, which cleaves human C3, might be one of the multiple mechanisms by which tumor cells escape the immune surveillance.

Signaling through the EBV/C3d receptor (CR2, CD21) in human B lymphocytes: activation of phosphatidylinositol 3-kinase via a CD19-independent pathway.

We herein analyzed the regulation of phosphatidylinositol 3-kinase (PI 3-kinase) activity by CR2 activated on B lymphocyte cell surface. We demonstrated that CR2 activation triggered in vivo PI 3-kinase activity and interaction of PI 3-kinase p85 subunit with a tyrosine-phosphorylated p95 component. The specificity of PI 3-kinase activity was controlled using wortmannin and LY294002. CR2 activation did not trigger tyrosine phosphorylation of PI 3-kinase p85 subunit, but induced direct interaction of tyrosine phosphorylated p95 with the Src homology 2 domain of p85 subunit, as shown using glutathione-S-transferase fusion proteins. Despite identical molecular masses, immunoblotting analysis demonstrated that tyrosine-phosphorylated p95 that interacted in vivo and in vitro with p85 was neither CD19, the 95-kDa proto-oncogene vav, nor Gab1 (a 95-kDa adaptor molecule). Furthermore, p95 tyrosine phosphoprotein also expressed in K562A cells (CR2+ CD19- cells) interacted with Src homology 2 domain of PI 3-kinase p85 subunit after CR2 activation. Activated CR2 did not interact directly with p85 subunit or tyrosine-phosphorylated p95. This suggests the presence of an intermediate molecule between activated CR2 and tyrosine-phosphorylated p95, which may be 3BP2. In addition, in contrast to CD19 activation, CR2 activation did not trigger interaction of CD19 or Vav with PI 3-kinase p85 subunit or coprecipitation of PI 3-kinase activity with CD19. Together, these data clearly demonstrated that CR2 activation triggered in vivo PI 3-kinase activation through a pathway distinct from that triggered through CD19 activation.

Binding of the endogenously expressed Epstein-Barr virus (EBV) envelope glycoprotein gp350 with the viral receptor masks the major EBV-neutralizing epitope and affects gp350-specific ADCC.

The major neutralizing epitope (MNE) for the Epstein-Barr virus (EBV) is present on its envelope glycoprotein gp350/220 (hereafter referred to as gp350) in close proximity to the virus-receptor (CR2) binding site and is recognized by the neutralizing murine monoclonal antibody (mAb) 72A1. We studied the reactivities of 72A1 and another anti-gp350 mAb 2L10 (which does not neutralize EBV) with gp350 expressed on three different lymphoid cell lines (Raji, CEM.NKr and BJA-B). Our results indicate that gp350 expressed on the surface of CR2-positive cells interacts with the viral receptor and that this interaction masks the major EBV-neutralizing epitope. The interaction was reversible and the masked epitope was revealed on incubation with an excess of anti-CR2 mAb OKB7. Gp350-expressing CEM-NKr cells with intact MNE exhibited significantly higher (P < or = 0.05) lysis in gp350-specific antibody-dependent cellular cytotoxic assays compared with its Raji counterpart. The present results may have important implications for the use of soluble viral receptors as therapeutic agents in acute and chronic EBV and other viral infections (e.g., HIV-1).

Procathepsin-L, a proteinase that cleaves human C3 (the third component of complement), confers high tumorigenic and metastatic properties to human melanoma cells.

We previously demonstrated that highly metastatic human melanoma cells secrete a 41 kDa proteinase that cleaves C3, the third component of complement, and shares antigenic determinants with procathepsin-L. Thus, we herein transfected the nonmetastatic DX-3 melanoma cells with the procathepsin-L cDNA. Three clones expressing and secreting high levels of procathepsin-L were selected. Conditioned medium and whole cell extracts from these clones, but not from control cells, carried a high C3-cleaving activity. The transfected clones displayed up to 60% resistance to complement-mediated lysis. Overexpression of procathepsin-L in melanoma cells increased their tumorigenicity and switched their phenotype from nonmetastatic to highly metastatic cells. This is the first report that demonstrates that enforced expression of procathepsin-L by human melanoma cells arms them with the ability to inactivate complement-mediated lysis and contributes to tumor growth and metastasis.

Alpha 1-proteinase inhibitor is the serum regulator of the activity of p57, a C3-cleaving proteinase present in human erythrocyte membranes.

Human erythrocytes express at the membrane level a p57 serine proteinase which cleaves C3, the third component of complement. We demonstrated herein that human serum carries an inhibitory activity against this p57 membrane proteinase. Purification allowed to identify this inhibitor as the alpha 1-proteinase inhibitor (alpha 1-PI) on the basis of its molecular weight, antigenicity and amino acid sequence identity. Data demonstrated that alpha 1-PI is the unique and strong serum inhibitor of the p57 proteinase activity: inhibition studies showed that alpha 1-PI inhibited p57 proteinase activity with a kass value of 10(5) M-1 s-1. Inhibition of p57 proteinase by alpha 1-PI was due to formation of a SDS-stable complex between both components. We suggest that inhibition of the membrane p57 proteinase activity by serum alpha 1-PI may be involved in the regulation of C3 fragment generation and/or in clearance in liver of C3b bearing immune complexes by erythrocyte-CR1.

Evidence for a new transcript of the Epstein-Barr virus/C3d receptor (CR2, CD21) which is due to alternative exon usage.

CR2 extracellular domain is constituted of 15 or 16 Short Consensus Repeats (SCR), with additional SCR 11 localized between SCRs 10 and 12. We amplified Raji cDNA library, with specific primers where SCR 11 is localized. This generated a new fragment of 643 bp (16b SCR), in addition to the two expected transcripts of 489 (15 SCR) and 667 (16a SCR) bp. Sequencing these three fragments and the corresponding genomic DNA, demonstrated the presence of a 24 bp deletion in 16b SCR, without change of open reading frame and that this 24 bp region was flanked by two splicing acceptor sites. This supported a new alternative splicing of CR2, with generation of a third distinct mRNA. This third transcript was expressed in human CR2 positive T cells, normal or transformed B cells and EBV negative B cell lines. The 24 bp deletion corresponds to a proline-rich region, which may influence CR2 conformation and more likely have consequences on CR2 extra and intracellular interactions.

Co-expression and secretion of C3, the third component of complement and a C3-cleaving cysteine proteinase in a highly metastatic human melanoma cell line.

We recently demonstrated that DM-4, a human melanoma cell line highly metastatic in nude mice, expressed a p41 C3-cleaving proteinase. This p41 proteinase is a cysteine proteinase, associated to cell surface and involved in tumorigenicity and metastatic properties of these tumor cells. We demonstrate herein that DM-4 cells also secrete the p41 proteinase. In addition, analysis of cellular components which reacted with the p41 proteinase led us to demonstrate that DM-4 cells synthesized and secreted human C3. Secreted C3 is cleaved by the secreted p41 proteinase and a C3dg-like fragment is generated. This is the first demonstration that a human melanoma cell line co-expresses and co-secretes human C3 and a C3-cleaving cysteine proteinase, antigenically related to procathepsin L.

Identification of RB18A, a 205 kDa new p53 regulatory protein which shares antigenic and functional properties with p53.

Immunological screening with the anti-p53 moAb, PAb1801 of a cDNA expression library, prepared from human B lymphoma cells, led us to identify a new human 205 kDa protein called RB18A for 'Recognized By PAb1801 moAntibody'. Immunoblotting or immunoprecipitation of fusion protein or in vitro translated protein, respectively, demonstrated that RB18A protein was recognized by several anti-p53 moAb reacting with the N or C-terminal domains of p53. Full length sequence of RB18A cDNA and computer analysis demonstrated that despite common antigenic determinants between RB18A and p53 proteins, nucleotide and deduced protein sequences did not reveal any significant homologies. RB18A mRNA was detected in all tissues tested except in kidney. In addition, RB18A protein shared identical functions with p53 protein: binding to DNA or to p53 and self-oligomerization. Furthermore, RB18A regulated p53 specific binding on his DNA consensus binding site. These functions were associated to the C-terminal domain of RB18A protein and more specifically to the PAb421 binding site present in this domain. The activation by RB18A of p53 binding on DNA was induced through an unstable interaction between both proteins. Altogether, our data demonstrated that RB18A protein shares antigenic and functional properties with p53 and regulated p53 functions.

Tyrosine phosphorylation in peripheral lymphocytes from patients with systemic lupus erythematosus.

A comparative study of tyrosine phosphorylation was performed on peripheral blood lymphocytes from systemic lupus erythematosus (SLE) patients and from healthy donors. Freshly isolated SLE lymphocytes presented an elevated tyrosine phosphorylation level when compared to healthy donors lymphocytes (p = 0.005). Among all phosphorylated proteins, those called p120, p110, p80 and p55-p60 were more phosphorylated. The level of tyrosine phosphorylation of p120 and p110 proteins discriminated significantly (p = 0.0048, respectively, p = 0.02) between SLE patients and healthy donors. Lymphocytes form SLE patients and healthy donors were then stimulated by cross-linking T cell antigens (CD3, CD4, CD8) to further distinguish the signal transduction between normal and pathologic lymphocytes. No statistical differences in the tyrosine phosphorylation pattern, following CD4 or CD8 cross-linking, were observed between SLE patients and healthy donors lymphocytes. CD3 cross-linking induced an effect on tyrosine phosphorylation different in SLE patients versus healthy donors lymphocytes. Thus, the lymphocytes of SLE patients were refractile in anti-CD3 stimulation in comparison with the healthy donors lymphocytes. Chi-square analysis demonstrated that a significantly larger number of healthy donors responded to anti-CD3 stimulation compared to SLE patients (p = 0.03). The high frequency of tyrosine phosphorylation of p110 and p80 proteins, following CD3 stimulation, in normal versus SLE lymphocytes, suggested that these proteins could be involved in abnormal signal transduction in SLE cells.

A cysteine proteinase, which cleaves human C3, the third component of complement, is involved in tumorigenicity and metastasis of human melanoma.

The DM-4 human melanoma cell line, which is highly metastatic in nude mice, expresses a C3-cleaving activity that proteolyzes labeled as well as unlabeled human C3. This C3-cleaving activity is a cysteine proteinase characterized by a M(r) 41,000. The p41 proteinase shares antigenic determinants with murine p39 procathepsin-L and human procathepsin-L. Preincubation of DM-4 cells with anti-p39 F(ab')2 induced up to 45% decrease in their complement resistance. Pretreatment of DM-4 cells with anti-p39 Ab strongly inhibited their tumorigenicity and significantly decreased their metastatic potential in nude mice. Thus, the p41 C3-cleaving proteinase contributes to tumorigenicity and metastasis of human melanoma DM-4 cells.

Identification on melanoma cells of p39, a cysteine proteinase that cleaves C3, the third component of complement: amino-acid-sequence identities with procathepsin L.

We previously identified, on normal or tumour cells, two membrane proteinases, p57 and p65, that cleave human C3, the third component of complement, thus regulating C3's biological properties. Whereas p57 was purified from human erythrocytes, p65 was identified using polyclonal anti-p57 antibodies on a human melanoma cell line resistant to complement lysis. Analysis of cell distribution of C3-cleaving proteinases established that DSm, a murine melanoma cell line, expressed a C3-cleaving proteinase distinct from p57 and p65 proteinases. Thus we purified the C3-cleaving proteinase solubilized from membranes of DSm cells. The purified proteinase, termed 'p39' on the basis of its molecular mass of 39 kDa, was identified, using specific proteinase inhibitors, as a cysteine proteinase. Anti-p39 antibodies, prepared against highly purified p39, localized the p39 C3-cleaving proteinase mainly at the cell surface and demonstrated that p39 is also secreted. Anti-p39 antibodies inhibited solubilized C3-cleaving activity. Preincubation of DSm cells with anti-p39 F(ab')2 fragments increased up to 60% complement cell susceptibility. Amino acid analysis of N-terminal and three other regions of p39 demonstrated that this C3-cleaving proteinase carries 100% identity within four regions of procathepsin L. This is the first demonstration that a melanoma cell line expresses on its surface and secretes a p39 C3-cleaving cysteine proteinase that shares sequence identities with procathepsin L. Thus the p39 cysteine proteinase represents a new member of the C3-cleaving proteinase family associated with, and/or expressed on, the cell surface.

Pep34, a synthetic peptide whose sequence corresponds to the intracytoplasmic domain of the Epstein-Barr virus receptor (CR2, CD21), regulates human B lymphocyte proliferation triggered through CR2.

CR2 is involved in regulation of human B lymphocyte proliferation by interacting, through distinct domains, with extracellular, cell surface or intracellular components. Contribution of CR2 intracytoplasmic domain in CR2 regulatory functions remains unclear. Thus, we used pep34, a 34 amino acid synthetic peptide whose sequence corresponds to CR2 intracytoplasmic domain. Pep34 was incorporated into B lymphocytes which were then activated by EBV or C3d through CR2. Our data demonstrate that pep34 inhibits 100% B lymphocyte proliferation triggered by EBV or C3d. Irrelevant peptide had no effect. When B lymphocyte proliferation was triggered by a multipotent B cell activator as SAC, pep34 did not exert any inhibitory effect. Our data demonstrate that pep34 inhibits B lymphocyte proliferation only when lymphocytes are triggered through CR2. Thus, this strongly supports that despite its short length. CR2 intracytoplasmic domain participates to regulatory functions of this receptor.

Epstein-Barr virus/C3d receptor (CR2, CD21) activated by its extracellular ligands regulates pp105 phosphorylation through two distinct pathways.

We previously demonstrated that human C3d or pep16, a 16-amino acid synthetic peptide derived from human C3d, induced in vivo and in vitro tyrosine phosphorylation of pp105, an intracellular component found only in human cells that express CR2 at their surface. To determine the contribution of CR2 molecules to this enzymatic regulation, we first analyzed whether activation of CR2 by other extracellular CR2 ligands could trigger such regulation in cell extracts. Subsequently, we used cell extracts of either CR2-positive cells depleted in CR2 molecules by absorption with anti-CR2 antibodies or CR2-negative cells transfected with CR2 cDNA. We demonstrate here that pp105 phosphorylation was induced when CR2 was activated by C3d and pep16 as well as by gp350, the Epstein-Barr virus capsid protein or OKB7, an anti-CR2 monoclonal antibody (mAb). HB5, another anti-CR2 mAb, which did not activate B lymphocytes through CR2, did not induce pp105 phosphorylation. Thus, C3d, pep16, gp350, and OKB7 presented similar properties in activating CR2 to trigger pp105 phosphorylation and in regulating B lymphocyte proliferation, while HB-5 had no effect on either assays. Furthermore, our data demonstrate that the presence of CR2 activated by its extracellular ligands regulates pp105 phosphorylation through two distinct pathways: one which also requires the presence of non-activated CD19, and one which is independent of CD19. The involvement of CD19 in the first pathway was not due to the formation of putative CR2-CD19 complexes. Both pathways were TAPA-1 independent. This is the first demonstration that activated CR2 molecules can play a regulatory role in enzymatic function, such as phosphorylation, despite the absence of CD19 and TAPA-1.

Wild-type p53 regulates its own transcription in a cell-type specific manner.

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.

Binding sites of the Epstein-Barr virus and C3d receptor (CR2, CD21) for its three intracellular ligands, the p53 anti-oncoprotein, the p68 calcium binding protein and the nuclear p120 ribonucleoprotein.

Epstein-Barr virus/C3d receptor (CR2, CD21) interacts with three intracellular proteins: the p53 anti-oncoprotein expressed in human B lymphoma cells, the p68 calcium binding protein expressed in normal B lymphocytes and the nuclear p120 ribonucleoprotein (RNP). We previously demonstrated that p53 and p68 interacted with the intracytoplasmic carboxy-terminal domain of CR2. To analyse the amino acid sequence of CR2 binding sites for p53 and p68, we synthesized different peptides whose sequences were derived from this carboxy-terminal domain. Thus, CR2 bound to p53 and p68 through two distinct binding sites localized on the N-terminal and on the central part of its carboxy-terminal domain, characterized by the amino acid sequences of KHRERNYYTD and KEAFHLEARE, respectively. CR2 site reacting with the nuclear p120RNP was determined using either anti-CR2 mAb directed against its extracellular domain or pep34, pep14/SCR3 and pep14/SCR4, synthetic peptides whose sequences corresponded to the intracellular 34 amino acid domain or to sites of the extracellular domain of CR2, respectively. Data support that CR2 interacts with p120RNP through the DEGYRLQGPPSSRC amino acid sequence of its extracellular SCR4 domain. Furthermore, phosphorylation of CR2 inhibits its interaction with the nuclear p120RNP. Binding of CR2, through its intracellular and extracellular domains, with the p53 oncoprotein and p120RNP, respectively, and the co-localization of these three proteins on nuclear interchromatin fibrils, suggest that CR2 could act as a crosslinker between these two nuclear proteins to regulate their functions.