Antigen processing of vesicular stomatitis virus in situ. Interdigitating dendritic cells present viral antigens independent of marginal dendritic cells but fail to prime CD4(+) and CD8(+) T cells.

Acute macrophage (M phi) depletion, using a liposome-mediated 'suicide technique', markedly suppressed priming of splenic CD4(+) and CD8(+) T-cell responses to vesicular stomatitis virus (VSV). However, phagocytic marginal dendritic cells (MDC), but not interdigitating dendritic cells (IDC), are now known to be also depleted by this technique. To clarify the role splenic dendritic cell (DC) subsets and M phi play in priming for a virus-specific T-cell-mediated immune response, DC and M phi were purified from VSV-infected mice and assayed for the presence of epitopes recognized by VSV helper T (Th) cells and cytotoxic T lymphocytes (CTL). Antigen pulse experiments performed in situ demonstrated that VSV Th cell and CTL epitopes became transiently associated only with DC, but not M phi or B cells, indicating that DC represent the critical antigen-presenting cell (APC) population in vivo for this virus. The failure of MDC/M phi-deficient mice to become primed was not due to the complete elimination of antigen-presenting DC because VSV peptide/class I and II complexes were detected on IDC following lipsome-mediated elimination of phagocytic cells. However, the VSV-induced chemokine response was dramatically suppressed in these mice. Thus, despite the expression of VSV peptide/class I and II complexes, IDC are not sufficient to prime VSV Th cells in the absence of MDC and/or splenic M phi.

Lipocortin 1 fragment modifies pyrogenic actions of cytokines in rats.

Lipocortins form a group of proteins that have been proposed as mediators of the anti-inflammatory actions of glucocorticoids. Intracerebroventricular injection of a recombinant fragment of lipocortin 1 (NH2-terminal 1-188) caused dose-dependent (0.4-1.2 micrograms) reductions in the acute increases in colonic temperature and oxygen consumption, which occurred in response to central injections of recombinant interleukin 1 beta and gamma-interferon in conscious rats. In contrast the lipocortin fragment did not affect the response to prostaglandin E2, and its activity was prevented by heat treatment or by pretreatment of animals with polyclonal antiserum raised to the fragment. Central injection of antiserum significantly enhanced the thermogenic responses to interleukin 1 beta in rats treated with dexamethasone without affecting the responses in normal animals. These results support a physiological role for lipocortin in the central effects of glucocorticoids.

Functionally important conserved amino-acids in interferon-alpha 2 identified with analogues produced from synthetic genes.

A gene was chemically synthesised and expressed in Escherichia coli to produce [Ala30,32,33]IFN-alpha 2, an analogue of human alpha 2-interferon (IFN-alpha 2) which is devoid of activity on human cells. Eight additional analogues provided single changes in IFN-alpha 2 at each of these three conserved positions. No one residue is essential for activity, but both antiviral and anti-proliferative activity are particularly sensitive to changes in the side-chain of Arg33.

Chemical synthesis of a human interferon-alpha 2 gene and its expression in Escherichia coli.

A 511-base pair DNA fragment encoding human interferon-alpha 2 has been chemically synthesised and expressed from a lac UV5 and a synthetic trp promoter in Escherichia coli. The synthesis involved preparation of 68 oligodeoxyribonucleotides and their enzymic ligation. The product expressed from the trp promoter system had high antiviral activity and displayed biological effects similar to those of Namalwa interferon on natural killer cell activity and in a Daudi cell growth inhibition assay. E.coli minicells containing plasmid DNA with the synthetic IFN-alpha 2 gene under trp promoter control produce a protein with the same electrophoretic mobility as a sample of authentic IFN-alpha 2. The protein from E.coli cross-reacts with the monoclonal antibody NK-2 and was readily purified, close to homogeneity, by immunoadsorption chromatography on NK-2 sepharose.

Ion-exchange high-performance liquid chromatography of oligodeoxyribonucleotides using formamide.

The superiority of buffer systems containing formamide for the ion-exchange high-performance liquid chromatographic separation of oligodeoxyribonucleotide mixtures generated in solid-phase syntheses is illustrated. The resolutions achieved are compared to those achieved with the same mixtures in other eluting solvents. The use of formamide systems is recommended for oligodeoxyribonucleotide purification in general and is particularly valuable where the oligonucleotide of interest is highly self-complementary and/or rich in deoxyguanosine residues.

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.

Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.