Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 97
Filtrar
1.
Eur J Psychotraumatol ; 11(1): 1725322, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32341762

RESUMEN

Literature suggests that the occurrence of psychological trauma (PT) from various negative life experiences beyond events mentioned in the DSM-criterion A, receives little to no attention when comorbid with psychosis. In fact, despite research indicating the intricate interplay between PT and psychosis, and the need for trauma-focused interventions (TFI), there continue to be mixed views on whether treating PT would worsen psychosis, with many practitioners hesitating to initiate treatment for this reason. This study, therefore, aimed to understand patient perspectives on the role of PT in psychosis and related treatment options. A qualitative exploratory approach was adopted using in-depth interviews with individuals experiencing psychosis. The Global Assessment of Functioning (GAF) scale was administered on a predetermined maximum variation sample resulting in two groups of participants- those with moderate-mild disability (GAF 54-80; n = 10) and those experiencing moderate-severe disability (GAF 41-57; n = 10). With the former group, a semi-structured interview schedule was used, while with the latter, owing to multiple symptoms and difficulty in cognitive processing, a structured interview schedule was used. Results from interpretative phenomenological analysis (IPA) indicated that traumatic loss was central to experienced PT, but received no attention; this often contributed to the psychotic experience and/or depression, through maintenance factors such as cognitive distortions and attenuated affective responses. Further, the experience of loss seems to be more consequential to trauma-related symptoms than the event itself. Participants opined strongly the need for TFI and the role of it in promoting recovery from psychosis.


La literatura sugiere que la ocurrencia de un trauma psicológico (TP) derivado de experiencias negativas de la vida más allá de los eventos mencionados en el criterio A del DSM, recibe poca o ninguna atención cuando se encuentra en comorbilidad con la psicosis. De hecho, a pesar de que la investigación indica la interacción intrincada entre el TP y la psicosis, y la necesidad de Intervenciones con Foco en el Trauma (IFT), continúa habiendo visiones mixtas respecto a si el tratar el TP podría empeorar la psicosis, con muchos profesionales dudando iniciar tratamiento por este motivo. Este estudio por tanto buscó comprender las perspectivas de los pacientes respecto al rol del TP en la psicosis y las opciones de tratamiento relacionadas. Se utilizó un enfoque cualitativo exploratorio usando entrevistas en profundidad con individuos que experimentaban una psicosis. Se administró la Escala Global de Funcionamiento (GAF) a una muestra predeterminada de máxima variación, resultando en 2 grupos de participantes: aquellos con discapacidad leve a moderada (GAF 54­80; n=10) y quienes presentaban discapacidad moderada a severa (GAF 41­57; n=10). Con el primer grupo se utilizó una entrevista semi-estructurada, mientras que con el segundo, debido a sus múltiples síntomas y dificultad en el procesamiento cognitivo, se utilizó un esquema de entrevista estructurada. Los resultados del análisis fenomenológico interpretativo (AFI) indicaron que la pérdida traumática era central al TP experimentado, pero no recibía atención; esto generalmente contribuía a la experiencia psicótica y/o depresión, a través de factores mantenedores como distorsiones cognitivas y respuestas afectivas atenuadas. Más aún, la experiencia de pérdida parece ser más consecuencia de los síntomas relacionados al trauma que del evento en sí mismo. Los participantes opinaron enérgicamente sobre la necesidad de IFT y su rol en la promoción de la recuperación de la psicosis.

2.
Mol Psychiatry ; 23(2): 316-322, 2018 02.
Artículo en Inglés | MEDLINE | ID: mdl-28289280

RESUMEN

Folic acid supplementation confers modest benefit in schizophrenia, but its effectiveness is influenced by common genetic variants in the folate pathway that hinder conversion to its active form. We examined physiological and clinical effects of l-methylfolate, the fully reduced and bioactive form of folate, in schizophrenia. In this randomized, double-blind trial, outpatients with schizophrenia (n=55) received l-methylfolate 15 mg or placebo for 12 weeks. Patients were maintained on stable doses of antipsychotic medications. The pre-defined primary outcome was change in plasma methylfolate at 12 weeks. Secondary outcomes included change in symptoms (Positive and Negative Syndrome Scale (PANSS), Scale for Assessment of Negative Symptoms, Calgary Depression Scale for Schizophrenia), cognition (Measurement and Treatment Research to Improve Cognition in Schizophrenia composite) and three complementary magnetic resonance imaging measures (working memory-related activation, resting connectivity, cortical thickness). Primary, mixed model, intent-to-treat analyses covaried for six genetic variants in the folate pathway previously associated with symptom severity and/or response to folate supplementation. Analyses were repeated without covariates to evaluate dependence on genotype. Compared with placebo, l-methylfolate increased plasma methylfolate levels (d=1.00, P=0.0009) and improved PANSS Total (d=0.61, P=0.03) as well as PANSS Negative and General Psychopathology subscales. Although PANSS Total and General Psychopathology changes were influenced by genotype, significant PANSS Negative changes occurred regardless of genotype. No treatment differences were seen in other symptom rating scales or cognitive composite scores. Patients receiving l-methylfolate exhibited convergent changes in ventromedial prefrontal physiology, including increased task-induced deactivation, altered limbic connectivity and increased cortical thickness. In conclusion, l-methylfolate supplementation was associated with salutary physiological changes and selective symptomatic improvement in this study of schizophrenia patients, warranting larger clinical trials. ClinicalTrials.gov, NCT01091506.


Asunto(s)
Esquizofrenia/tratamiento farmacológico , Tetrahidrofolatos/farmacología , Adulto , Antipsicóticos/uso terapéutico , Cognición/efectos de los fármacos , Método Doble Ciego , Femenino , Ácido Fólico/metabolismo , Ácido Fólico/farmacología , Humanos , Masculino , Persona de Mediana Edad , Escalas de Valoración Psiquiátrica , Tetrahidrofolatos/uso terapéutico , Resultado del Tratamiento
3.
Psychol Med ; 48(7): 1139-1147, 2018 05.
Artículo en Inglés | MEDLINE | ID: mdl-28889814

RESUMEN

BACKGROUND: Distinguishing temporal patterns of depressive symptoms during pregnancy and after childbirth has important clinical implications for diagnosis, treatment, and maternal and child outcomes. The primary aim of the present study was to distinguish patterns of chronically elevated levels of depressive symptoms v. trajectories that are either elevated during pregnancy but then remit after childbirth, v. patterns that increase after childbirth. METHODS: The report uses latent growth mixture modeling in a large, population-based cohort (N = 12 121) to investigate temporal patterns of depressive symptoms. We examined theoretically relevant sociodemographic factors, exposure to adversity, and offspring gender as predictors. RESULTS: Four distinct trajectories emerged, including resilient (74.3%), improving (9.2%), emergent (4.0%), and chronic (11.5%). Lower maternal and paternal education distinguished chronic from resilient depressive trajectories, whereas higher maternal and partner education, and female offspring gender, distinguished the emergent trajectory from the chronic trajectory. Younger maternal age distinguished the improving group from the resilient group. Exposure to medical, interpersonal, financial, and housing adversity predicted membership in the chronic, emergent, and improving trajectories compared with the resilient trajectory. Finally, exposure to medical, interpersonal, and financial adversity was associated with the chronic v. improving group, and inversely related to the emergent class relative to the improving group. CONCLUSIONS: There are distinct temporal patterns of depressive symptoms during pregnancy, after childbirth, and beyond. Most women show stable low levels of depressive symptoms, while emergent and chronic depression patterns are separable with distinct correlates, most notably maternal age, education levels, adversity exposure, and child gender.


Asunto(s)
Depresión Posparto/diagnóstico , Depresión/diagnóstico , Adulto , Diagnóstico Diferencial , Escolaridad , Femenino , Humanos , Modelos Logísticos , Estudios Longitudinales , Masculino , Edad Materna , Embarazo , Escalas de Valoración Psiquiátrica , Resiliencia Psicológica , Índice de Severidad de la Enfermedad , Factores Sexuales , Estrés Psicológico , Factores de Tiempo , Adulto Joven
4.
Eur J Psychotraumatol ; 8(1): 1394146, 2017.
Artículo en Inglés | MEDLINE | ID: mdl-29163865

RESUMEN

Background: Prior research on adaptation after early trauma among black South African women typically assessed resilience in ways that lacked contextual specificity. In addition, the neurocognitive correlates of social and occupational resilience have not been investigated. Objective: The primary aim of this exploratory study was to identify domains of neurocognitive functioning associated with social and occupational resilience, defined as functioning at a level beyond what would be expected given exposure to childhood trauma. Methods: A sample of black South African women, N = 314, completed a neuropsychological battery, a questionnaire assessing exposure to childhood trauma, and self-report measures of functional status. We generated indices of social and occupational resilience by regressing childhood trauma exposure on social and occupational functioning, saving the residuals as indices of social and occupational functioning beyond what would be expected given exposure to childhood trauma. Results: Women with lower non-verbal memory evidenced greater social and occupational resilience above and beyond the effects attributable to age, education, HIV status, and depressive and posttraumatic stress symptoms. In addition, women with greater occupational resilience exhibited lower semantic language fluency and processing speed. Conclusion: Results are somewhat consistent with prior studies implicating memory effects in impairment following trauma, though our findings suggest that reduced abilities in these domains may be associated with greater resilience. Studies that use prospective designs and objective assessment of functional status are needed to determine whether non-verbal memory, semantic fluency, and processing speed are implicated in the neural circuitry of post-traumatic exposure resilience.


Planteamiento: Las investigaciones previas sobre la adaptación después del trauma temprano entre las mujeres negras de Sudáfrica generalmente evaluaban la resiliencia de maneras que carecían de especificidad contextual. Además, no se han investigados los correlatos neurocognitivos de la resiliencia social y ocupacional. Objetivo: El objetivo principal de este estudio exploratorio fue identificar los dominios del funcionamiento neurocognitivo asociados con la resiliencia social y ocupacional, que se define como el funcionamiento en un nivel mayor de lo que se esperaría dada la exposición al trauma infantil. Métodos: Una muestra de mujeres negras sudafricanas, N = 314, completó una batería neuropsicológica, un cuestionario que evaluaba la exposición al trauma infantil y medidas de auto informe de su funcionamiento. Generamos índices de resiliencia social y ocupacional mediante la regresión de la exposición al trauma infantil en el funcionamiento social y laboral, conservando los residuos como índices de funcionamiento social y laboral más allá de lo esperado dada la exposición al trauma infantil. Resultados: Las mujeres con menor memoria no verbal mostraron una mayor resiliencia social y ocupacional por encima y más allá de los efectos atribuibles a la edad, la educación, el estado del VIH y los síntomas de depresión y estrés postraumático. Además, las mujeres con mayor resiliencia ocupacional mostraron menor fluidez del lenguaje semántico y de velocidad de procesamiento. Conclusión: Los resultados son algo consistentes con los estudios previos que implican los efectos de la memoria en el deterioro después del trauma, aunque nuestros hallazgos sugieren que las habilidades reducidas en estos dominios pueden asociarse a una mayor resiliencia. Se necesitan estudios que usen diseños prospectivos y una evaluación objetiva del estado funcional para determinar si la memoria no verbal, la fluidez semántica y la velocidad de procesamiento están implicadas en los circuitos neuronales de la resiliencia a la exposición postraumática.

5.
Acta Psychiatr Scand ; 136(5): 465-472, 2017 11.
Artículo en Inglés | MEDLINE | ID: mdl-28851055

RESUMEN

OBJECTIVE: This study examined the effect of adjunctive telmisartan on psychopathology and cognition in olanzapine- or clozapine-treated patients with schizophrenia. METHOD: In a 12-week randomized, double-blind, placebo-controlled study, patients diagnosed with schizophrenia or schizoaffective disorder received either telmisartan (80 mg once per day) or placebo. Psychopathology was assessed using the Positive and Negative Syndrome Scale (PANSS) and the Scale for Assessment of Negative Symptoms (SANS), and a neuropsychological battery was used to assess cognitive performance. Assessments for psychopathology and cognition were conducted at baseline and week 12. RESULTS: Fifty-four subjects were randomized, and 43 completed the study (22 in the telmisartan group, 21 in the placebo group). After 12-weeks of treatment, the telmisartan group had a significant decrease in PANSS total score compared withthe placebo group (mean ± SD: - 4.1 ± 8.1 vs. 0.4 ± 7.5, P = 0.038, SCohen's d = 0.57). There were no significant differences between the two groups in change from baseline to week 12 in PANSS subscale scores, SANS total score, or any cognitive measures (P > 0.100). CONCLUSION: The present study suggests that adjunctive treatment with telmisartan may improve schizophrenia symptoms. Future trials with larger sample sizes and longer treatment durations are warranted.


Asunto(s)
Bloqueadores del Receptor Tipo 1 de Angiotensina II/farmacología , Antipsicóticos/farmacología , Bencimidazoles/farmacología , Benzoatos/farmacología , Evaluación de Resultado en la Atención de Salud , Trastornos Psicóticos/tratamiento farmacológico , Esquizofrenia/tratamiento farmacológico , Adulto , Bloqueadores del Receptor Tipo 1 de Angiotensina II/administración & dosificación , Antipsicóticos/administración & dosificación , Bencimidazoles/administración & dosificación , Benzoatos/administración & dosificación , Benzodiazepinas/administración & dosificación , Benzodiazepinas/farmacología , Clozapina/administración & dosificación , Clozapina/farmacología , Método Doble Ciego , Quimioterapia Combinada , Femenino , Estudios de Seguimiento , Humanos , Masculino , Persona de Mediana Edad , Olanzapina , Telmisartán
6.
Int J Clin Psychiatry Ment Health ; 3(1): 9-19, 2015 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-27054141

RESUMEN

Our program attempted to improve attitudes and confidence of Peruvian primary care physicians (PCPs) providing mental health care. The training program underwent an evaluation to determine impact of sustained confidence in performing medical and psychiatric procedures, and application of learned skills. Fifty-two Peruvian primary care practitioners were trained at the Harvard Program in Refugee Trauma (HPRT) over a two-week period. There was significant improvement in PCPs' confidence levels of performing psychiatric procedures (counseling, prescribing medications, psychiatric diagnosis, assessing the risk for violence, and treating trauma victims) when comparing baseline and post-two-week to one year follow-up. When comparing post-two-week and one-year follow-up quantitative measures, confidences levels went slightly down. This may be an implication that the frequency of trainings and supervisions are needed more frequently. In contrast, qualitative responses from the one-year follow-up revealed increase in victims of violence clinical care, advocacy, awareness, education, training, policy changes, accessibility of care, and sustainment of diagnostic tools. This study supports the feasibility of training PCP's in a culturally effective manner with sustainability over time.

7.
Plant Dis ; 98(10): 1446, 2014 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-30703955

RESUMEN

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

8.
Artículo en Inglés | MEDLINE | ID: mdl-24173636

RESUMEN

OBJECTIVE: This study analyzes the relationship between informants' age and their assessment of mental health needs in postconflict society and examines if mental health needs assessment priorities differ depending upon whether or not the informant was exposed to the Liberian civil war. METHODS: cross-sectional survey was conducted in March 2009 to obtain data on mental health needs of Liberian children, adolescents and young adults. A total of 171 individuals were interviewed. The data were analyzed using a two- way ANOVA. RESULTS: Elder respondents expressed a preference for young adults to receive services in a church/mosque (F = 4.020, p < .05); for adolescents in volunteer programs (F = 3.987, p < .05) and for children in sports programs (F = 4.396, p < .05). Experiencing conflict did exert some influence on treatment setting preferences. Those who resided outside Liberia during the conflict cited a preference for traditional healers and medical clinics. However, this preference was for the children and young adult age categories. Those who experienced the civil war reported significantly higher preferences for adolescent services to be located in medical clinics, with traditional healers, and in churches/mosques. CONCLUSION: This study provides additional support for the premise that the utilization of psychiatric services needs to be viewed from the perspective of Liberians and that there are differences in preferences across groups. Our results suggest that service providers and policy makers take into account the age of the patient when deciding where to locate treatment settings for the population.

9.
Afr J Psychiatry (Johannesbg) ; 16(5): 349-55, 2013 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-24051668

RESUMEN

OBJECTIVE: The study examined key informants' perceptions of the emotional impact of traumatic events, major problems, functional limitations and appropriate treatment settings for children, adolescents, and young adults in post-conflict Liberia. METHOD: This research is a based on cross-sectional survey conducted between March 30, 2009 and April 30, 2009 in Liberia with 171 local key Liberian informants. Analysis was conducted using mixed methods. The findings we will report were collected in the qualitative portion of the survey. RESULTS: We found that while different interventions were preferred for different types of young people, some interventions were mentioned for all youth and by all age and gender groups of key informants. These included counseling, education, and skills training. Also frequently chosen were housing, community reintegration, recreation, and medical care. In general, key informants reported similar concerns regardless of their ages or genders. Notable exceptions to this were in interventions for youth who joined fighting forces. Men over 50 were the only ones to recommend apology and reparations. Similarly, in recommendations for criminals and violent youth, a number of men mentioned prison, whereas the women did not. CONCLUSION: Our findings suggest that the needs of post-conflict Liberian youth span a variety of domains, including physical, emotional, medical, psychological, and educational. These findings can be used to guide the development of treatment programs for these young people.


Asunto(s)
Anomia (Social) , Servicios de Salud Mental/organización & administración , Ajuste Social , Trastornos de Estrés Traumático , Adolescente , Adulto , Femenino , Humanos , Liberia , Masculino , Persona de Mediana Edad , Evaluación de Necesidades , Investigación Cualitativa , Control Social Formal/métodos , Apoyo Social , Trastornos de Estrés Traumático/etiología , Trastornos de Estrés Traumático/psicología , Trastornos de Estrés Traumático/rehabilitación , Poblaciones Vulnerables/psicología , Guerra
10.
Acta Psychiatr Scand ; 127(3): 217-26, 2013 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-22943577

RESUMEN

OBJECTIVE: This study examined the effects of adjunctive aripiprazole therapy on metabolism in clozapine-treated patients with schizophrenia. METHOD: In an 8-week randomized, double-blind, placebo-controlled study, subjects received either aripiprazole (15 mg/day) or placebo. At baseline and week 8, metabolic parameters were assessed by the frequently sampled intravenous glucose tolerance test, nuclear magnetic resonance spectroscopy and whole-body dual-energy X-ray absorptiometry (DXA). RESULTS: Thirty subjects completed the study (16 in the aripiprazole group and 14 in the placebo group). Glucose effectiveness measured by the frequently sampled intravenous glucose tolerance test improved significantly in the aripiprazole group (0.003 ± 0.006 vs. -0.005 ± 0.007/min, P = 0.010). The aripiprazole group showed significant reductions in both plasma low-density lipoprotein (LDL) levels (-15.1 ± 19.8 vs. 4.4 ± 22.5 mg/dl, P = 0.019) and LDL particle numbers (-376 ± 632 vs. -36 ± 301 nm, P = 0.035). Further, there was a significant reduction in the lean mass (-1125 ± 1620 vs. 607 ± 1578 g, P = 0.011) measured by whole-body DXA scan in the aripiprazole group. All values were expressed as mean ± standard deviation, aripiprazole vs. placebo. CONCLUSION: Adjunctive therapy with aripiprazole may have some metabolic benefits in clozapine-treated patients with schizophrenia.


Asunto(s)
Antipsicóticos/metabolismo , Clozapina/metabolismo , Piperazinas/metabolismo , Quinolonas/metabolismo , Esquizofrenia/metabolismo , Absorciometría de Fotón/métodos , Adulto , Antipsicóticos/uso terapéutico , Aripiprazol , Composición Corporal/efectos de los fármacos , Clozapina/uso terapéutico , Método Doble Ciego , Quimioterapia Combinada/métodos , Femenino , Estudios de Seguimiento , Glucosa/metabolismo , Prueba de Tolerancia a la Glucosa/métodos , Humanos , Lipoproteínas LDL/sangre , Espectroscopía de Resonancia Magnética/métodos , Masculino , Piperazinas/uso terapéutico , Quinolonas/uso terapéutico , Esquizofrenia/tratamiento farmacológico
11.
Eye (Lond) ; 26(10): 1357-62, 2012 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-22899005

RESUMEN

AIMS AND PURPOSE: The aim of this study was to describe the prevalence and characteristics of drusen and pigmentary changes in a middle-aged population. METHODS: Retinal images from 500 individuals aged 18-54 years were included. The source of participants was two UK optometry practices. Retinal images were graded using the Wisconsin Age-Related Maculopathy Grading System. However, owing to the relatively young age of the population studied, a new category of drusen of smaller size (<31.5 µm) was introduced. RESULTS: Drusen were identified within the central macular grid in 91.48% of all gradable eyes and in 444 subjects. Drusen sized <31.5 µm were present in 89.7% of eyes, drusen sized >31.5 µm and <63 µm were present in 45.9% of all eyes and drusen >63 µm and <125 µm were present in only 1.7% of eyes. No eye had drusen larger or equal to 125 µm. Very few eyes (1.2%) showed pigmentary changes within the grid. Drusen load increased with increasing age, P <0.001. CONCLUSIONS: The frequency of drusen in a younger Caucasian population aged 18-54 years is high, with 91.48% of all gradable eyes having drusen. The most frequent drusen subtype was hard distinct drusen <31.5 µm. No druse greater or equal in size to 125 µm was seen. Pigmentary changes are rare.


Asunto(s)
Drusas Retinianas/etnología , Epitelio Pigmentado de la Retina/patología , Población Blanca/etnología , Adolescente , Adulto , Femenino , Humanos , Degeneración Macular/diagnóstico , Degeneración Macular/etnología , Masculino , Persona de Mediana Edad , Fotograbar , Prevalencia , Drusas Retinianas/diagnóstico , Reino Unido/epidemiología , Adulto Joven
12.
J Biotechnol ; 154(1): 68-75, 2011 Jun 10.
Artículo en Inglés | MEDLINE | ID: mdl-21504771

RESUMEN

The quantitative nuclease protection assay (qNPA) is a very simple and highly sensitive method for measuring mRNA transcripts, can be used on a variety of sample types, and is amenable to high-throughput sample processing. We have combined the power of the qNPA assay with the density of a DNA microarray to create a qNPA Microarray platform. This platform is compatible with common laboratory equipment: it uses fluorescence-based detection, can be analyzed with common microarray scanners, and is in an SBS footprint with 96-well layout for high-throughput applications. Here, we demonstrate the characteristics of a qNPA Microarray slide that contains up to 1700 gene elements per well. We show that the new platform can reliably detect transcripts at levels as low as 10fM with median CVs below 12%. On a standardized set of samples, the qNPA Microarray detected the same trends in gene expression as the original qNPA technology, real time qPCR, and Affymetrix GeneChip DNA Microarrays. Given its ease of use, compatibility with multiple sample types, high-throughput capabilities, and its integration with standard laboratory equipment, the qNPA Microarray is a powerful new platform for gene expression research.


Asunto(s)
Perfilación de la Expresión Génica , Ensayos Analíticos de Alto Rendimiento/métodos , Ensayos de Protección de Nucleasas/métodos , Análisis de Secuencia por Matrices de Oligonucleótidos/métodos , Línea Celular , Sondas de ADN/metabolismo , Bases de Datos Genéticas , Regulación de la Expresión Génica , Humanos , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Análisis de Secuencia de ADN
13.
Acta Psychiatr Scand ; 119(6): 457-65, 2009 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-19183127

RESUMEN

OBJECTIVE: The primary purpose of this 8-week double-blind, placebo-controlled trial of rosiglitazone 4 mg/day was to examine its effect on insulin sensitivity index (SI) and glucose utilization (SG) in clozapine-treated subjects with schizophrenia with insulin resistance. METHOD: Eighteen subjects were randomized and accessed with a Frequently Sampled Intravenous Glucose Tolerance Test (FSIVGTT) at baseline and at week 8 to estimate SG and SI. RESULTS: Controlling for the baseline, comparing the rosiglitazone group with placebo group, there was a non-significant improvement in SG (0.016 +/- 0.006-0.018 +/- 0.008, effect size = 0.23, P = 0.05) with a trend of improvement in SI in the rosiglitazone group (4.6 +/- 2.8-7.8 +/- 6.7, effect size = 0.18, P = 0.08). There was a significant reduction in small low-density lipoprotein cholesterol (LDL-C) particle number (987 +/- 443-694 +/- 415, effect size = 0.30, P = 0.04). CONCLUSION: Rosiglitazone may have a role in addressing insulin resistance and lipid abnormalities associated with clozapine.


Asunto(s)
Clozapina/efectos adversos , Hipoglucemiantes/uso terapéutico , Síndrome Metabólico/inducido químicamente , Esquizofrenia/tratamiento farmacológico , Tiazolidinedionas/uso terapéutico , Adolescente , Adulto , Anciano , Glucemia/metabolismo , LDL-Colesterol/metabolismo , Clozapina/uso terapéutico , Método Doble Ciego , Femenino , Prueba de Tolerancia a la Glucosa , Humanos , Resistencia a la Insulina , Masculino , Síndrome Metabólico/tratamiento farmacológico , Persona de Mediana Edad , Placebos , Rosiglitazona , Esquizofrenia/metabolismo
14.
HIV Med ; 9(2): 118-25, 2008 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-18257774

RESUMEN

OBJECTIVE: The aim of the study was to determine whether the expression of CD38 on CD8 T cells can identify patients with virological failure on antiretroviral therapy (ART). DESIGN: This was a cross-sectional study of patients attending a single HIV clinic in London. METHODS: The expression of CD38 on CD8 T cells was assessed using a biologically calibrated flow cytometry protocol. Patients were characterized by lymphocyte subset and viral load measurements. Characteristics including historical CD4 T cell counts, therapeutic history, co-infections and demographics were obtained from medical records. RESULTS: Elevated levels of CD8 CD38(high) T cells were found in HIV-1-infected patients who failed to suppress viral replication with ART; however, this parameter lacked sufficient sensitivity and specificity to replace viral load testing in assessing the efficacy of ART. Increased levels of CD8 CD38(high) cells were associated with reduced CD4 T cell counts in HIV-1-infected patients on ART after correcting for known determinants of CD4 T-cell recovery. CONCLUSIONS: The expression of CD38 on CD8 T cells lacks sufficient sensitivity and specificity to be used as a surrogate marker for viral load to monitor HIV-1 infection. T-cell activation is associated with reduced CD4 T-cell reconstitution in patients receiving ART.


Asunto(s)
ADP-Ribosil Ciclasa 1/metabolismo , Terapia Antirretroviral Altamente Activa , Linfocitos T CD4-Positivos/inmunología , Linfocitos T CD8-positivos/inmunología , Infecciones por VIH/inmunología , VIH-1 , Adulto , Estudios Transversales , Femenino , Infecciones por VIH/tratamiento farmacológico , Infecciones por VIH/virología , Humanos , Londres , Masculino , Insuficiencia del Tratamiento , Replicación Viral/efectos de los fármacos , Replicación Viral/inmunología
15.
Clin Exp Immunol ; 150(2): 238-44, 2007 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-17672869

RESUMEN

There are limited data on the efficacy of T cell-based assays to detect tuberculosis (TB) antigen-specific responses in immune-deficient human immunodeficiency virus (HIV) patients. The aim of this study is to determine whether TB antigen-specific immune responses can be detected in patients with HIV-1 infection, especially in those with advanced disease (CD4 T cell count < 300 cells/microl). An enzyme-linked immunospot (ELISPOT) assay, which detects interferon (IFN)-gamma secreted by T cells exposed to TB antigens, was used to assess specific immune responses in a prospective study of 201 HIV-1-infected patients with risk factors for TB infection, attending a single HIV unit. The performance of the ELISPOT assay to detect TB antigen-specific immune responses is independent of CD4 T cell counts in HIV-1 patients. The sensitivity and specificity of this assay for the diagnosis of active tuberculosis does not differ significantly from values obtained in immunocompetent subjects. The negative predictive value of the TB ELISPOT test is 98.2%. A positive predictive value of 86% for the diagnosis of active tuberculosis was found when the combined number of early secretory antigen target-6 (ESAT-6) and culture filtrate protein-10 (CFP-10) IFN-gamma spots to CD4 T cell count ratio was > 1.5. TB antigen-specific immune responses can be detected in HIV patients with low CD4 T cell counts using ELISPOT technology in a routine diagnostic laboratory and is a useful test to exclude TB infection in immune-deficient HIV-1 patients. A combination of TB antigen-specific IFN-gamma responses and CD4 T cell counts has the potential to distinguish active tuberculosis from latent infection.


Asunto(s)
Infecciones Oportunistas Relacionadas con el SIDA/inmunología , Antígenos Bacterianos/inmunología , VIH-1 , Mycobacterium tuberculosis/inmunología , Tuberculosis/inmunología , Infecciones Oportunistas Relacionadas con el SIDA/diagnóstico , Adulto , Recuento de Linfocito CD4 , Ensayo de Inmunoadsorción Enzimática/métodos , Femenino , Humanos , Inmunidad Celular , Interferón gamma/biosíntesis , Masculino , Persona de Mediana Edad , Valor Predictivo de las Pruebas , Tuberculosis/diagnóstico
16.
J Neuroimmunol ; 187(1-2): 156-8, 2007 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-17499366

RESUMEN

Natalizumab (Tysabri) (anti-VLA4) is a novel agent for treatment of relapsing multiple sclerosis (MS) [Polman C.H., O'Connor P.W., Havrdova E. et al., 2006. A randomized, placebo-controlled trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 354, 899-910.]. Controlled trials have shown considerable efficacy in preventing relapses, in excess of that seen for other EMEA-approved disease modulating drugs. While well-tolerated and generally safe, three cases of progressive multifocal leukoencephalopathy (PML) occurred in the context of 3 clinical trials encompassing some 3300 patients using this drug in multiple sclerosis and Crohn's disease. Immune compromised patients, such as those receiving immunosuppressive medications, are at a higher risk of developing PML. Natalizumab was recently approved for the treatment of relapsing forms of MS. This includes patients who had an inadequate response to other therapies and some of these patients will have already received immunosuppressants. These agents have the potential to cause prolonged effects on the immune system, even after dosing has been discontinued. Determining that these patients are not immunocompromised will be an important safety issue to consider prior to the initiation of natalizumab therapy. This short report summarizes interdisciplinary practical recommendations from specialists in neuroimmunology, rheumatology, transplantation medicine and clinical immunology.


Asunto(s)
Anticuerpos Monoclonales/uso terapéutico , Factores Inmunológicos/uso terapéutico , Esclerosis Múltiple/terapia , Guías de Práctica Clínica como Asunto , Anticuerpos Monoclonales Humanizados , Humanos , Natalizumab
17.
Acta Psychiatr Scand ; 115(2): 101-5, 2007 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-17244173

RESUMEN

UNLABELLED: This study sought to examine the effectiveness of sibutramine, a weight loss agent, on clozapine-associated weight gain. METHOD: This was a 12-week double-blind, placebo controlled, randomized trial of sibutramine for weight loss in obese clozapine-treated schizophrenia or schizoaffective disorder subjects. RESULTS: Ten patients were enrolled into the placebo group and 11 patients into the sibutramine group. There were no significant baseline differences between the two groups on age, gender, education, ethnicity, diagnosis, weight, body mass index (BMI), and blood pressure. At week 12, there were no significant differences in changes in weight, BMI, abdominal and waist circumferences, Hba1c, fasting glucose, or cholesterol levels. CONCLUSION: Sibutramine treatment did not show significant weight loss compared with placebo in clozapine-treated patients with schizophrenia or schizoaffective disorder. Further research with a larger sample size and longer follow-up duration is warranted.


Asunto(s)
Antipsicóticos/efectos adversos , Depresores del Apetito/farmacología , Depresores del Apetito/uso terapéutico , Clozapina/efectos adversos , Ciclobutanos/farmacología , Ciclobutanos/uso terapéutico , Obesidad/inducido químicamente , Obesidad/tratamiento farmacológico , Esquizofrenia/tratamiento farmacológico , Aumento de Peso/efectos de los fármacos , Adulto , Antropometría , Antipsicóticos/uso terapéutico , Glucemia/metabolismo , Índice de Masa Corporal , Peso Corporal/efectos de los fármacos , Colesterol/sangre , Clozapina/uso terapéutico , Método Doble Ciego , Ayuno , Femenino , Hemoglobina Glucada , Hemoglobinas/metabolismo , Humanos , Masculino , Obesidad/metabolismo , Trastornos Psicóticos/tratamiento farmacológico
18.
Eur Respir J ; 27(6): 1307-10, 2006 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-16772392

RESUMEN

Infection by Aspergillus species causes a wide spectrum of pulmonary disease in humans. In two patients with semi-invasive Aspergillus-induced lung disease, significantly reduced levels of interferon-gamma secretion by peripheral blood mononuclear cells were found after in vitro stimulation with the T-cell mitogen phytohaemagglutinin. Despite anti-fungal therapy, both patients exhibited progressive disease, and adjunctive interferon-gamma therapy was associated with significant clinical improvement. The data suggest that impaired production of interferon-gamma can be seen in patients with chronic pulmonary aspergillosis. Adjunctive cytokine therapy with interferon-gamma may be useful in patients with progressive disease despite adequate anti-fungal therapy.


Asunto(s)
Aspergilosis/tratamiento farmacológico , Interferón gamma/uso terapéutico , Enfermedades Pulmonares Fúngicas/tratamiento farmacológico , Adulto , Antifúngicos/uso terapéutico , Aspergilosis/inmunología , Aspergillus fumigatus/efectos de los fármacos , Líquido del Lavado Bronquioalveolar/microbiología , Enfermedad Crónica , Progresión de la Enfermedad , Relación Dosis-Respuesta a Droga , Esquema de Medicación , Quimioterapia Combinada , Femenino , Humanos , Inyecciones Subcutáneas , Interferón gamma/sangre , Enfermedades Pulmonares Fúngicas/inmunología , Persona de Mediana Edad
19.
Acta Psychiatr Scand ; 113(2): 121-5, 2006 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-16423163

RESUMEN

OBJECTIVE: We studied a sample of schizophrenia out-patients to test the hypotheses that serum homocysteine concentrations would correlate positively with measures of glucose metabolism. METHOD: Subjects underwent a nutritional assessment and fasting plasma, serum insulin and homocysteine tests. RESULTS: Males had a significantly higher homocysteine levels than females (7.69 +/- 1.42 microM vs. 6.63 +/- 1.40 microM; P = 0.02). Comparing subjects with normal fasting glucose (NFG) (glucose < 100 mg/dl) and impaired fasting glucose (IFG) (> or = 100 mg/dl) subjects with IFG (mean 8.2 +/- 1.5 microM) had significantly higher homocysteine levels than those with NFG (mean 7.2 +/- 1.4 microM, P = 0.03). IFG was also associated with greater mean values for a Homeostatic Model Assessment-Insulin Resistance (HOMA-IR) (P = 0.002) and diastolic blood pressure (P = 0.045). CONCLUSION: The group with IFG had higher fasting serum homocysteine concentrations than those with NFG which supports a connection to an important cardiovascular risk factor.


Asunto(s)
Glucemia/metabolismo , Homocisteína/sangre , Trastornos Psicóticos/sangre , Esquizofrenia/sangre , Adulto , Antipsicóticos/uso terapéutico , Benzodiazepinas/uso terapéutico , Presión Sanguínea/fisiología , Enfermedad Crónica , Clozapina/uso terapéutico , Centros Comunitarios de Salud Mental , Femenino , Ácido Fólico/sangre , Homeostasis/fisiología , Humanos , Insulina/sangre , Resistencia a la Insulina/fisiología , Masculino , Persona de Mediana Edad , Evaluación Nutricional , Olanzapina , Estado Prediabético/sangre , Estado Prediabético/diagnóstico , Trastornos Psicóticos/tratamiento farmacológico , Valores de Referencia , Factores de Riesgo , Risperidona/uso terapéutico , Esquizofrenia/tratamiento farmacológico , Factores Sexuales , Estadística como Asunto , Relación Cintura-Cadera
20.
Acta Psychiatr Scand ; 113(2): 142-7, 2006 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-16423166

RESUMEN

OBJECTIVE: We conducted this 6-week open-label trial to examine the effects of adjunctive aripiprazole in clozapine-treated subjects on weight, lipid and glucose metabolism, as well as positive and negative symptoms of schizophrenia. METHOD: Ten clozapine-treated subjects received aripiprazole augmentation; eight completed the 6-week trial and two ended at week 4. Eighty percent were male, the mean age was 38.7 +/- 8.9 years and the mean clozapine dose was 455 +/- 83 mg daily. RESULTS: There was a significant decrease in weight (P = 0.003), body mass index (P = 0.004), fasting total serum cholesterol (P = 0.002) and total triglycerides (P = 0.04) comparing baseline to study endpoint. There was no significant change in total Positive and Negative Syndrome Scale scores. CONCLUSION: This combination may be useful for clozapine-associated medical morbidity and must be studied in placebo-controlled double-blind randomized trials to determine efficacy and safety.


Asunto(s)
Antipsicóticos/administración & dosificación , Clozapina/administración & dosificación , Piperazinas/administración & dosificación , Trastornos Psicóticos/tratamiento farmacológico , Quinolonas/administración & dosificación , Esquizofrenia/tratamiento farmacológico , Adulto , Atención Ambulatoria , Antipsicóticos/efectos adversos , Aripiprazol , Glucemia/metabolismo , Índice de Masa Corporal , Peso Corporal/efectos de los fármacos , Colesterol/sangre , Clozapina/efectos adversos , Centros Comunitarios de Salud Mental , Quimioterapia Combinada , Femenino , Estudios de Seguimiento , Humanos , Masculino , Persona de Mediana Edad , Piperazinas/efectos adversos , Escalas de Valoración Psiquiátrica , Trastornos Psicóticos/diagnóstico , Quinolonas/efectos adversos , Esquizofrenia/diagnóstico , Triglicéridos/sangre
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA