Reducing Peptidoglycan Crosslinking by Chemical Modulator Reverts ß-lactam Resistance in Methicillin-Resistant Staphylococcus aureus.

Small molecule can be utilized to restore the effectiveness of existing major classes of antibiotics against antibiotic-resistant bacteria. In this study, it is demonstrated that celastrol, a natural compound, can modify the bacterial cell wall and subsequently render bacteria more suceptible to ß-lactam antibiotics. It is shown that celastrol leads to incomplete cell wall crosslinking by modulating levels of c-di-AMP, a secondary messenger, in methicillin-resistant Staphylococcus aureus (MRSA). This mechanism enables celastrol to act as a potentiator, effectively rendering MRSA susceptible to a range of penicillins and cephalosporins. Restoration of in vivo susceptibility of MRSA to methicillin is also demonstrated using a sepsis animal model by co-administering methicillin along with celastrol at a much lower amount than that of methicillin. The results suggest a novel approach for developing potentiators for major classes of antibiotics by exploring molecules that re-program metabolic pathways to reverse ß-lactam-resistant strains to susceptible strains.

Intracellular Dynamics-Resolved Label-Free Scattering Reveals Real-Time Metabolism of Single Bacteria.

Nanoscopic investigation of bacterial cells is essential to reveal their physiological status, impacting all cellular functions. Currently, this requires labeled probes or targeted staining procedures. Herein, we report a new bacterial feature, intracellular dynamics-resolved Rayleigh scattering (IDRS), that visualizes spatiotemporal cytoplasmic transitions in unlabeled bacteria and characterizes their real-time physiological status in 10 s. From single-bacterium IDRS signals, we discovered unique spatial patterns and their multiple transitions in Gram-negative and Gram-positive bacteria. The magnitude of IDRS signal variation highly correlated with the metabolic status of bacteria, differentiating persistent subpopulations. This is also the first report demonstrating distinct real-time metabolic conditions of unlabeled drug-resistant bacteria that are exposed to different doses of antibiotics. Our strategy opens up a way to simultaneously trace in situ metabolic and antibiotic resistance statuses, which can be applied in single-cell level control of bacterial metabolism and efficacy with a heterogeneous nature.

Protocol for in vitro fluorescence assay of papain-like protease and cell-based immunofluorescence assay of coronavirus infection.

Here, we describe detailed steps to constitute an in vitro assay for monitoring papain-like protease of coronavirus and a cell-based immunofluorescence infection assay. These assays can be adapted for high-throughput screening to determine the efficacy of novel protease inhibitors of coronaviruses and other viruses. In addition, cell-based immunofluorescence infection assay can be used to visually analyze antiviral efficacy of any novel compounds. For complete details on the use and execution of this protocol, please refer to Jeong et al. (2022).1.

Chemical screen uncovers novel structural classes of inhibitors of the papain-like protease of coronaviruses.

The papain-like protease (PLpro) of coronaviruses is an attractive antiviral target to inhibit both viral replication and interference of the host immune response. We have identified and characterized three novel classes of small molecules, thiophene, cyanofuran, and triazoloquinazoline, as PLpro inhibitors. Thiophene inhibited the PLpro of two major coronaviruses, Middle East respiratory syndrome coronavirus (MERS-CoV) and severe acute respiratory syndrome coronavirus (SARS-CoV) including SARS-CoV-2, while cyanofuran and triazoloquinazoline more selectively inhibited MERS-CoV PLpro. Unlike GRL0617, a known PLpro inhibitor, all three compounds contain no naphthyl group but like GRL0617 were predicted to fit on the cleft near the BL2 loop. Docking studies further revealed that the location and direction of the binding determined their specificity to different coronaviruses. Together, our work demonstrates that the BL2 loop and nearby regions are outstanding druggable targets, and our three inhibitors can be applicable to the development of therapeutics for coronavirus infection.

Incidence and Molecular Identification of Begomoviruses Infecting Tomato and Pepper in Myanmar.

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

High-Throughput Phenotyping Methods for Breeding Drought-Tolerant Crops.

Drought is a main factor limiting crop yields. Modern agricultural technologies such as irrigation systems, ground mulching, and rainwater storage can prevent drought, but these are only temporary solutions. Understanding the physiological, biochemical, and molecular reactions of plants to drought stress is therefore urgent. The recent rapid development of genomics tools has led to an increasing interest in phenomics, i.e., the study of phenotypic plant traits. Among phenomic strategies, high-throughput phenotyping (HTP) is attracting increasing attention as a way to address the bottlenecks of genomic and phenomic studies. HTP provides researchers a non-destructive and non-invasive method yet accurate in analyzing large-scale phenotypic data. This review describes plant responses to drought stress and introduces HTP methods that can detect changes in plant phenotypes in response to drought.

First report of Colombian datura virus in Brugmansia suaveolens in Korea.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Raloxifene as a treatment option for viral infections.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused corona virus disease 2019 (COVID-19) pandemic and led to mass casualty. Even though much effort has been put into development of vaccine and treatment methods to combat COVID-19, no safe and efficient cure has been discovered. Drug repurposing or drug repositioning which is a process of investigating pre-existing drug candidates for novel applications outside their original medical indication can speed up the drug development process. Raloxifene is a selective estrogen receptor modulator (SERM) that has been approved by FDA in 1997 for treatment and prevention of postmenopausal osteoporosis and cancer. Recently, raloxifene demonstrates efficacy in treating viral infections by Ebola, influenza A, and hepatitis C viruses and shows potential for drug repurposing for the treatment of SARS-CoV-2 infection. This review will provide an overview of raloxifene's mechanism of action as a SERM and present proposed mechanisms of action in treatment of viral infections.