Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 96
Filtrar
1.
Chem Sci ; 15(24): 9096-9103, 2024 Jun 19.
Artículo en Inglés | MEDLINE | ID: mdl-38903237

RESUMEN

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.

2.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 03 22.
Artículo en Inglés | MEDLINE | ID: mdl-38271265

RESUMEN

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Asunto(s)
Complejos de Coordinación , Compuestos Organometálicos , Rutenio , Compuestos Organometálicos/química , ADN/química , Oligonucleótidos/química , Complejos de Coordinación/química , Temperatura , Rutenio/química
3.
Inorg Chem ; 63(5): 2460-2469, 2024 Feb 05.
Artículo en Inglés | MEDLINE | ID: mdl-38262043

RESUMEN

Ruthenium(II) complexes [Ru(tap)2(NN)]2+ (tap = 1,4,5,8-tetraazaphenanthrene, NN = 11-cyano-dipyrido[3,2-a:2',3'-c]phenazine (11-CN-dppz) and 11,12-dicyano-dipyrido[3,2-a:2',3'-c]phenazine (11,12-CN-dppz)) feature the C≡N groups as infrared (IR)-active redox markers. They were studied by cyclic voltammetry, UV-vis, and IR spectroelectrochemistry (SEC), and density functional theory calculations to assign the four 1e- reduction waves R1-R4 observed in dichloromethane. Generally, the NN ligands are reduced first (R1). For [Ru(tap)2(11,12-CN-dppz)]2+, R1 is sufficiently separated from R2 and delocalized over both tap ligands. Accordingly, IR SEC conducted at R1 shows a large red shift of the νs,as(C≡N) modes by -18/-28 cm-1, accompanied by a 4-fold enhancement of the νs(C≡N) intensity, comparably with reference data for free 11,12-CN-dppz. The first tap-based reduction of spin-doublet [Ru(tap)2(11,12-CN-dppz)]+ to spin-triplet [Ru(tap)2(11,12-CN-dppz)] at R2 decreased ν(C≡N) by merely -2 cm-1, while the intensity enhancement reached an overall factor of 8. Comparably, a red shift of ν(C≡N) by -27 cm-1 resulted from the 1e- reduction of [Ru(tap)2(11-CN-dppz)]2+ at R1 (poorly resolved from R2), and the intensity enhancement was roughly 3-fold. Concomitant 1e- reductions of the tap ligands (R2 and R3) caused only minor ν(C≡N) shifts of -3 cm-1 and increased the absorbance by overall factors of 6.5 and 8, respectively.

4.
Nucleic Acids Res ; 50(22): 12636-12656, 2022 12 09.
Artículo en Inglés | MEDLINE | ID: mdl-36382400

RESUMEN

The four natural DNA bases (A, T, G and C) associate in base pairs (A=T and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases.


Asunto(s)
ADN Forma B , Ligandos , Emparejamiento Base , ADN/genética , ADN/química , Conformación de Ácido Nucleico , Terapia Molecular Dirigida
5.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Artículo en Inglés | MEDLINE | ID: mdl-35324198

RESUMEN

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Asunto(s)
G-Cuádruplex , Rutenio , Dicroismo Circular , ADN/química , Humanos , Rutenio/química , Telómero/metabolismo
6.
J Nephrol ; 31(1): 61-70, 2018 02.
Artículo en Inglés | MEDLINE | ID: mdl-28573387

RESUMEN

BACKGROUND: Sleep disorders are common and multi-factorial in patients with advanced chronic kidney disease and end-stage renal disease (ESRD). Sleep disorders and disturbance have a negative impact on wellbeing and quality of life. OBJECTIVE: To assess the impact of a change in renal replacement therapy (RRT) modality on sleep quality and sleep disturbance in patients with ESRD. DATA SOURCES: Multiple electronic databases were searched without publication type/period restrictions. The reference lists of all included articles were manually searched for additional citations. Non-published data was identified by hand searching key conference abstracts. STUDY ELIGIBILITY CRITERIA: Participants of interest were adult patients with ESRD requiring RRT [conventional haemodialysis (HD), short daily HD, nocturnal HD, continuous ambulatory peritoneal dialysis (CAPD), continuous cycler-assisted peritoneal dialysis (CCPD) or transplantation]. The exposure or intervention of interest was switch of RRT modality. STUDY APPRAISAL: Two reviewers independently assessed all studies for inclusion and extracted relevant data. RESULTS: Sixteen studies with a combined total of 670 patients and 191 controls were included for review and described in detail. Looking specifically at restless leg syndrome, symptoms resolved in over 60% of affected patients with a switch to increased intensity RRT (either intensive HD, CCPD or transplant). Meta-analysis of the nine studies that looked specifically at sleep apnoea parameters again favoured intensive RRT over standard/conventional RRT (conventional HD or CAPD) with statistical significance [Risk ratio 0.66 (95% CI 0.51-0.84)]. Meta-analysis of all studies favoured a switch to increased intensity RRT in terms of overall sleep quality, with statistical significance [Risk ratio 0.58 (95% CI 0.40-8.83)]. LIMITATIONS: Restriction to the English language may have introduced selection bias. Funnel plot analysis suggested there was also an element of publication bias. Studies were heterogeneous in terms of patient selection, means of sleep quality assessment and modality switch. CONCLUSIONS AND IMPLICATIONS OF KEY FINDINGS: Sleep disturbance, sleep apnoea and restless legs syndrome all tend to improve when a switch is made to intensive dialysis or transplant. This is important information for patients struggling with disturbed sleep and marked fatigue. This hypothesis-generating review highlights the need for more high quality prospective research in the area.


Asunto(s)
Fallo Renal Crónico/terapia , Trasplante de Riñón , Diálisis Peritoneal Ambulatoria Continua , Diálisis Renal , Trastornos del Sueño-Vigilia/fisiopatología , Sueño , Adulto , Femenino , Estado de Salud , Humanos , Fallo Renal Crónico/diagnóstico , Fallo Renal Crónico/epidemiología , Fallo Renal Crónico/fisiopatología , Trasplante de Riñón/efectos adversos , Masculino , Persona de Mediana Edad , Diálisis Peritoneal Ambulatoria Continua/efectos adversos , Calidad de Vida , Diálisis Renal/efectos adversos , Factores de Riesgo , Trastornos del Sueño-Vigilia/diagnóstico , Trastornos del Sueño-Vigilia/epidemiología , Resultado del Tratamiento
7.
Ecol Appl ; 27(4): 1351-1364, 2017 06.
Artículo en Inglés | MEDLINE | ID: mdl-28263423

RESUMEN

Human use of water resources threatens environmental water supplies. If resource managers are to develop policies that avoid unacceptable ecological impacts, some means to predict ecosystem response to changes in water availability is necessary. This is difficult to achieve at spatial scales relevant for water resource management because of the high natural variability in ecosystem hydrology and ecology. Water plant functional groups classify species with similar hydrological niche preferences together, allowing a qualitative means to generalize community responses to changes in hydrology. We tested the potential for functional groups in making quantitative prediction of water plant functional group distributions across diverse wetland types over a large geographical extent. We sampled wetlands covering a broad range of hydrogeomorphic and salinity conditions in South Australia, collecting both hydrological and floristic data from 687 quadrats across 28 wetland hydrological gradients. We built hydrological-niche models for eight water plant functional groups using a range of candidate models combining different surface inundation metrics. We then tested the predictive performance of top-ranked individual and averaged models for each functional group. Cross validation showed that models achieved acceptable predictive performance, with correct classification rates in the range 0.68-0.95. Model predictions can be made at any spatial scale that hydrological data are available and could be implemented in a geographical information system. We show the response of water plant functional groups to inundation is consistent enough across diverse wetland types to quantify the probability of hydrological impacts over regional spatial scales.


Asunto(s)
Conservación de los Recursos Naturales/métodos , Hidrología/métodos , Fenómenos Fisiológicos de las Plantas , Humedales , Ecosistema , Modelos Biológicos , Australia del Sur
8.
Adv Mar Biol ; 74: 1-68, 2016.
Artículo en Inglés | MEDLINE | ID: mdl-27573049

RESUMEN

Climate influences marine ecosystems on a range of time scales, from weather-scale (days) through to climate-scale (hundreds of years). Understanding of interannual to decadal climate variability and impacts on marine industries has received less attention. Predictability up to 10 years ahead may come from large-scale climate modes in the ocean that can persist over these time scales. In Australia the key drivers of climate variability affecting the marine environment are the Southern Annular Mode, the Indian Ocean Dipole, the El Niño/Southern Oscillation, and the Interdecadal Pacific Oscillation, each has phases that are associated with different ocean circulation patterns and regional environmental variables. The roles of these drivers are illustrated with three case studies of extreme events-a marine heatwave in Western Australia, a coral bleaching of the Great Barrier Reef, and flooding in Queensland. Statistical and dynamical approaches are described to generate forecasts of climate drivers that can subsequently be translated to useful information for marine end users making decisions at these time scales. Considerable investment is still needed to support decadal forecasting including improvement of ocean-atmosphere models, enhancement of observing systems on all scales to support initiation of forecasting models, collection of important biological data, and integration of forecasts into decision support tools. Collaboration between forecast developers and marine resource sectors-fisheries, aquaculture, tourism, biodiversity management, infrastructure-is needed to support forecast-based tactical and strategic decisions that reduce environmental risk over annual to decadal time scales.


Asunto(s)
Cambio Climático , Clima , Predicción , Océanos y Mares , Australia , Arrecifes de Coral , Técnicas de Apoyo para la Decisión , El Niño Oscilación del Sur , Explotaciones Pesqueras/tendencias , Inundaciones , Calor , Océano Índico , Modelos Biológicos , Océano Pacífico , Estaciones del Año
9.
Br J Oral Maxillofac Surg ; 54(8): 847-850, 2016 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-27389373

RESUMEN

Leadership is uncommonly taught formally at any level in surgical training, and is not often evaluated formally either within assessment programmes or during appraisal. Good leadership skills in oral and maxillofacial surgery (OMFS) include professionalism, technical competence, motivation, innovation, ability to communicate, resilience, and effective teaching. They also include the recognition of when and how to "follow" when appropriate. Such skills can be developed through experience, observation, and education using a framework that can include mentoring, coaching, and feedback. This review provides some guidance in how to improve leadership skills in OMFS, which we hope will to improve the quality of training and care of patients.


Asunto(s)
Competencia Clínica , Liderazgo , Humanos , Cirugía Ortognática
10.
Br J Radiol ; 87(1042): 20130701, 2014 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-25135310

RESUMEN

OBJECTIVE: To review new incidental findings detected on low-resolution CT attenuation correction (CTAC) images acquired during single-photon emission CT (SPECT-CT) myocardial perfusion imaging (MPI) and to determine whether the CTAC images had diagnostic value and warrant reporting. METHODS: A multicentre study was performed in four UK nuclear medicine departments. CTAC images acquired as part of MPI performed using SPECT were evaluated to identify incidental findings. New findings considered to be clinically significant were evaluated further. Positive predictive value (PPV) was determined at the time of definitive diagnosis. RESULTS: Of 1819 patients studied, 497 (27.3%) had a positive CTAC finding. 51 (2.8%) patients had findings that were clinically significant at the time of the CTAC report and had not been previously diagnosed. Only four (0.2%) of these were potentially detrimental to patient outcome. CONCLUSION: One centre had a PPV of 0%, and the study suggests that these CTAC images should not be reported. Two centres with more modern equipment had low PPVs of 0% and 6%, respectively, and further research is suggested prior to drawing a conclusion. The centre with best quality CT had a PPV of 67%, and the study suggests that CTAC images from this equipment should be reported. ADVANCES IN KNOWLEDGE: This study is unique compared with previous studies that have reported only the potential to identify incidental findings on low-resolution CT images. This study both identifies and evaluates new clinically significant incidental findings, and it demonstrates that the benefit of reporting the CTAC images depends on the type of equipment used.


Asunto(s)
Procesamiento de Imagen Asistido por Computador/métodos , Hallazgos Incidentales , Tomografía Computarizada Multidetector/métodos , Imagen de Perfusión Miocárdica/métodos , Femenino , Humanos , Masculino , Persona de Mediana Edad , Valor Predictivo de las Pruebas , Intensificación de Imagen Radiográfica , Tomografía Computarizada de Emisión de Fotón Único , Tomografía Computarizada por Rayos X/métodos
11.
Dis Esophagus ; 26(1): 37-43, 2013 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-22394075

RESUMEN

Minimally invasive surgical techniques are becoming increasingly popular within the pediatric population. Flexible endoscopy may enhance or replace existing techniques in the future. Many of the reported benefits of laparoscopy and thoracoscopy may apply to endoscopy and endoscopy-assisted procedures; however, no reports exist as to the application, results, and outcomes for these procedures in children. It was hypothesized that endoscopy is a useful and safe adjunct for pediatric surgical patients. Retrospective review of medical records for patients who underwent endoscopy or endoscopy-assisted operations at two children's hospitals over 3 years (August 31, 2007-August 31, 2010) was completed. During this time period, 30 procedures were performed on 28 patients. Indications for procedure, age, operative technique, operative times, surgical outcomes, complications, and length of stay for each patient were reviewed. Patient age ranged from 3 days to 20 years. Indications for operation included esophageal pathology (13), gastroduodenal pathology (14), pancreatic pseudocyst (2), and displaced sigmoid Chait® (Cook, Inc., Bloomington, IN, USA) tube. Although endoscopy was intended only as an adjunct in all cases, the planned procedure was satisfactorily completed with a purely endoscopic approach in six cases. There were no intraoperative complications, and minor postoperative complications including one stricture requiring dilation, postoperative stridor, and esophageal leak, were each successfully managed conservatively. Endoscopy offers a promising adjunct to more traditional minimally invasive techniques in children. In some cases, endoscopy may offer an alternative to more invasive procedures or eliminate the need for tube thoracostomy or post-procedural contrast studies in some esophageal cases.


Asunto(s)
Enfermedades del Sistema Digestivo/diagnóstico , Enfermedades del Sistema Digestivo/cirugía , Endoscopía del Sistema Digestivo/métodos , Endoscopía/métodos , Adolescente , Niño , Preescolar , Estudios de Cohortes , Endoscopía/efectos adversos , Endoscopía del Sistema Digestivo/efectos adversos , Femenino , Estudios de Seguimiento , Hospitales Pediátricos , Humanos , Lactante , Recién Nacido , Tiempo de Internación , Masculino , Procedimientos Quirúrgicos Mínimamente Invasivos/efectos adversos , Procedimientos Quirúrgicos Mínimamente Invasivos/métodos , Tempo Operativo , Dolor Postoperatorio/epidemiología , Dolor Postoperatorio/fisiopatología , Seguridad del Paciente , Complicaciones Posoperatorias/epidemiología , Complicaciones Posoperatorias/fisiopatología , Estudios Retrospectivos , Medición de Riesgo , Factores de Tiempo , Resultado del Tratamiento , Adulto Joven
12.
Ann R Coll Surg Engl ; 94(5): 356-8, 2012 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-22943234

RESUMEN

A simple scoring system that enables surgeons to make an estimation of the likelihood of postoperative urinary retention (POUR) in patients undergoing lower limb total joint replacement would be a useful one. This would enable selection of high risk patients who merit pre-operative catheterisation in a clean theatre environment rather than risking urinary retention and its associated complications late at night on the ward by junior, inexperienced staff. The International Prostate Symptom Score (IPSS) is such a scoring system and we assessed its reliability in predicting those male patients likely to go into POUR. We selected all male patients undergoing lower limb total joint arthroplasty under spinal anaesthesia and calculated their IPSS. We found a statistically significant increase in the likelihood of POUR as IPSS rises (p = 0.0002). We concluded that the IPSS is a quick and easy method of predicting those at risk of POUR, allowing them to be catheterised prophylactically, preventing possible complications.


Asunto(s)
Anestesia Raquidea/efectos adversos , Artroplastia de Reemplazo de Cadera/efectos adversos , Artroplastia de Reemplazo de Rodilla/efectos adversos , Índice de Severidad de la Enfermedad , Retención Urinaria/prevención & control , Adulto , Anciano , Anciano de 80 o más Años , Humanos , Masculino , Persona de Mediana Edad , Estudios Prospectivos , Factores de Riesgo , Retención Urinaria/etiología
13.
J Laryngol Otol ; 126(3): 295-301, 2012 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-22251666

RESUMEN

AIMS: To determine (1) the accuracy of positron emission tomography - computed tomography in the diagnosis of head and neck cancer, (2) the learning curve involved, and (3) whether its use alters patient management. MATERIALS AND METHODS: A retrospective study including 80 patients with head and neck cancer who underwent positron emission tomography - computed tomography image fusion at Blackpool Victoria Hospital. RESULTS: Fifty-three patients underwent positron emission tomography - computed tomography for staging (32 for detection of a primary tumour and 21 for detection of distant metastasis) and 27 for detection of loco-regional recurrence. Ten primary tumours and 20 recurrences were accurately diagnosed by this method. Eighteen patients had their tumour stage and management modified as a result of this method of imaging. The effect of the learning curve resulted in better true positive detection rates, one year after introduction (81 versus 61 per cent). The sensitivity and specificity of this method in detecting head and neck cancer were 70 and 42 per cent, respectively, whereas those of conventional imaging were 73 and 51 per cent, respectively. CONCLUSION: Compared with magnetic resonance imaging, the benefits of positron emission tomography - computed tomography may be limited to diagnosis of recurrence, as it is less hindered by tissue fibrosis, radiotherapy-related oedema, scarring and inflammation.


Asunto(s)
Carcinoma/diagnóstico por imagen , Neoplasias de Cabeza y Cuello/diagnóstico por imagen , Imagen Multimodal , Recurrencia Local de Neoplasia/diagnóstico por imagen , Neoplasias Primarias Desconocidas/diagnóstico por imagen , Tomografía de Emisión de Positrones , Tomografía Computarizada por Rayos X , Biopsia , Carcinoma/patología , Carcinoma/secundario , Competencia Clínica , Fluorodesoxiglucosa F18 , Neoplasias de Cabeza y Cuello/patología , Neoplasias de Cabeza y Cuello/secundario , Humanos , Hallazgos Incidentales , Metástasis Linfática , Estadificación de Neoplasias/métodos , Variaciones Dependientes del Observador , Valor Predictivo de las Pruebas , Radiofármacos , Estudios Retrospectivos , Sensibilidad y Especificidad
14.
Clin Endocrinol (Oxf) ; 74(6): 750-5, 2011 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-21521265

RESUMEN

CONTEXT AND OBJECTIVE: Somnolence and obesity are prevalent in craniopharyngioma patients. We hypothesized that somnolence was because of obstructive sleep apnoea in craniopharyngioma patients. DESIGN, PATIENTS AND MEASUREMENTS: We assessed prevalence of somnolence and sleep apnoea in 28 craniopharyngioma and 23 obese controls attending a tertiary referral centre, by means of the Epworth Sleepiness Score (ESS) and polysomnography. All subjects with sleep apnoea were offered continuous positive airway pressure therapy (CPAP) or modafinil. All craniopharyngioma patients, with unexplained somnolence, were offered modafinil. RESULTS: Somnolence was reported by 20/28 (71·5%) craniopharyngioma patients and 4/23 (17%) obese subjects (P < 0·001). Median ESS was 7·5 (IQR 6, 10·7) in craniopharyngioma patients and 4·0 (4,8) in controls, P < 0·01. Eleven somnolent craniopharyngioma patients had obstructive sleep apnoea, in whom treatment led to a reduction in ESS by 6·4 ± 1·4, P = 0·01. Among the remaining nine patients, five were offered modafinil therapy, of whom four had benefit, three were not compliant with hormone replacement, and one died before intervention. There was no difference in the prevalence of obstructive sleep apnoea between craniopharyngioma (n = 13, 46%) and obese subjects (n = 14, 61%, P = 0·4). Body mass index (BMI) does not correlate with apnoea hypopnoea index [apnoea - hypopnoea index (AHI), r = 0·25, P = 0·08], which suggests that obesity alone does not explain the prevalence of sleep apnoea in craniopharyngioma patients. CONCLUSIONS: Somnolence is common in craniopharyngioma patients and in the majority is because of obstructive sleep apnoea. An additional group of somnolent craniopharyngioma patients benefits from modafinil.


Asunto(s)
Craneofaringioma/complicaciones , Neoplasias Hipofisarias/complicaciones , Síndromes de la Apnea del Sueño/diagnóstico , Trastornos del Sueño-Vigilia/diagnóstico , Adulto , Anciano , Compuestos de Bencidrilo/uso terapéutico , Estimulantes del Sistema Nervioso Central/uso terapéutico , Presión de las Vías Aéreas Positiva Contínua , Femenino , Humanos , Masculino , Persona de Mediana Edad , Modafinilo , Polisomnografía , Síndromes de la Apnea del Sueño/complicaciones , Síndromes de la Apnea del Sueño/terapia , Trastornos del Sueño-Vigilia/etiología , Trastornos del Sueño-Vigilia/terapia , Resultado del Tratamiento , Adulto Joven
15.
Minerva Chir ; 64(2): 147-57, 2009 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-19365315

RESUMEN

UNLABELLED: This article will focus on a review of the history and current status of laparoscopic Nissen fundoplication for gastroesophageal reflux disease in infants and children. METHODS: Review of the available current literature concerning laparoscopic Nissen fundoplication in infants and children. Information regarding the current approach for gastroesophageal reflux disease (GERD) in children will be reviewed in addition to the indications for surgical antireflux operation; application and safety of laparoscopy; and the outcomes of laparoscopic Nissen fundoplication in both normal and neurologically impaired children. Finally, the reported data regarding the learning curve in performing the procedure and short-term and long-term complications of laparoscopic Nissen procedure will be discussed. Compared to open antireflux operations, the laparoscopic Nissen approach in infants and children is safe; durable; provides better cosmetic results; and allows for earlier institution of feedings. The established ''learning curve'' for safe and competent performance of laparoscopic Nissen fundoplication is from 25-50 cases. Neurologically impaired patients may indeed benefit from a minimally invasive approach to GERD and enteral access related to improvement of quality of life. Better nutrition and decreased complications related to malnutrition and a decreased incidence of aspiration pneumonia may be realized for these patients. The laparoscopic Nissen approach to GERD is well accepted and widely utilized in infants and children. Prospective randomized multi-institutional studies will be necessary to accurately determine whether this therapeutic approach to GERD in both neurologically impaired and neurologically normal children is the superior option compared to continued medical therapy or gastrojejunal feeding tube approaches to GERD.


Asunto(s)
Fundoplicación/métodos , Reflujo Gastroesofágico/cirugía , Laparoscopía , Niño , Fundoplicación/educación , Humanos , Desnutrición/prevención & control , Neumonía por Aspiración/prevención & control , Calidad de Vida , Resultado del Tratamiento
16.
Endoscopy ; 38(7): 684-9, 2006 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-16761209

RESUMEN

BACKGROUND AND STUDY AIMS: Recent studies have documented the safety of propofol sedation for endoscopic procedures, but many endoscopists are reluctant to use propofol for high-risk patients because of adverse effects. The aim of this study was to demonstrate the safety and efficacy of nurse-administered propofol sedation during emergency upper endoscopy for patients with gastrointestinal bleeding. PATIENTS AND METHODS: Over a period of 18 months, 120 patients suffering from acute upper gastrointestinal bleeding received propofol sedation administered by a registered nurse. Among these, 15 patients were classified into American Society of Anesthesiologists (ASA) class IV, 84 were ASA class III, and 21 were ASA class II. Patients without gastrointestinal bleeding, who also received propofol during the same period and were matched for age, gender, and ASA class, served as controls. RESULTS: Endoscopic hemostasis was achieved in 98.3 % of patients, and 97.5 % were satisfied with the procedure. In patients with gastrointestinal bleeding, the rates of hypotension (systolic blood pressure < 90 mmHg) and hypoxemia (peripheral oxygen saturation < 90 %) were 8.3 % and 6.7 % respectively, values higher than those in the control group. However, neither mask ventilation nor endotracheal intubation was necessary. Although two patients with gastrointestinal bleeding developed pneumonia, most likely due to aspiration during the procedure, they recovered within 5 days of treatment. There were no sedation-associated severe complications or mortalities. CONCLUSION: Using a strict protocol designed to protect the patient's airway and cardiovascular function, nurse-administered propofol sedation during emergency upper gastrointestinal endoscopy is safe and appropriate in cases of acute gastrointestinal bleeding.


Asunto(s)
Sedación Consciente/enfermería , Endoscopía Gastrointestinal/enfermería , Hemorragia Gastrointestinal/enfermería , Hemostasis Endoscópica/enfermería , Hipnóticos y Sedantes/administración & dosificación , Propofol/administración & dosificación , Enfermedad Aguda , Adulto , Anciano , Anciano de 80 o más Años , Sedación Consciente/efectos adversos , Urgencias Médicas , Femenino , Hemorragia Gastrointestinal/etiología , Hemorragia Gastrointestinal/terapia , Humanos , Masculino , Persona de Mediana Edad , Propofol/efectos adversos
17.
Endoscopy ; 38(4): 360-7, 2006 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-16680635

RESUMEN

BACKGROUND AND STUDY AIMS: Propofol has several attractive properties, including a rapid onset of action and rapid recovery. However, the administration of propofol sedation in the absence of anesthesiologists remains controversial. This report describes the safety profile of propofol sedation for endoscopy when administered by registered nurses under the supervision of endoscopists. PATIENTS AND METHODS: The study was conducted in the endoscopic center of a Japanese private hospital. With assistance from an anesthesiologist, a protocol for administration of propofol by registered nurses was developed. Over the past 6 years, 27,500 patients received nurse-administered propofol sedation. The safety and patient satisfaction with this sedation procedure were evaluated. RESULTS: Among the participating patients, 6.7% developed hypoxemia (Sp(O2) < 90%); 6.2% required oxygen administration via a nasal cannula. Severe hypoxemia (Sp(O2) < 85%) occurred in 121 patients (0.62%) during upper gastrointestinal endoscopy and 20 patients (0.25%) during colonoscopy, but neither mask ventilation nor endotracheal intubation was necessary. A decline in blood pressure (systolic blood pressure < 90 mm Hg) was seen in 3.5% of the colonoscopy patients and 1.2% of the upper endoscopy patients. However, hypotension was corrected immediately using an intravenous saline solution. Patients who received propofol sedation expressed overall satisfaction on a 10-point visual analogue scale (with an average of 9.4 points). Among patients who had previously received a combination of midazolam and pethidine for colonoscopy, 85% preferred propofol sedation. The mean time from the end of the procedure to full recovery was 14.6 min. CONCLUSIONS: Administration of propofol by registered nurses under the supervision of endoscopists was safe, and resulted in high rates of patient satisfaction.


Asunto(s)
Anestésicos Intravenosos/administración & dosificación , Sedación Consciente/enfermería , Endoscopía Gastrointestinal/métodos , Enfermeras Clínicas , Propofol/administración & dosificación , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Femenino , Humanos , Masculino , Persona de Mediana Edad , Organización y Administración , Satisfacción del Paciente
18.
Anesthesiology ; 103(1): 65-73, 2005 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-15983458

RESUMEN

BACKGROUND: Dysfunctional mitochondria have been widely accepted as one of the key targets and a mediator of secondary cell injury and organ failure during hemorrhagic shock (HS). The liver is known to be the first organ to display the signs of injury during HS. This report describes experiments to determine whether modulation of hepatic mitochondrial dysfunctions by pharmacologic agents could prevent liver injury in rats subjected to HS. METHODS: In this study, Sprague-Dawley rats were either treated as controls or subjected to computer-controlled arterial hemorrhage (40 mmHg) for 60 min followed by resuscitation with hypertonic saline, hypertonic beta-hydroxybutyrate, or hypertonic sodium pyruvate for the next 60 min before death. During the course of the experiment, animals were continuously monitored for hemodynamic and metabolic parameters. At the end of the experiment, the liver was excised and examined for oxidative injury, mitochondrial functions, expression of nitric oxide synthase, and indicators of apoptosis. RESULTS: In comparison to hypertonic saline and hypertonic beta-hydroxybutyrate, pyruvate significantly protected the liver from oxidative injury, prevented the up-regulation of nitric oxide synthase, inhibited pyruvate dehydrogenase deactivation, and improved cellular energy charge and mitochondrial functions. In addition, pyruvate also reduced cleavage of poly-adenosine diphosphate ribose polymerase by preventing leakage of mitochondrial cytochrome c in the liver of HS animals. CONCLUSIONS: These data suggest that modulation of mitochondrial metabolic functions is likely to be one of the important mechanisms by which pyruvate exerts its protective effects on the liver during HS and resuscitation in rats.


Asunto(s)
Apoptosis/efectos de los fármacos , Mitocondrias Hepáticas/efectos de los fármacos , Ácido Pirúvico/farmacología , Choque Hemorrágico/metabolismo , Animales , Apoptosis/fisiología , Masculino , Mitocondrias Hepáticas/metabolismo , Ácido Pirúvico/uso terapéutico , Ratas , Ratas Sprague-Dawley , Choque Hemorrágico/prevención & control
19.
QJM ; 97(4): 229-35, 2004 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-15028853

RESUMEN

BACKGROUND: As use of a drug becomes widespread, the full spectrum of its effects becomes clearer. Although a link has been suggested between low or lowered cholesterol and irritability/aggression, less is known about possible links between irritability and statins. AIM: To assess the possible connection of statin usage to severe irritability. DESIGN: Case series. METHODS: Six patients referred or self-referred with irritability and short temper on statin cholesterol-lowering drugs completed a survey providing information on character of behavioural effect, time-course of onset and recovery, and factors relevant to drug adverse effect causality. RESULTS: In each case the personality disruption, once evident, was sustained until statin use was discontinued; and resolved promptly with drug cessation. In four patients, re-challenge with statins occurred, and led to recrudescence of the problem. All patients experienced other recognized statin adverse effects while on the drug. Manifestations of severe irritability included homicidal impulses, threats to others, road rage, generation of fear in family members, and damage to property. DISCUSSION: Case series invariably raise more questions than they can answer. These case reports suggest that severe irritability may occur in some statin users. Although this adverse effect may be rare, potentially life-threatening adverse effects of drugs must be taken seriously.


Asunto(s)
Anticolesterolemiantes/efectos adversos , Inhibidores de Hidroximetilglutaril-CoA Reductasas/efectos adversos , Genio Irritable , Trastornos del Humor/inducido químicamente , Anciano , Anticolesterolemiantes/administración & dosificación , Femenino , Humanos , Inhibidores de Hidroximetilglutaril-CoA Reductasas/administración & dosificación , Masculino , Persona de Mediana Edad
20.
Scand J Urol Nephrol ; 37(6): 512-4, 2003.
Artículo en Inglés | MEDLINE | ID: mdl-14675927

RESUMEN

Condyloma acuminata of the urinary bladder is a rare finding, particularly in the absence of similar lesions of the external genitalia. We present a case in which an isolated condyloma acuminatum-like lesion rapidly progressed to a poorly differentiated spindle cell carcinoma, underlying the need for careful endoscopic follow-up of patients with such lesions.


Asunto(s)
Carcinoma/patología , Condiloma Acuminado/patología , Invasividad Neoplásica/patología , Lesiones Precancerosas/patología , Neoplasias de la Vejiga Urinaria/patología , Infecciones Urinarias/patología , Anciano , Biopsia con Aguja , Carcinoma/diagnóstico , Condiloma Acuminado/diagnóstico , Cistoscopía , Femenino , Estudios de Seguimiento , Humanos , Inmunohistoquímica , Medición de Riesgo , Neoplasias de la Vejiga Urinaria/diagnóstico , Infecciones Urinarias/diagnóstico
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...