Escherichia coli expression and characterization of alfa-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% β-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L asparaginase I termoestável de Pyrococcus abyssi

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G – 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G – 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

Escherichia coli expression and characterization of -amylase from Geobacillus thermodenitrificans DSM-465

Abstract Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% -helices, 15% -sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

Resumo A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi

Abstract L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as G 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

Resumo A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como G 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

Escherichia coli expression and characterization of α-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% ß-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L-asparaginase I termoestável de Pyrococcus abyssi

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G ­ 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G ­ 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

Escherichia coli expression and characterization of alfa-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% β-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.(AU)

A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.(AU)

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L asparaginase I termoestável de Pyrococcus abyssi

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.(AU)

A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.(AU)

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi.

L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G - 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

Escherichia coli expression and characterization of α-amylase from Geobacillus thermodenitrificans DSM-465.

Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% ß-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Prevalence and chemotherapy of babesiosis among Lohi sheep in the Livestock Experiment Station, Qadirabad, Pakistan, and environs

A total of 310 blood smears were collected from sheep of the Livestock Experiment Station, Qadirabad, Sahiwal district, Pakistan, and surrounding areas. The samples were examined microscopically and 30 (9.67%) were positive for babesiosis. The animals were divided into two groups (A and B) for chemotherapy. Group A sheep were treated with diminazene diaceturate while group B animals received imidocarb dipropionate. Drug efficacy was determined by negative blood smear examination. Diminazene diaceturate effectiveness against babesiosis was 80% while that of imidocarb dipropionate was 100%. Hematological studies revealed a significant decrease in hemoglobin concentrations and hematocrit values for Babesia-positive animals compared to healthy controls.(AU)

Prevalence and chemotherapy of babesiosis among Lohi sheep in the Livestock Experiment Station, Qadirabad, Pakistan, and environs

A total of 310 blood smears were collected from sheep of the Livestock Experiment Station, Qadirabad, Sahiwal district, Pakistan, and surrounding areas. The samples were examined microscopically and 30 (9.67 percent) were positive for babesiosis. The animals were divided into two groups (A and B) for chemotherapy. Group A sheep were treated with diminazene diaceturate while group B animals received imidocarb dipropionate. Drug efficacy was determined by negative blood smear examination. Diminazene diaceturate effectiveness against babesiosis was 80 percent while that of imidocarb dipropionate was 100 percent. Hematological studies revealed a significant decrease in hemoglobin concentrations and hematocrit values for Babesia-positive animals compared to healthy controls.(AU)