RESUMEN
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMEN
A highly efficient ratiometric electrochemiluminescence (ECL) immunoassay was explored by bidirectionally regulating the ECL intensity of two luminophors. The immunoassay was conducted in a split-type mode consisting of an ECL detection procedure and a sandwich immunoreaction. The ECL detection was executed using a dual-disk glassy carbon electrode modified with two potential-resolved luminophors (g-C3N4-Ag and Ru-MOF-Ag nanocomposites), and the sandwich immunoreaction using glucose oxidase (GOx)-modified SiO2 nanospheres as labels was carried out in a 96-well plate. The Ag nanoparticles (NPs) acted as bifunctional units both for triggering the resonance energy transfer (RET) with g-C3N4 and for accelerating the electron transfer rate of the Ru-MOF-Ag ECL reaction. When the H2O2 catalyzed by GOx in the 96-well plate was transferred to the dual-disk glass carbon electrode, the doped Ag NPs in the two luminophors could be etched, thus destroying the RET between C3N4 and the accelerated reaction to Ru-MOF, resulting in an opposite trend in the ECL signal outputted from the dual disks. Using the ratio of the two signals for quantification, the constructed immunosensor for a model target, i.e. myoglobin, exhibited a low detection limit of 4.7 × 10-14 g/mL. The ingenious combination of ECL ratiometry, bifunctional Ag NPs, and a split-type strategy effectively reduces environmental and human errors, offering a more precise and sensitive analysis for complex samples.
Asunto(s)
Técnicas Electroquímicas , Glucosa Oxidasa , Límite de Detección , Mediciones Luminiscentes , Nanopartículas del Metal , Plata , Plata/química , Inmunoensayo/métodos , Nanopartículas del Metal/química , Técnicas Electroquímicas/métodos , Mediciones Luminiscentes/métodos , Glucosa Oxidasa/química , Glucosa Oxidasa/metabolismo , Técnicas Biosensibles/métodos , Mioglobina/análisis , Dióxido de Silicio/químicaRESUMEN
As one of the interesting signaling mechanisms, the in situ growth reaction on a photoelectrode has proven its powerful potential in photoelectrochemical (PEC) bioanalysis. However, the specific interaction between the signaling species with the photoactive materials limits the general application of the signal mechanism. Herein, on the basis of an in situ growth reaction on a photoelectrode of single-atom-based photoactive material, a general PEC immunoassay was developed in a split-type mode consisting of the immunoreaction and PEC detection procedure. Specifically, a single-atom photoactive material that incorporates Fe atoms into layered Bi4O5I2 (Bi4O5I2-Fe SAs) was used as a photoelectrode for PEC detection. The sandwich immunoreaction was performed in a well of a 96-well plate using Ag nanoparticles (Ag NPs) as signal tracers. In the PEC detection procedure, the Ag+ converted from Ag NPs were transferred onto the surface of the Bi4O5I2-Fe SAs photoelectrode and thereafter AgI was generated on the Bi4O5I2-Fe SAs in situ to form a heterojunction through the reaction of Ag+ with Bi4O5I2-Fe SAs. The formation of heterojunction greatly promoted the electro-hole separation, boosting the photocurrent response. Exemplified by myoglobin (Myo) as the analyte, the immunosensor achieved a wide linear range from 1.0 × 10-11 to 5.0 × 10-8 g mL-1 with a detection limit of 3.5 × 10-12 g mL-1. This strategy provides a general PEC immunoassay for disease-related proteins, as well as extends the application scope of in situ growth reaction in PEC analysis.
Asunto(s)
Técnicas Biosensibles , Nanopartículas del Metal , Técnicas Biosensibles/métodos , Inmunoensayo/métodos , Plata , Mioglobina , Técnicas Electroquímicas/métodos , Límite de DetecciónRESUMEN
Restrictions on the use of phthalates have led to the wide use of alternative plasticizers (APs) such as organophosphate, adipate, citrate, and sebacate. However, because plasticizers combine with polymers in plastic products via unstable noncovalent bonds, they can easily migrate out of these products, causing environmental pollution. In particular, their migration out of food packaging, containers, and other food-contact materials and into food has raised great concerns. Toxicological studies have shown that APs contain potentially toxic substances that can affect endocrine functions and cause neurotoxicity, genotoxicity, and other adverse effects. Thus, their potential risks to food should not be underestimated. Sesame oil is a necessity in daily cooking. The results of risk monitoring in recent years have indicated that sesame oil often contains phthalates in excess of the standard limits. However, the potential risks of APs in sesame oil have not yet been reported. Some common detection methods for APs include gas chromatography-mass spectrometry, gas chromatography-triple quadrupole mass spectrometry, and liquid chromatography-triple quadrupole mass spectrometry. Unfortunately, these methods use low-resolution mass spectrometry and are limited by the resolution, scan rate, and analysis mode. Gas chromatography-quadrupole time-of-flight mass spectrometry (GC-Q-TOF/MS) has the advantages of high resolution, sensitivity, and analysis speed. In full-scan mode, GC-Q-TOF/MS can accurately collect the full-spectrum mass number of target compounds with low content levels in complex substrates, thereby realizing efficient screening and quantitative analysis. It shows outstanding advantages in the trace analysis of pesticide residues and pollutants. Furthermore, it features strong qualitative and high screening abilities. Establishment of a personal compound database and library (PCDL) addresses limitations in the number of compounds that can be measured and enables the rapid identification of targets without the use of standard products. In addition, increasing the number of targets for synchronous screening enables the retrospective analysis of new targets. In this study, a method based on GC-Q-TOF/MS was developed for the determination of 54 APs in sesame oil. The samples were extracted with acetonitrile and purified using a PSA/silica solid-phase extraction column. The mass-spectral information of the samples was then collected by GC-Q-TOF/MS in full-scan mode, and the 54 APs were searched using an established high-resolution mass-spectrum database to simultaneously achieve the broad-spectrum screening, qualitative identification, and quantitative analysis of multiple targets. The effects of different extraction solvents and purification methods on sample extraction and purification were compared. The accuracy of the screening results was improved by optimizing the GC-separation conditions, quality-extraction window, retention-time deviation, and other screening parameters. The screening detection limits (SDLs) of the 54 APs ranged from 0.01 to 0.02 mg/kg; specifically, the SDL of 41 compounds was 0.01 mg/kg and that of 13 compounds were 0.02 mg/kg. The limits of quantification were in the range of 0.02-0.04 mg/kg. A total of 80 sesame-oil samples were rapidly screened using this method under optimal conditions. Five APs were identified from the 80 sesame-oil samples and quantitatively analyzed using the matrix-matched external-standard method. The results of this quantitative methodology showed that the five APs had good linear relationships in the range of 0.01-0.2 mg/L, with all correlation coefficients greater than 0.99. The accuracy and precision of the method were verified using a standard recovery test with blank sesame-oil samples. Under the three standard levels of 0.04, 0.08, and 0.2 mg/kg, the recoveries of the five APs ranged from 71.3% to 97.8%, and the relative standard deviations (RSDs) ranged from 0.4% to 6.1%(n=6). The developed method is fast, accurate, sensitive, and has high throughput. Thus, it can realize the efficient screening, qualitative identification, and quantitative analysis of the 54 APs in sesame oil and provides a potential solution for the monitoring of other contaminants in food.
Asunto(s)
Plastificantes , Aceite de Sésamo , Cromatografía de Gases y Espectrometría de Masas/métodos , Ensayos Analíticos de Alto Rendimiento , Estudios Retrospectivos , Espectrometría de Masas , Cromatografía Líquida de Alta PresiónRESUMEN
Improvements in living standards have led to an increase in the consumption of animal-derived foods. Pesticides may be used illegally during animal breeding as well as meat production and processing for pest control and preservation. Pesticides applied to crops may also be enriched in animal tissues through the food chain, thereby increasing the risk of pesticide residue accumulation in muscles and visceral tissues and endangering human health. China has stipulated maximum residue limits for pesticide residues in livestock and poultry meat and their viscera. Many other major developed countries and organizations, including the European Union, Codex Alimentarius Commission, and Japan, have also set maximum residue limits for these residues (0.005-10, 0.004-10, and 0.001-10 mg/kg, respectively). Research on pretreatment technologies for pesticide residue detection in plant-derived foods is widely available, but insufficient attention has been paid to animal-derived foods. Thus, high-throughput detection technologies for pesticide residues in animal-derived foods are limited. The impurities that can interfere with the detection process for plant-derived foods mainly include organic acids, polar pigments, and other small molecular compounds; by contrast, the matrix of animal-derived foods is much more complex. Macromolecular proteins, fats, small molecular amino acids, organic acids, and phospholipids can interfere with the detection of pesticide residues in animal-derived foods. Thus, selecting the appropriate pretreatment and purification technology is of great importance. In this study, the QuEChERS technique was combined with online gel permeation chromatography-gas chromatography-tandem mass spectrometry (GPC-GC-MS/MS) to determine 196 pesticide residues in animal-derived foods. The samples were extracted with acetonitrile, purified using the QuEChERS technique coupled with online GPC, detected by GC-MS/MS, determined in multiple reaction monitoring mode (MRM), and quantified using the external standard method. The effects of the extraction solvent and purification agent type on the extraction efficiency and matrix removal of the method were optimized. The purification effect of online GPC on the sample solution was investigated. The optimal distillate receiving time was obtained by studying the recoveries of the target substances and matrix effects over different distillate receiving periods to achieve the effective introduction of target substances and efficient matrix removal. Further, the advantages of the QuEChERS technique combined with online GPC were evaluated. The matrix effects of 196 pesticides were assessed; ten pesticide residues showed moderate matrix effects, while four pesticide residues showed strong matrix effects. A matrix-matched standard solution was used for quantification. The 196 pesticides showed good linearity in the range of 0.005-0.2 mg/L, with correlation coefficients greater than 0.996. The limits of detection and quantification were 0.002 and 0.005 mg/kg, respectively. The recoveries of 196 pesticides at spiked levels of 0.01, 0.05, and 0.20 mg/kg were 65.3%-126.2%, with relative standard deviations (RSDs) of 0.7%-5.7%. The proposed method is rapid, accurate, and sensitive; thus, it is suitable for the high-throughput screening and detection of multiple pesticide residues in animal-derived foods.
Asunto(s)
Residuos de Plaguicidas , Plaguicidas , Animales , Humanos , Espectrometría de Masas en Tándem , Ensayos Analíticos de Alto Rendimiento , Cromatografía de Gases y Espectrometría de Masas , Cromatografía en GelRESUMEN
A closed bipolar electrochemiluminescence (BP-ECL) platform for sensitive prostate specific antigen (PSA) detection was proposed based on a novel synergistic signal amplification strategy. Specifically, glucose oxidase-loaded Cu-based metal-organic frameworks (Cu-MOFs/GOx) as bifunctional probes were bridged on the anodic interface with the target PSA as the intermediate unit. In virtue of the large loading capacity of Cu-MOFs, a large amount of a co-reactant, i.e., H2O2 in this L-012-based ECL system and gluconic acid were generated on the anodic pole in the presence of glucose. The generated gluconic acid could effectively degrade the Cu-MOFs to release Cu2+ which greatly accelerates the formation of highly active intermediates from co-reactant H2O2, boosting the ECL intensity. As for the cathodic pole, K3Fe(CN)6 with a lower reduction potential is used to reduce the driving voltage and speed up the reaction rate, further strengthening the ECL intensity. Thanks to the synergistic signal amplification effect at both two electrode poles of the BP-ECL system, highly sensitive detection of PSA was realized with a detection limit of 5.0 × 10-14 g/mL and a wide linear range of 1.0 × 10-13-1.0 × 10-7 g/mL. The strategy provides a novel way for signal amplification in the BP-ECL biosensing field.
Asunto(s)
Técnicas Biosensibles , Antígeno Prostático Específico , Humanos , Masculino , Mediciones Luminiscentes , Peróxido de Hidrógeno , Inmunoensayo , Técnicas Electroquímicas , Límite de DetecciónRESUMEN
The understanding of areas for "classical" electrochemistry (including catalysis, electrolysis and sensing) and bio-electrochemistry at the micro/nanoscale are focus on the continued performance facilitations or the exploration of new features. In the recent 20â years, a different mode for driving electrochemistry has been proposed, which is called as bipolar electrochemistry (BPE). BPE has garnered attention owing to the interesting properties: (i)â its wireless nature facilitates electrochemical sensing and high throughput analysis; (ii)â the gradient potential distribution on the electrodes surface is a useful tool for preparing gradient surfaces and materials. These permit BPE to be used for modification and analytical applications on a micro/nanoscale surface. This review aims to introduce the principle and classification of BPE and BPE at micro/nanoscale; sort out its applications in electrocatalysis, electrosynthesis, electrophoresis, power supply and so on; explain the confined BPE and summarize its analytical application for single entities (single cells, single particles and single molecules), and discuss finally the important direction of micro/nanoscale BPE.
Asunto(s)
Técnicas Electroquímicas , Nanotecnología , Técnicas Electroquímicas/métodos , Electroquímica , Electrodos , CatálisisRESUMEN
BACKGROUND: Gitelman syndrome (GS) is a rare inherited autosomal recessive tubulopathy, characterized clinically by hypokalemia, hypomagnesemia, hypocalciuria, and metabolic alkalosis, and is caused by an inactivating mutation in SLC12A3. GS is prone to misdiagnosis when occurring simultaneously with hyperthyroidism. It is important to consider the possibility of other diseases when hyperthyroidism is combined with hypokalemia, which is difficult to correct. CASE SUMMARY: A female patient with hyperthyroidism complicated with limb weakness was diagnosed with thyrotoxic hypokalemic periodic paralysis for 4 mo. However, the patient's serum potassium level remained low despite sufficient potassium replacement and remission of hyperthyroidism. GS was confirmed by whole exome and Sanger sequencing. Gene sequencing revealed compound heterozygous mutations of c.488C>T (p.Thr163Met), c.2612G>A (p.Arg871His), and c.1171_1178dupGCCACCAT (p.Ile393fs) in SLC12A3. Protein molecular modeling was performed to predict the effects of the identified missense mutations. All three mutations cause changes in protein structure and may result in abnormal protein function. All previously reported cases of GS coexisting with autoimmune thyroid disease are reviewed. CONCLUSION: We have identified a novel compound heterozygous mutation in SLC12A3. The present study provides new genetic evidence for GS.
RESUMEN
This work presents a novel signal amplification strategy for electrochemiluminescence (ECL) biosensor based on liposome-assisted chemical redox cycling for in situ formation of Au nanoparticles (Au NPs) on TiO2 nanotubes (TiO2 NTs) electrode. The system was exemplified by ascorbic acid (AA)-loaded liposome, the redox cycling of AA utilizing tris (2-carboxyethyl) phosphine (TCEP) as reductant, and the use of Au nanoclusters (Au NCs)/TiO2 NTs as working electrode to implement the ECL detection of prostate specific antigen (PSA). Specifically, the AA-loaded liposomes were used as tags to label the captured PSA through a sandwich immunoreaction. After the lysate of the liposome was transferred onto the interface of Au NCs/TiO2 NTs in the presence of Au3+ and TECP, the chemical redox cycling was triggered. In the cycling, Au3+ was directly reduced in situ by AA to form Au NPs on Au NCs/TiO2 NTs electrode, whereas the oxidation product of AA was reduced by TCEP to regenerate AA. The large loading capacity of the liposome and chemical redox cycling resulted in the incomplete reduction of the Au NCs to Au NPs on the TiO2 NTs electrode, enhancing the ECL intensity greatly. The multiple signal amplification strategy achieved an ultrasensitive detection for PSA with a detection limit down to 6.7 × 10-15 g mL-1 and a wide linear concentration range from 1.0 × 10-14 to 1.0 × 10-8 g mL-1. It is believed that this work is anticipated to extend the employment of advanced chemical redox cycling reaction in the field of ECL bioassays.
Asunto(s)
Técnicas Biosensibles , Nanopartículas del Metal , Técnicas Biosensibles/métodos , Técnicas Electroquímicas/métodos , Oro , Humanos , Inmunoensayo , Límite de Detección , Liposomas , Masculino , Oxidación-Reducción , Antígeno Prostático EspecíficoRESUMEN
A novel signal-increased photoelectrochemical (PEC) biosensor for l-cysteine (L-Cys) was proposed based on the Bi2MoO6-Bi2S3 heterostructure formed in situ on the indium-tin oxide (ITO) electrode. To fabricate the PEC biosensor, Bi2MoO6 nanoparticles were prepared by a hydrothermal method and coated on a bare ITO electrode. When L-Cys existed, Bi2S3 was formed in situ on the interface of the Bi2MoO6/ITO electrode by a chemical displacement reaction. Under the visible light irradiation, the Bi2MoO6-Bi2S3/ITO electrode exhibited evident enhancement in photocurrent response compared with the Bi2MoO6/ITO electrode, owing to the signal-increased sensing system and the excellent property of the formed Bi2MoO6-Bi2S3 heterostructure such as the widened light absorption range and efficient separation of photo-induced electron-hole pairs. Under the optimal conditions, the sensor for L-Cys detection has a linear range from 5.0 × 10-11 to 1.0 × 10-4 mol L-1 and a detection limit of 5.0 × 10-12 mol L-1. The recoveries ranging from 90.0% to 110.0% for determining L-Cys in human serum samples validated the applicability of the biosensor. This strategy not only provides a method for L-Cys detection but also broadens the application of the PEC bioanalysis based on in situ formation of photoactive materials.
RESUMEN
Potential-resolved electrochemiluminescence (ECL) ratiometric analysis has become a research hotspot in bioassays by virtue of its good accuracy, versatility and specificity. Current ECL ratiometry mainly focuses on the competition for the co-reactant or quantitative analysis using a variable signal and a changeless signal; the disorganized change or small difference between the two signals may affect the accuracy and sensitivity of detection. In this study, we have developed a novel ECL ratiometric sensor based on the bidirectional regulation of two independent co-reaction systems by H2O2. H2O2 as a bidirectional moderator permits the ECL signals of the cathode and anode to independently change in opposite trends, which greatly enhances the organization and difference between the two signals. The ratio of the two signals is used to realize the quantitative analysis of myoglobin (MyO) with a good linear relationship between log(ECLcathode/ECLanode) and log CMyO in the range of 1.0 × 10-13 to 1.0 × 10-7 g mL-1. The detection limit is 4.0 × 10-14 g mL-1. Furthermore, it showed excellent performance in the determination of MyO in human serum samples. The proposed biosensor provides some developments for the sensitive and accurate detection of disease markers.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Electrodos , Humanos , Peróxido de Hidrógeno , Límite de Detección , Mediciones LuminiscentesRESUMEN
[This corrects the article DOI: 10.7150/ijbs.66915.].
RESUMEN
For real-time evaluation of the cell behavior and function under in vivo-like 3D environment, the 3D functionalized scaffolds simultaneously integrate the function of 3D cell culture, and electrochemical sensing is a convincing candidate. Herein, Fe3O4 nanoparticles as the nanozyme (peroxide oxidase mimics) were modified on graphene foam scaffold to construct a 3D integrated platform. The platform displayed a wide linear range of 100 nM to 20 µM and a high sensitivity of 53.2 nA µM-1 toward detection of hydrogen peroxide (H2O2) under the working potential of + 0.6 V (vs. Ag/AgCl). The obtained 3D scaffold also displayed satisfactory selectivity toward the possible interferents that appeared in the cell culture environment. Furthermore, the cells still maintained high cell viability (almost 100%) after their growth and proliferation on the scaffold for 7 days. With the superior performance on cell culture and electrochemical monitoring, the functions on the 3D culture of MCF-7 or HeLa cells and in situ monitoring of cell-released H2O2 was easily achieved on this 3D platform, which show its great application prospects on further cancer-related disease diagnosis or drug screening. A nanozyme-based three-dimensional graphene scaffold was successfully constructed for cell culture and identification of cancer cells through in situ electrochemical monitoring of the cell-released H2O2.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Grafito/química , Peróxido de Hidrógeno/metabolismo , Nanopartículas Magnéticas de Óxido de Hierro/química , Células Cultivadas , Electrodos , Células HeLa , Humanos , Peróxido de Hidrógeno/química , Células MCF-7 , Tamaño de la Partícula , Propiedades de SuperficieRESUMEN
A simple and highly selective fluorescence biosensor has been exploited for p-nitrophenol (p-NP) and alkaline phosphatase (ALP) activity detection based on the glutathione-stabilized copper nanoclusters (GSH-CuNCs) mediated-inner filter effect (IFE). The GSH-CuNCs were prepared by employing GSH as stabilizer and ascorbic acid (AA) as reductant. The obtained GSH-CuNCs exhibited a strong blue fluorescence emission at 420 nm with an excitation wavelength of 365 nm, which overlapped largely with the absorption spectra of p-nitrophenol (p-NP). Therefore, the luminescence of GSH-CuNCs could be quenched by p-NP through inner filter effect. In addition, ALP catalyzed the substrate p-nitrophenyl phosphate (p-NPP) to form p-nitrophenol (p-NP), which also leading to the fluorescence quenching of GSH-CuNCs. The fluorescent strategy was realized for the sensitive determination of p-NP and ALP activity with the promising limit of detection of 20 nM (for p-NP) and 0.003 mUâ mL-1 (for ALP). Furthermore, the method could be applied to detect the p-NP content in river water samples and ALP activity in human serum samples.
Asunto(s)
Cobre , Nanopartículas del Metal , Fosfatasa Alcalina , Cobre/química , Colorantes Fluorescentes/química , Glutatión , Humanos , Límite de Detección , Nanopartículas del Metal/química , Nitrofenoles , Espectrometría de FluorescenciaRESUMEN
Background: Circular RNAs (circRNAs), which generally act as microRNA (miRNA) sponges to competitively regulate the downstream target genes of miRNA, play an essential role in cancer biology. However, few studies have been reported on the role of circRNA based competitive endogenous RNA (ceRNA) network in hepatocellular carcinoma (HCC). Herein, we aimed to screen and establish the circRNA/miRNA/mRNA networks related to the prognosis and progression of HCC and further explore the underlying mechanisms of tumorigenesis. Methods: GEO datasets GSE97332, GSE108724, and GSE101728 were utilized to screen the differentially expressed circRNAs (DE-circRNAs), DE-miRNAs, and DEmRNAs between HCC and matched para-carcinoma tissues. After six RNA-RNA predictions and five intersections between DE-RNAs and predicted RNAs, the survival-related RNAs were screened by the ENCORI analysis tool. The ceRNA networks were constructed using Cytoscape software, based on two models of up-regulated circRNA/down-regulated miRNA/up-regulated mRNA and down-regulated circRNA/up-regulated miRNA/down-regulated mRNA. The qRT-PCR assay was utilized for detecting the RNA expression levels in HCC cells and tissues. The apoptosis, Edu, wound healing, and transwell assays were performed to evaluate the effect of miR-106b-5p productions on the proliferation, invasion, and metastasis of HCC cells. In addition, the clone formation, cell cycle, and nude mice xenograft tumor assays were used to investigate the influence of hsa_circ_0001495 (circCCNB1) silencing and overexpression on the proliferation of HCC cells in vitro and in vivo. Furthermore, the mechanism of downstream gene DYNC1I1 and AKT/ERK signaling pathway via the circCCNB1/miR-106b-5p/GPM6A network in regulating the cell cycle was also explored. Results: Twenty DE-circRNAs with a genomic length less than 2000bp, 11 survival-related DE-miRNAs, and 61 survival-related DE-mRNAs were screened out and used to construct five HCC related ceRNA networks. Then, the circCCNB1/miR-106b-5p/GPM6A network was randomly selected for subsequent experimental verification and mechanism exploration at in vitro and in vivo levels. The expression of circCCNB1 and GPM6A were significantly down-regulated in HCC cells and cancer tissues, while miR-106b-5p expression was up-regulated. After transfections, miR-106b-5p mimics notably enhanced the proliferation, invasion, and metastasis of HCC cells, while the opposite was seen with miR-105b-5p inhibitor. In addition, circCCNB1 silencing promoted the clone formation ability, the cell cycle G1-S transition, and the growth of xenograft tumors of HCC cells via GPM6A downregulation. Subsequently, under-expression of GPM6A increased DYNC1I1 expression and activated the phosphorylation of the AKT/ERK pathway to regulate the HCC cell cycle. Conclusions: We demonstrated that circCCNB1 silencing promoted cell proliferation and metastasis of HCC cells by weakening sponging of oncogenic miR-106b-5p to induce GPM6A underexpression. DYNC1I1 gene expression was up-regulated and further led to activation of the AKT/ERK signaling pathway.
Asunto(s)
Carcinoma Hepatocelular/genética , Ciclina B1/genética , Neoplasias Hepáticas/genética , MicroARNs/genética , ARN Circular/genética , Animales , Línea Celular Tumoral , Proliferación Celular/genética , Dineínas Citoplasmáticas/metabolismo , Regulación Neoplásica de la Expresión Génica , Silenciador del Gen , Humanos , Sistema de Señalización de MAP Quinasas , Masculino , Glicoproteínas de Membrana/metabolismo , Ratones , Ratones Endogámicos BALB C , Ratones Desnudos , Proteínas del Tejido Nervioso/metabolismo , Proteínas Proto-Oncogénicas c-akt/metabolismo , Ensayos Antitumor por Modelo de XenoinjertoRESUMEN
The photoelectrochemical (PEC) self-powered system has attracted great attention in disease detection. The determination of a simple and efficient approach for disease-related biomarkers is highly interesting and appealing. Herein, an ingenious visible light-induced membraneless self-powered PEC biosensing platform was constructed, integrating a signal amplification strategy for ultrasensitive split-type PEC bioanalysis. The system was comprised of a Bi2S3/BiPO4 heterojunction photoanode and a platinum (Pt) cathode in a one compartment chamber. An alkaline phosphatase (ALP)-loaded sandwich immunoassay was used to generate the signal reporter ascorbic acid (AA) in a 96-well plate, and myoglobin (Myo) was used as a model protein. In the presence of AA, ferrocene (Fc), and Tris (2-carboxyethyl) phosphine (TCEP), the chemical-chemical redox cycling scheme was operated upon the initial oxidation of Fc by the holes in the Bi2S3/BiPO4 photoelectrode, and Fc was regenerated from Fc+ by AA. Subsequently, AA was regenerated by TCEP after its oxidation, and cycling was triggered. As a result, the proposed self-powered PEC sensing exhibited excellent performance with a wide linear range from 5.0 × 10-13 to 1.0 × 10-7 g/mL, and a low detection limit of 2.0 × 10-13 g/mL for Myo. This work provided a new design of a redox cycling strategy in the self-powered PEC biosensor, and showed an effective approach for the clinical diagnosis.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Electrodos , Inmunoensayo , Límite de Detección , Oxidación-ReducciónRESUMEN
Herein, a novel and facile dual-wavelength ratiometric electrochemiluminescence-resonance energy transfer (ECL-RET) sensor for hydrogen sulfide (H2S) detection was constructed based on the interaction between S2- and Cd2+-doped g-C3N4 nanosheets (NSs). Cd2+-doped g-C3N4 NSs exhibited a strong ECL emission at 435 nm. In the presence of H2S, CdS was formed in situ on g-C3N4 NSs by the adsorption of S2- and Cd2+, generating another ECL emission at 515 nm. Furthermore, the overlapping of the absorption spectrum of the formed CdS and the ECL emission spectrum of g-C3N4 NSs led to a feasible RET, thus quenching the ECL intensity from g-C3N4 at 435 nm. Through an ECL decrease at 435 nm and an increase at 515 nm, a dual-wavelength ratiometric ECL-RET system for H2S was designed. The sensor exhibited a lower detection limit of 0.02 µM with a wide linear range of 0.05-100.0 µM. In addition, the applicability of the method was validated by plasma sample analysis with a linear range of 80.0-106.0%. We believe that such a proposal would provide new insight into advanced dual-wavelength ECL ratiometric assays.
Asunto(s)
Técnicas Biosensibles , Sulfuro de Hidrógeno , Cadmio , Técnicas Electroquímicas , Límite de Detección , Mediciones LuminiscentesRESUMEN
To achieve high sensitivity for biomolecule detection in photoelectrochemical (PEC) bioanalysis, the ideal photoelectrode and ingenious signaling mechanism play crucial roles. Herein, the feasibility of the photogenerated hole-induced chemical-chemical redox cycling amplification strategy on a Z-scheme heterostructure photoelectrode was validated, and the strategy toward enhanced multiple signal amplification for advanced PEC immunoassay application was developed. Specifically, a direct Z-scheme Bi2S3/Bi2MoO6 heterostructure was synthesized via a classic hydrothermal method and served as a photoelectrode for the signal response. Under the illumination, the PEC chemical-chemical redox cycling (PECCC) among 4-aminophenol generated by the enzymatic catalysis from a sandwich immunoassay, ferrocene as a mediator, and tris (2-carboxyethyl) phosphine as a reducing agent was run on the Z-scheme Bi2S3/Bi2MoO6 heterostructure photoelectrode. Exemplified by interleukin-6 (IL-6) as the target, the applicability of the strategy was studied in a PEC immunoassay. Thanks to the multiple signal amplification originating from the high efficiency of the PECCC redox cycling system, the enzymatic amplification, and the fine performance of the Z-scheme Bi2S3/Bi2MoO6 heterostructure photoelectrode, the assay for IL-6 exhibits a very low detection limit of 2.0 × 10-14 g/mL with a linear range from 5.0 × 10-14 to 1.0 × 10-8 g/mL. This work first validates the feasibility of the PECCC redox cycling on the Z-scheme heterostructure photoelectrode and the good performance of the strategy in PEC bioanalysis. We envision that it would provide a new prospective for highly sensitive PEC bioanalysis on the basis of a Z-scheme heterostructure.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Bismuto , Inmunoensayo , Límite de Detección , Molibdeno , Oxidación-Reducción , Estudios ProspectivosRESUMEN
Photoelectrochemical (PEC) immunoassay is a burgeoning and promising bioanalytical method. However, the practical application of PEC still exist some challenges such as the inevitable damage of biomolecules caused by the PEC system and the unsatisfactory sensitivity for biomarkers with low abundance in real sample. To solve the problems, we integrated the cosensitized structure of Ag2S/ZnO nanocomposities as photoelectrode with photogenerated hole-induced chemical redox cycling amplification (CRCA) strategy to develop a split-type PEC immunosensor for cardiac troponin I (cTnI) with high sensitivity. Initially, the immunoreaction was carried out on the 96-well plates in which alkaline phosphatase (ALP) could catalyze ascorbic acid 2-phosphate (AAP) to generate the signal-reporting species ascorbic acid (AA). Subsequently, the AA participated and the tris (2-carboxyethyl) phosphine (TCEP) mediated chemical redox cycling reaction took place on the photoelectrode, thus leading to signal amplification. Under the optimized conditions, the immunosensor demonstrated a detection limit (LOD) of 3.0 × 10-15 g mL-1 with a detection range of 1.0 × 10-14 g mL-1 to 1.0 × 10-9 g mL-1 for cTnI. Impressively, the proposed method could determine the cTnI in human serum samples with high sensitivity and satisfactory accuracy. Considering the virtues of the photoelectrode and the chemical redox cycling strategy, the method would hold great potential for highly sensitive biosensing and bioanalysis.
Asunto(s)
Técnicas Biosensibles , Troponina I , Fosfatasa Alcalina/metabolismo , Técnicas Electroquímicas , Humanos , Inmunoensayo , Límite de Detección , Oxidación-ReducciónRESUMEN
Developing an efficient signal amplification strategy is very important to improve the sensitivity of bioanalysis. In this paper, a liposome-assisted enzyme catalysis signal amplification strategy was developed for electrochemiluminescence (ECL) immunoassay of prostate specific antigen (PSA) in a split-type mode. The sandwich immunoreaction occurred in a 96-well plate, and glucose oxidase (GOx) encapsulated and antibody-modified liposomes were used as labels. The ECL detection was carried out using a rGO-Au NP modified glassy carbon electrode (GCE). The large amount of generated H2O2, i.e. the coreactant of the luminol system, and the excellent catalytic behavior of rGO-Au NPs greatly boosted the ECL signal, resulting in the signal amplification. The developed ECL immunosensor for detecting PSA achieved a wider linear range from 1.0 × 10-13 to 1.0 × 10-8 g mL-1 and a detection limit of 1.7 × 10-14 g mL-1. The application of the proposed strategy was demonstrated by analyzing PSA in human serum samples with recoveries from 89.0% to 113.0%, and relative standard deviations (RSDs) were less than 6.6%. This work provides a new horizon to expand the application of liposomes for ECL bioanalysis.