Vibrational spectra and ab initio molecular orbital calculations of the novel anti-cancer drug combretastatin A-4 prodrug.

The NIR-FT Raman and FT-IR spectral studies of the novel antineoplastic and antiangiogenesis substance comprestatin A-4 prodrug (CA4P) were carried out. The equilibrium geometry, various bonding features and harmonic vibrational frequencies of CA4P have been investigated with the help of B3LYP density functional theory (DFT) method. The most preferred cis-configuration for its bioactivity has been demonstrated on the basis of torsional potential energy surface (PES) scan studies. Stability of the molecule arising from hyperconjugative interactions leading to its bioactivity, charge delocalization and mesomeric effects have been analyzed using natural bond orbital (NBO) analysis. Detailed assignments of the vibrational spectra have been made with the aid of theoretically predicted vibrational frequencies. The optimized geometry shows near-planarity of phenyl rings and perpendicular conformation of meta substituted methoxy group. The vibrational analysis confirms the differently acting ring modes, steric repulsion, pi conjugation and back-donation.

Vibrational spectroscopic studies on the natural product, columbianadin.

NIR-FT Raman and FT-IR spectra of columbianadin, extracted from seeds and roots of Heracleum candolleaum, were recorded and analyzed. The vibrational frequencies of the compound have been computed using semi-empirical AM1 method and compared with experimental values. The C=O stretching frequencies of the carbonyl groups have been lowered due to conjugation. The CH stretching and bending vibrations of CH3 groups of the ester part indicate the presence of hyperconjugation effect. Characteristic ring vibrations have also been identified.

Water and protein structure in photoaged and chronically aged skin.

Changes in the structural proteins and hydration during aging is responsible for altered skin morphologic and mechanical properties manifested as wrinkling, sagging, loss of elasticity, or apparent dryness. To gain insight into the age-related alterations in protein conformation and water structure, we obtained Raman spectra from the sun-protected buttock skin representing chronologic aging and the sun-exposed forearm skin representing combined effects of photoaging and chronologic aging. Ten aged individuals (five men, five women; age range 74-87) and 10 control young individuals (five men, five women; age range 22-29) entered the study. In the photoaged forearm skin the positions of protein-specific amide I, amide III, and CH stretching bands were shifted, suggesting increased protein folding. In contrast, major changes were seen only in the amide I peak in chronologically aged skin. The intensity of the 3250 cm(-1) OH stretching band was increased in photoaged skin (but not in chronologically aged skin) indicating an increased water content. R(v) representation of the low-frequency region of Raman spectra was applied to determine water structure. In the young skin and chronologically aged skin water was mostly present in the bound form. In the photoaged skin, however, an increase in intensity at 180 cm(-1) was noted, which reflects an increase in the not-protein bound water (tetrahedron water clusters). In conclusion, it seems that proteins in the photoaged skin are more compact and interact with water to limited degree. Impairment in protein hydration may add to the understanding of ultrastructural, mechanical, and biochemical changes in structural proteins in the aged skin.

Characterization of DNA topoisomerase II alpha/beta heterodimers in HeLa cells.

In mammalian cells, DNA topoisomerase II is the product of two distinct genes encoding the alpha and beta isoforms of the enzyme. Besides homodimeric topoisomerase IIalpha and IIbeta, we have recently shown that alpha/beta heterodimers constitute a third population of topoisomerase II in HeLa cells. We found that topoisomerase II heterodimers are not restricted to HeLa cells but exist in different mammalian cell types, and up to 25% of the total topoisomerase IIbeta population is involved in heterodimer formation. Studies of topoisomerase II phosphorylation in HeLa cells show that heterodimers are phosphorylated in vivo to a significantly lower level compared to homodimeric alpha enzymes, but in contrast to the latter neither heterodimers nor topoisomerase IIbeta homodimers coprecipitate together with a kinase activity that is able to mediate their phosphorylation. However, both enzymes can still be phosphorylated by exogenously added casein kinase II. The differential phosphorylation of topoisomerase II heterodimers suggests an alternative regulation of this topoisomerase II subclass compared to the homodimeric topoisomerase IIalpha counterparts.

Distinctive molecular abnormalities in benign and malignant skin lesions: studies by Raman spectroscopy.

Near-infrared Fourier transform Raman spectroscopy is an analytical, nondestructive technique that provides information about the molecular structure of the investigated sample. The molecular structure of proteins and lipids differ between neoplastic and normal tissues and therefore Raman spectroscopy has been considered promising for the diagnosis of cancer. We aimed to compare the molecular structure of normal skin, benign and malignant skin lesions by the near-infrared Fourier transform Raman spectroscopy. Biopsies were obtained from the following skin lesions: skin tag, dermatofibroma, seborrhoeic keratosis, actinic keratosis, keratoacanthoma, basal cell carcinoma, squamous cell carcinoma, nevus intradermalis, nevus compositus, dysplastic nevus and lentigo maligna. Control skin was harvested from the vicinity of these lesions. In the Raman spectra, the secondary structure of the proteins was reflected by the amide vibrations of peptide bonds. The principal lipid vibrations were twisting and wagging (CH2) and CH stretching vibrations. Histologically distinguishable lesions showed specific combinations of band changes indicating alterations in the protein conformation and in the molecular structure of the lipids. Histogenetically related lesions (actinic keratosis and sqamous cell carcinoma) produced similar but not identical patterns of spectral changes. Because the examined skin lesions produced reproducible and unique spectra, we suggest that Raman spectroscopy will be useful for diagnosis of skin lesions.

Long-range fragmentation of the eukaryotic genome by exogenous and endogenous nucleases proceeds in a specific fashion via preferential DNA cleavage at matrix attachment sites.

Small cell lung cancer cells (OC-NYH-VM) were permeabilized and treated with different nucleases. The long-range distribution of DNA cleavage sites in the amplified c-myc gene locus was then analyzed by pulsed field gel electrophoretic separation of the released 50-kilobase to 1-megabase DNA fragments followed by indirect end labeling. Exogenous DNase I and nucleases specific for the single-stranded DNA were found to generate similar nonrandom patterns of large DNA fragments. The cleavage sites were located close to or even colocalized with matrix attachment regions, which were mapped independently using a recently developed procedure for DNA loop excision by DNA topoisomerase II-mediated DNA cleavage. Endogenous acidic nuclease with the properties of DNase II also digested DNA preferentially in proximity to the matrix attachment regions, generating characteristic patterns of excised DNA loops and their oligomers. A similar, although less specific, pattern of DNA fragmentation was observed after incubation of permeabilized cells under conditions favoring the activity of endogenous neutral Ca(2+)- and Mg(2+)-dependent nucleases. These findings are discussed in the context of the current model of the spatial domain organization of eukaryotic genome.

Antagonistic effect of aclarubicin on camptothecin induced cytotoxicity: role of topoisomerase I.

The cellular target of camptothecin and several of its derivatives has been identified as topoisomerase I. Central to the cytotoxic action of camptothecin is the drug's ability to stimulate formation of topoisomerase I mediated DNA cleavages. Here we demonstrate that the intercalating antitumor agent aclarubicin inhibits camptothecin induced DNA single strand breaks in cells as measured by alkaline elution. When purified topoisomerase I was reacted with DNA, aclarubicin inhibited the formation of enzyme mediated DNA breaks induced by camptothecin. High aclarubicin concentrations (10 and 100 microM) caused a slight stimulation of topoisomerase I mediated DNA cleavage at a few distinct DNA sites. The cytotoxicity associated with camptothecin treatment measured in clonogenic assays was antagonized by preincubation with aclarubicin. This inhibitory effect of aclarubicin upon camptothecin action holds implications for the scheduling of aclarubicin in combination therapy with anticancer agents directed against topoisomerase I. Aclarubicin also inhibits the effect of topoisomerase II directed agents [such as etoposide (VP16), amsacrine (mAMSA), etc.] suggesting that aclarubicin acts against the two topoisomerases.

Comparison of the effects of methoxysuccinyl-Ala-Ala-Pro-Val-chloromethyl ketone-inhibited neutrophil elastase with the effects of its naturally occurring mutationally inactivated homologue (HBP) on fibroblasts and monocytes in vitro.

The mature neutrophils in the circulation contain, besides the different proteases known for a long time, a recently discovered proteolytically inactive elastase homologue (HBP/CAP37/azurocidin). This homologue, which we have named HBP due to its strong affinity to heparin, is a chemoattractant for monocytes and has been shown to induce reversible detachment and contraction when added to monolayers of endothelial cells or fibroblasts. HBP may therefore play a pivotal role in leukocyte migration in response to inflammation. In this report a comparison of CH3O-Suc-Ala-Ala-Pro-Val-CH2Cl-inhibited elastase with HBP, its naturally occurring homologue selectively mutated in active serine and histidine, reveals that homotypic aggregation of monocytes and contraction of fibroblasts is specific for HBP. HBP induces thrombospondin secretion from monocytes four times as efficiently as the inhibited elastase, and the same molecule was found unable to compete for a specific saturable binding of HBP to monocytes with an apparent KD of 3 x 10(-8)M.

[Are health and disease equally distributed among children?]. / Er børns sundhed og sygdom ligeligt fordelt?

Living conditions for children and young people are of great interest. In previous investigations, differences in sickness among social groups have been found. WHO plans to reduce differences in health conditions among groups within the countries by at least 25%. In this article, attention is drawn to inequalities in health among children in Denmark. Parameters such as the risk of stillbirth, congenital malformations and death during the first year of life do not differ between social groups. Where the less harsh data are concerned, inequalities still exist between social groups, also among Danish children. In relation to the goals set by WHO, it is important to be aware that the existing ways of measurement may not be sufficient.

[Social and health inequality in an area of community housing in Odense]. / Sociale og sundhedsmaessige uligheder i et område med almennyttigt boligbyggeri i Odense.

This investigation is a cross-sectional investigation based on the registers available which describe the conditions of health in children born in 1978 and resident in 1987 in two different social districts, one of which was socially, stressed while the other was slightly less stressed. The vaccination coverage was found to be lower in the socially stressed district and lower among immigrant children. More unvaccinated children were observed among children of mothers who received public assistance and of single parents. Hospital admissions on account of diagnoses due to infection were thrice as frequent from the socially stressed district. As regards height, weight and psychomotor status, no differences were observed between the districts. The investigation indicates that social inequalities cause health inequalities and that, in particular, there appears to be a need for health-promoting efforts where the socially stressed environments are concerned e.g. immigrant families.

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.

Preferential relaxation of supercoiled DNA containing a hexadecameric recognition sequence for topoisomerase I.

In prokaryotes, the degree of supercoiling of DNA can profoundly influence the use of specific promoters. In eukaryotes, a variety of indirect observations suggest that DNA topology has a similar importance in proper gene expression. Much attention has therefore been focused on the cellular proteins that control DNA supercoiling, among which are the enzymes topoisomerase I and II. A hexadecameric sequence functions as a strong attraction site for topoisomerase I. Here we report that the interaction of topoisomerase I with this sequence motif is highly specific, because a single base-pair substitution prevents strand cleavage and thereby catalytic activity at the sequence. Thus, supercoiled DNA containing the recognition sequence is relaxed preferentially by topoisomerase I compared to a control, but no difference in the relaxation rate is observed for supercoiled DNA carrying the mutated sequence. The preference for the recognition sequence seems to be an intrinsic property of all eukaryotic type I topoisomerases, suggesting that the interaction might be important in a fundamental biological process.

Purification and characterization of an inducible mitochondrial DNA polymerase from Tetrahymena thermophila.

Treatment of the eukaryotic organism Tetrahymena with various types of DNA-damaging agents has been reported to cause a 35-fold induction of a mitochondrial DNA polymerase. We here report that the enzyme can be induced in large-scale cultures by exposure of the cells to thymine starvation and/or intercalating agents. The induced DNA polymerase has been purified to near homogeneity, with a specific activity of approx. 300,000 units/mg protein. The relative molecular mass of the active form of the enzyme is approx. 100,000, as determined by glycerol gradient sedimentation. The subunit structure has been analysed by SDS polyacrylamide gel electrophoresis of the highly purified preparation and by immunoprecipitation with a monoclonal antibody directed to the DNA polymerase. A polypeptide of Mr 47,000 has been observed to be a subunit of the enzyme. This corresponds to the size of the subunits suggested for mitochondrial DNA polymerase from chicken embryos and mouse myeloma cells.

Topoisomerase I has a strong binding preference for a conserved hexadecameric sequence in the promoter region of the rRNA gene from Tetrahymena pyriformis.

Topoisomerase I is in situ associated with DNaseI hypersensitive sites located in the promotor and terminator regions of the extrachromosomal rDNA in Tetrahymena thermophila at sites with sequences fitting the motif (sequence in text) Reconstitution experiments with purified topoisomerase I and cloned fragments of rDNA demonstrate that the enzyme exhibits the same binding and cleavage properties on naked DNA. These observations are striking as topoisomerase I previously has been found to exhibit low sequence specificity. The specific binding of the enzyme has an absolute requirement for divalent cations with a preference for Ca2+. The strong binding to the hexadecamer has been characterized by competition experiments, and it has been used to determine the molecular weight of the enzyme.

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule.

An electron microscopic analysis of transcription of nucleolar chromatin isolated from Tetrahymena pyriformis.

Transcriptionally active nucleoli and solubilized nucleolar chromatin were visualized by electron microscopy. The palindromic structure of the chromatin was demonstrated by spreading the chromatin on glow-discharged grids. In the presence of single-strand binding EcoHDP protein the preribosomal RNA transcripts are seen attached to the RNA-polymerase molecules in the electron micrographs. Each palindrome contains two preribosomal RNA genes. THe strict termination properties of the transcription are indicated by the absence of transcriptional complexes in the distal parts of the molecules. - Investigation of the process of transcription in nucleolar chromatin being depleted of a termination protein by ammonium sulfate-treatment showed in agreement with biochemical studies that only some of the RNA polymerases terminate properly while other transcribe into the distal spacer region. The elongation rate is estimated to be slightly lower than in the gene region. The results are discussed in relation to biochemical studies of the transcriptional properties of the chromatin.

In vitro splicing of the ribosomal RNA precursor in isolated nucleoli from Tetrahymena.

The macronuclear rRNA genes of Tetrahymena thermophila contain an 0.4 kb intervening sequence in the 26S rRNA coding region. The sequence is represented within the primary transcription product. We demonstrate in this paper that the enzyme activities necessary for the endonucleolytic cleavage as well as for the ligation of the transcript are associated with the isolated. The intervening sequence is excised as an unique molecule, which is stable in vitro. About 50% of the in vitro synthesized RNA is processed. Faithful in vitro transcription occurs in the presence of the divalent ions Mg2+, Mn2+ and Co2+ while processing takes place only in the presence of Mg2+. The absolute requirement for Mg2+ in the excision reaction enables us to synthesize labelled pre-rRNA in the presence of Mn2+ or Co2+. The synthesized RNA can be used as a substrate in studies of th processing enzymes in vitro.

Effect of lucanthone (miracil D) on transcription of ribosomal RNA genes from Tetrahymena in vivo and in vitro.

Addition of lucanthone (1-5 mug/ml) to cultures of Tetrahymena results in a preferential inhibition of the synthesis of ribosomal RNA. Transcriptional studies with isolated nucleoli from Tetrahymena demonstrate that the endogenous RNA polymerases of the r-chromatin (chromatin form of rDNA) do not recognize the normal termination and move into the spacer region distal to the terminator in the presence of lucanthone. This is shown by hybridization of the transcript synthesized in the presence of the drug to restriction fragments of rDNA. Lucanthone seems specific in its action on termination as it does not inhibit the elongation process on the chromatin. Among various DNA-binding drugs tested only lucanthone and proflavine are found to cause repression of the termination. The data obtained suggest that the reduced synthesis of rRNA in lucanthone-treated eukaryotic cells is due to lack of reinitiating RNA polymerases possibly caused by improper termination.