RESUMEN
Aging is the main cause of many degenerative diseases. The skin is the largest and the most intuitive organ that reflects the aging of the body. Under the interaction of endogenous and exogenous factors, there are cumulative changes in the structure, function, and appearance of the skin, which are characterized by decreased synthesis of collagen and elastin, increased wrinkles, relaxation, pigmentation, and other aging characteristics. skin aging is inevitable, but it can be delayed. The successful isolation of mesenchymal stromal cells (MSC) in 1991 has greatly promoted the progress of cell therapy in human diseases. The International Society for Cellular Therapy (ISCT) points out that the MSC is a kind of pluripotent progenitor cells that have self-renewal ability (limited) in vitro and the potential for mesenchymal cell differentiation. This review mainly introduces the role of perinatal umbilical cord-derived MSC(UC-MSC) in the field of skin rejuvenation. An in-depth and systematic understanding of the mechanism of UC-MSCs against skin aging is of great significance for the early realization of the clinical transformation of UC-MSCs. This paper summarized the characteristics of skin aging and summarized the mechanism of UC-MSCs in skin rejuvenation reported in recent years. In order to provide a reference for further research of UC-MSCs to delay skin aging.
RESUMEN
BACKGROUND: Reduced numbers and dysfunction of thymic epithelial cells (TECs) are important factors of thymic degeneration. Previous studies have found that umbilical cord mesenchymal stem cells (UCMSCs) reverse the structure and function of the senescent thymus in vivo. However, the transcriptomic regulation mechanism is unclear. METHODS: TECs were cultured with H2O2 for 72 hours to induce senescence. UCMSCs were cocultured with senescent TECs for 48 hours to detect SA-ß-gal, P16 and Ki67. The cocultured TECs were collected for lncRNA, mRNA and miRNA sequencing to establish a competitive endogenous regulatory network (ceRNA). And RT-qPCR, immunofluorescence staining, and western blot were used to identified key genes. RESULTS: Our results showed that H2O2 induced TEC aging and that UCMSCs reversed these changes. Compared with those in aged TECs, 2260 DE mRNAs, 1033 DE lncRNAs and 67 DE miRNAs were differentially expressed, and these changes were reversed by coculturing the cells with UCMSCs. Differential mRNA enrichment analysis of ceRNA regulation revealed that the PI3K-AKT pathway was a significant signaling pathway. UCMSC coculture upregulated VEGFA, which is the upstream factor of the PI3K-AKT signaling pathway, and the expression of the key proteins PI3K and AKT. Thus, the expression of the cell cycle suppressor P27, which is downstream of the PI3K-AKT signaling pathway, was downregulated, while the expression of the cell cycle regulators CDK2 and CCNE was upregulated. CONCLUSION: UCMSC coculture upregulated the expression of VEGFA, activated the PI3K-AKT signaling pathway, increased the expression of CDK2 and CCNE, decreased the expression of P27, and promoted the proliferation of TECs.
Asunto(s)
Senescencia Celular , Técnicas de Cocultivo , Células Epiteliales , Perfilación de la Expresión Génica , Células Madre Mesenquimatosas , MicroARNs , Proteínas Oncogénicas , Timo , Cordón Umbilical , Células Madre Mesenquimatosas/metabolismo , Humanos , Células Epiteliales/metabolismo , Cordón Umbilical/citología , Timo/citología , Timo/metabolismo , MicroARNs/metabolismo , MicroARNs/genética , Quinasa 2 Dependiente de la Ciclina/metabolismo , Quinasa 2 Dependiente de la Ciclina/genética , Ciclina E/metabolismo , Ciclina E/genética , Biomarcadores/metabolismo , Peróxido de Hidrógeno/toxicidad , Peróxido de Hidrógeno/farmacología , Transducción de Señal , Factor A de Crecimiento Endotelial Vascular/metabolismo , Factor A de Crecimiento Endotelial Vascular/genética , Fosfatidilinositol 3-Quinasas/metabolismo , Células Cultivadas , Proteínas Proto-Oncogénicas c-akt/metabolismo , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Transcriptoma , Inhibidor p27 de las Quinasas Dependientes de la Ciclina/metabolismo , Inhibidor p27 de las Quinasas Dependientes de la Ciclina/genéticaRESUMEN
Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.
Asunto(s)
Enfermedades Autoinmunes , Exosomas , Células Madre , Humanos , Exosomas/metabolismo , Enfermedades Autoinmunes/terapia , Enfermedades Autoinmunes/inmunología , Células Madre/metabolismo , Animales , Trasplante de Células Madre/métodos , Diferenciación CelularRESUMEN
BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.
Asunto(s)
Células Madre Mesenquimatosas , Ovario , Femenino , Animales , Macaca mulatta , Peróxido de Hidrógeno , EnvejecimientoRESUMEN
With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.
RESUMEN
tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.
Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón UmbilicalRESUMEN
Senile thymus atrophy is an important factor leading to decreased immune function. Repairing the atrophic thymus tissue structure, rebuilding immune function, and replenishing the number of exogenous stem cells may be ideal methods. In this study, bone marrow mesenchymal stem cells were intravenously infused into elderly macaques. We found that thymus volume was substantially increased, some thymus tissue regeneration was observed, the degree of thymus tissue fibrosis decreased, collagen fiber deposition decreased, cortical and medulla structures emerged gradually, the number of apoptotic cells decreased significantly, and the expression of apoptosis-related proteins decreased. For the effects of stem cell therapy on aging-related genes, we performed transcriptomic analysis of thymus tissue. The results show the expression pattern of the tissue transcriptome tended to be similar to the thymus expression pattern in young macaques compared with the elderly group, reverse aging-related proteins. Based on the results, it is suggested that stem cell therapy is an ideal method to prevent or reverse the aging of the thymus.
Asunto(s)
Células Madre Mesenquimatosas , Rejuvenecimiento , Animales , Macaca , Timo , ColágenoRESUMEN
Background: The relationship between mortality and seizures after intracerebral hemorrhage (ICH) has not yet been understood until now. A meta-analysis was performed to assess the effect of post-ICH seizures on mortality among patients with ICH. Methods: PubMed and Embase were searched from the establishment of the databases to December 2021 to identify literature that evaluated the relationship between post-ICH seizures and mortality in ICH. Crude odds ratios and adjusted odds ratios with a 95% confidence interval (CI) were pooled using a random-effects model. Results: Thirteen studies involving 245,908 participants were eventually included for analysis. The pooled estimate suggested that post-ICH seizures were not associated with significantly increased mortality in patients with ICH (crude odds ratios 1.35, 95% CI: 0.91-2; adjusted adds ratios 1.22, 95% CI: 0.78-1.88). However, the relationship was not consistent in subgroup analysis or robust in a sensitivity analysis. Conclusions: This meta-analysis proved that post-ICH seizures were not associated with significantly increased mortality in patients with ICH. However, this result could be influenced by confounding factors, so more high-quality research is needed.
RESUMEN
BACKGROUND: The tumorigenesis of infused umbilical cord mesenchymal stem cells (UC-MSCs) is being preclinically evaluated. METHODS: We observed tumor formation in NOD SCID mice after a single subcutaneous injection of hUC-MSCs and the effect of these cells on tumor growth in tumor-bearing mice. Three generations (P5, P7, and P10) of hUC-MSCs (1 × 107) from two donors (hUC-MSC1 and hUC-MSC2) were inoculated subcutaneously into NOD SCID mice. Subcutaneous transplantation models were established in NOD SCID mice with human cervical cancer HeLa cells (solid tumor) and human B cell lymphoma Raji cells (hematological tumor). Then, the animals were euthanized, gross dissection was performed, and tissues were collected. Various organs were observed microscopically to identify pathological changes and tumor metastasis. RESULTS: In the tumorigenesis experiment, no general anatomical abnormalities were observed. In the tumor promotion experiment, some animals in the HeLa groups experienced tumor rupture, and one animal died in each of the low- and medium-dose hUC-MSC groups. The results may have occurred due to the longer feeding time, and the tumor may have caused spontaneous infection and death. Pathological examination revealed no metastasis to distant organs in any group. In the Raji tumor model, some animals in each group experienced tumor rupture, and one animal in the medium-dose hUC-MSC group died, perhaps due to increased tumor malignancy. Thus, hUC-MSCs neither promoted nor inhibited tumor growth. No cancer cell metastasis was observed in the heart, liver, spleen, lungs, kidneys or other important organs, except that pulmonary venule metastasis was observed in 1 animal in the model group. CONCLUSIONS: Injected hUC-MSCs were not tumorigenic and did not significantly promote or inhibit solid or hematological tumor growth or metastasis in NOD SCID mice.
Asunto(s)
Carcinogénesis/patología , Células Madre Mesenquimatosas/fisiología , Cordón Umbilical/citología , Animales , Femenino , Células HeLa , Humanos , Linfoma de Células B/patología , Masculino , Ratones Endogámicos NOD , Ratones SCID , Modelos Animales , Metástasis de la Neoplasia , Células Tumorales CultivadasRESUMEN
BACKGROUND: The ovaries are the core reproductive organs in women and are critical for maintaining normal reproductive function and endocrine system stability. An ageing C57 mouse model was used to evaluate the efficacy and mechanism of mouse umbilical cord mesenchymal stem cells (mUCMSCs) and to explore the mechanism by which mUCMSCs promote the antioxidant repair of mouse granulosa cells (mGCs). RESULTS: Eighteen-month-old C57 mice were randomly divided into a model group and a treatment group. At the same time, 2-month-old C57 mice were established as a young group (15 mice per group). The mice in the treatment group were injected via the tail vein with GFP-labelled mUCMSCs. The ovarian volume in ageing C57 mice was decreased, and there were no follicles at any stage. After mUCMSC transplantation, the mouse ovaries increased in size, follicles at various stages were observed in the cortex, and the antral follicle counts increased. The serum E2, AMH, and INH-B levels of mice in the treatment group were significantly higher than those of mice in the model control group (P < 0.05). mUCMSCs downregulated the expression of the autophagy-related gene LC3b and the apoptosis-related genes Bax and Caspase-3, upregulated the expression of SOD2 and the peroxidase gene PRDX IV, and reduced apoptosis rates and reactive oxygen species (ROS) levels in granulosa cells. CONCLUSIONS: mUCMSCs play roles in promoting the repair of ageing ovaries by regulating immunity, anti-inflammatory responses and the PI3K-Akt signalling pathway.
Asunto(s)
Ovario/anatomía & histología , Animales , Femenino , Ratones , Modelos AnimalesRESUMEN
Based on the characteristics of modern weapon injury, a repetitive model of traumatic systemic inflammatory response syndrome (SIRS) and an evaluation system were established. The models were treated with GFP-labeled tree shrew umbilical cord mesenchymal stem cells (UCMSCs). Forty out of 50 tree shrews were used to make a unilateral femoral comminuted fracture. Lipopolysaccharide was injected intravenously to create a traumatic SIRS model. The other 10 shrews were used as normal controls. After the model was established for 10 days, 20 tree shrews were injected intravenously with GFP-labeled UCMSCs, and 18 tree shrews were not injected as the model control group. The distribution of GFP-labeled cells in vivo was measured at 2 and 10 days after injection. Twenty days after treatment, the model group, the normal control group, and the treatment group were taken to observe the pathological changes in each tissue, and blood samples were taken for the changes in liver, renal, and heart function. Distribution of GFP-positive cells was observed in all tissues at 2 and 10 days after injection. After treatment, the HE staining results of the treatment group were close to those of the normal group, and the model group had a certain degree of lesions. The results of liver, renal, and heart function tests in the treatment group were returned to normal, and the results in the model group were abnormally increased. UCMSCs have a certain effect on the treatment of traumatic SIRS and provide a new technical solution for modern weapon trauma treatment.
Asunto(s)
Trasplante de Células Madre Mesenquimatosas , Células Madre Mesenquimatosas , Humanos , Riñón , Síndrome de Respuesta Inflamatoria Sistémica/terapia , Cordón UmbilicalRESUMEN
BACKGROUND: Age-associated lung tissue degeneration is a risk factor for lung injury and exacerbated lung disease. It is also the main risk factor for chronic lung diseases (such as COPD, idiopathic pulmonary fibrosis, cancer, among others). So, it is particularly important to find new anti-aging treatments. METHODS: We systematically screened and evaluated elderly senile multiple organ dysfunction macaque models to determine whether BMMSCs inhibited lung tissue degeneration. RESULTS: The average alveolar area, mean linear intercept (MLI), and fibrosis area in the elderly macaque models were significantly larger than in young rhesus monkeys (p < 0.05), while the capillary density around the alveoli was significantly low than in young macaque models (p < 0.05). Intravenous infusion of BMMSCs reduced the degree of pulmonary fibrosis, increased the density of capillaries around the alveoli (p < 0.05), and the number of type II alveolar epithelium in elderly macaques (p < 0.05). In addition, the infusion reduced lung tissue ROS levels, systemic and lung tissue inflammatory levels, and Treg cell ratio in elderly macaque models (p < 0.05). Indirect co-cultivation revealed that BMMSCs suppressed the expression of senescence-associated genes, ROS levels, apoptosis rate of aging type II alveolar epithelial cells (A549 cells), and enhanced their proliferation (p < 0.05). CONCLUSIONS: BMMSC treatment inhibited age-associated lung tissue degeneration.
Asunto(s)
Fibrosis Pulmonar Idiopática , Células Madre Mesenquimatosas , Animales , Fibrosis Pulmonar Idiopática/genética , Fibrosis Pulmonar Idiopática/terapia , Pulmón , Macaca , Alveolos PulmonaresRESUMEN
ABSTRACT: Studies on the relationship between hospital annualized case volume and in-hospital mortality in patients with subarachnoid hemorrhage (SAH) have shown conflicting results. Therefore, we performed a meta-analysis to further examine this relationship.The authors searched the PubMed and Embase databases from inception through July 2020 to identify studies that assessed the relationship between hospital annualized SAH case volume and in-hospital SAH mortality. Studies that reported in-hospital mortality in SAH patients and an adjusted odds ratio (OR) comparing mortality between low-volume and high-volume hospitals or provided core data to calculate an adjusted OR were eligible for inclusion. No language or human subject restrictions were imposed.Five retrospective cohort studies with 46,186 patients were included for analysis. The pooled estimate revealed an inverse relationship between annualized case volume and in-hospital mortality (OR, 0.53; 95% confidence interval, 0.42-0.68, Pâ<â.0001). This relationship was consistent in almost all subgroup analyses and was robust in sensitivity analyses.This meta-analysis confirms an inverse relationship between hospital annualized SAH case volume and in-hospital SAH mortality. Higher annualized case volume was associated with lower in-hospital mortality.
Asunto(s)
Hospitales de Alto Volumen/estadística & datos numéricos , Hemorragia Subaracnoidea/mortalidad , Mortalidad Hospitalaria , Humanos , Oportunidad Relativa , Estudios RetrospectivosRESUMEN
Ischemia-reperfusion injury is an important contributor to acute kidney injury and a major factor affecting early functional recovery after kidney transplantation. We conducted this experiment to investigate the protective effect of induced multipotent stem cell transplantation on renal ischemia-reperfusion injury. Forty rabbits were divided into four groups of 10 rabbits each. Thirty rabbits were used to establish the renal ischemia-reperfusion injury model, and ten rabbits served as the model group and were not treated. Among the 30 rabbits with renal ischemia-reperfusion injury, 10 rabbits were treated with induced peripheral blood mononuclear cells (PBMCs), and 10 other rabbits were treated with noninduced PBMCs. After three weekly treatments, the serum creatinine levels, urea nitrogen levels and urine protein concentrations were quantified. The kidneys were stained with hematoxylin-eosin (HE), periodic acid-Schiff (PAS) and Masson's trichrome and then sent for commercial metabolomic testing. The kidneys of the rabbits in the model group showed different degrees of pathological changes, and the recovery of renal function was observed in the group treated with induced cells. The results indicate that PBMCs differentiate into multipotent stem cells after induction and exert a therapeutic effect on renal ischemia-reperfusion injury.
Asunto(s)
Clara de Huevo/química , Riñón/irrigación sanguínea , Leucocitos Mononucleares/trasplante , Daño por Reperfusión/terapia , Animales , Diferenciación Celular , Extractos Celulares/farmacología , Células Cultivadas , Leucocitos Mononucleares/citología , Leucocitos Mononucleares/efectos de los fármacos , Células Madre Pluripotentes/citología , ConejosRESUMEN
A model of allergic rhinitis (AR) in BALB/c mice was established and evaluated to provide experimental subjects for further research. Preparation of human umbilical cord mesenchymal stem cells (hUCMSCs), including isolation, expansion culture, passaging, cryopreservation, and preparation of cell suspensions, provided materials for experimental research and clinical treatment. The mouse AR model was established by ovalbumin (OVA) intraperitoneal injection and the nasal stimulation induction method, and the model had a good effect and high repeatability. GFP-labeled hUCMSCs had good effects and were stable cells that could be used for tracking in animals. Transplantation of hUCMSCs by intraperitoneal and tail vein injections had a specific effect on the AR model of mice, and tail vein injection had a better effect. Tracking of hUCMSCs in vivo showed that the three groups of mice had the greatest number of hUCMSCs in the nose at week 2. The mouse AR model was used to evaluate the efficacy of hUCMSC transplantation via multiple methods for AR. The distribution of hUCMSCs in vivo was tracked by detecting green fluorescent protein (GFP), and the treatment mechanism of hUCMSCs was elucidated. This study provides technical methods and a theoretical basis for the clinical application of hUCMSCs.
Asunto(s)
Trasplante de Células Madre de Sangre del Cordón Umbilical , Trasplante de Células Madre Mesenquimatosas , Células Madre Mesenquimatosas/citología , Rinitis Alérgica/terapia , Animales , Conducta Animal , Modelos Animales de Enfermedad , Femenino , Proteínas Fluorescentes Verdes/metabolismo , Humanos , Interferón gamma/metabolismo , Interleucina-10/metabolismo , Interleucina-4/metabolismo , Interleucina-6/metabolismo , Ratones , Ratones Endogámicos BALB C , Reacción en Cadena de la Polimerasa , Rinitis Alérgica/metabolismo , Cordón Umbilical/citologíaRESUMEN
BACKGROUND: To study the effect of allogeneic umbilical cord mesenchymal stem cell transplantation on the structure and function of the thymus in aged C57 mice and provide a new method for the treatment of senile thymic atrophy. RESULTS: The changes in the thymus cortex and medulla volume and the lymphocyte ratio were analyzed by immunofluorescence. For thymus tissue sections, immunohistochemical staining was performed to detect p16, p53, SOD, becline1, LC3b, p62, sirt1, and sirt3. Changes in CK5, CK8, CD4 and CD8 expression were observed. Treatment with mUCMSCs could promote hair regeneration in aging mice and regenerate the thymus structure. CONCLUSIONS: mUCMSCs inhibited senescence of the thymus and promoted structural and functional thymus regeneration by downregulating the senescence genes p53 and p16 and upregulating the SOD, Sirt1 and Sirt3 genes, but the mechanism requires further research. METHODS: C57 mice were obtained and met the requirements of thymic aging. mUCMSCs were infused via the tail vein at a dose of 1×107 cells/kg twice per week for 3 weeks. Six weeks after the last transplantation, the thymus was weighed, and the thymus-to-body weight ratio was calculated. The thymus tissue was stained with HE.
RESUMEN
Inflammatory bowel disease (IBD) is a persistent and chronic disease that is characterized by destructive gastrointestinal (GI) inflammation. Researchers are trying to identify and develop new and more effective treatments with no side effects. Acute and chronic mouse models of IBD were established using dextran sulfate sodium (DSS) solution. To evaluate the efficacy and mechanism, umbilical cord mesenchymal stem cells (UCMSCs) were obtained from Kunming (KM) mice and humans. In the chronic IBD study, the survival rates of the normal control, model, mouse UCMSC (mUCMSC) and human UCMSC (hUCMSC) groups were 100%, 40%, 86.7%, and 100%, respectively. The histopathological scores of the normal control, intraperitoneal injection, intravenous treatment, and model groups were 0.5 ± 0.30, 5.9 ± 1.10, 8.7 ± 1.39, and 8.8 ± 1.33 (p = 0.021). UCMSCs promoted the expression of the intestinal tight junction protein occludin, downregulated the protein expression of the autophagy marker LC3A/B in colon tissue, and upregulated the expression of VEGF-A and VEGFR-1 at the injured site. This study provides an experimental model for elucidating the therapeutic effects of UCMSCs in IBD. We provide a theoretical basis and method for the clinical treatment of IBD using UCMSCs.
Asunto(s)
Enfermedades Inflamatorias del Intestino/terapia , Células Madre Mesenquimatosas , Cordón Umbilical/citología , Animales , Células Cultivadas , Humanos , Trasplante de Células Madre Mesenquimatosas , Ratones , Ocludina/metabolismo , Uniones Estrechas/metabolismo , Regulación hacia Arriba , Factor A de Crecimiento Endotelial Vascular/metabolismo , Receptor 1 de Factores de Crecimiento Endotelial Vascular/metabolismoRESUMEN
MicroRNA-155 (miRNA-155) is a typical multifunctional miRNA, which serves a crucial role in the regulation of numerous vessel cells. However, its effects on dysfunctional endothelial cells have not been completely elucidated. In order to investigate the signaling pathway of miRNA-155-induced cell injury, H2O2 was used to establish an oxidative stress cell model, and miR-155 was transfected into H2O2-treated cells. The CCK8 assay was then employed to examine the effect of miR-155 on the cell proliferations of H2O2-treated cells, and the expressions of Microtubule Associated Protein 1 Light Chain 3 (LC3) and Sequestosome 1 (P62) were detected to examine the effect of miR-155 on the autophagy of Human umbilical vein endothelial cells, and then the formation of intracellular autophagosomes was observed. The results indicated that endothelial cell proliferation was promoted, and oxidant-induced injury was decreased when the expression of miR-155 was inhibited. In addition, the results also demonstrated that when the miR-155 inhibitor was used, the expression of LC3 was increased and the expression of P62 was decreased. This suggests that modulated miR-155 can prevent oxidative damage in endothelial cells, by regulating the level of autophagy. Furthermore, the present study also demonstrated that miR-155 regulated autophagy via promotion of the expression of the autophagy-related gene, Autophagy Related 5 (ATG5). In conclusion, the attenuated expression of miR-155 can decrease oxidant-induced injury and promote cell proliferation via upregulating autophagy, which subsequently affects the expression of ATG5. The present study provides a novel insight into microRNAs as potential therapeutics for the treatment of heart disease.
RESUMEN
The relationship between bone marrow mesenchymal stem cells (BMSCs) and aging, as well as the antiaging effects of BMSCs, was observed. An aging macaque BMSC model was established. We isolated BMSCs from young and aged macaques and used RT-PCR and Western blot to confirm the aging-related mRNAs and their expression, revealing that TERT, SIRT1 and SIRT6 expression was decreased in the aged BMSCs. The morphology, immunophenotype, differentiation potential, proliferation potential, and antiaging effects of aged and young BMSCs on 293T cells were compared. The expression of aging-related genes and the difference between the secreted cytokines in natural aging and induced aging BMSCs were observed. The transcriptome of peripheral blood mononuclear cells from macaques was analyzed by high-throughput sequencing. Finally, the transcriptional characteristics and regulatory mechanisms of gene transcription in aging macaques were investigated.