RESUMEN
Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)
Asunto(s)
Bioensayo , Listeria monocytogenes , HemólisisRESUMEN
Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.
Asunto(s)
Animales , Bovinos , Microbiología de Alimentos/métodos , Listeria monocytogenes/aislamiento & purificación , Técnicas de Diagnóstico Molecular/métodos , Toxinas Bacterianas/genética , Supervivencia Celular , Chlorocebus aethiops , Pollos , Cartilla de ADN/genética , Productos Lácteos/microbiología , Peces , Proteínas de Choque Térmico/genética , Proteínas Hemolisinas/genética , India , Carne/microbiología , Leche/microbiología , Reacción en Cadena de la Polimerasa , Células VeroRESUMEN
Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.
Asunto(s)
Microbiología de Alimentos/métodos , Listeria monocytogenes/aislamiento & purificación , Técnicas de Diagnóstico Molecular/métodos , Animales , Toxinas Bacterianas/genética , Bovinos , Supervivencia Celular , Pollos , Chlorocebus aethiops , Cartilla de ADN/genética , Productos Lácteos/microbiología , Peces , Proteínas de Choque Térmico/genética , Proteínas Hemolisinas/genética , India , Carne/microbiología , Leche/microbiología , Reacción en Cadena de la Polimerasa , Células VeroRESUMEN
In the present study, the efficacy of polymerase chain reaction (PCR) based on mapA gene of C. jejuni was tested for detection of Campylobacter jejuni in naturally infected as well as spiked faecal and food samples of human and animal origin. Simultaneously, all the samples were subjected to the cultural isolation of organism and biochemical characterization. The positive samples resulted in the amplification of a DNA fragment of size ~589 bp in PCR assay whereas the absence of such amplicon in DNA extracted from E. coli, Listeria, Salmonella and Staphylococcus confirmed the specificity of the primers. Of randomly collected 143 faecal samples comprising human diarrheic stools (43), cattle diarrheic faeces (48) and poultry faecal swabs (52) only 4, 3 and 8, respectively, could be detected by isolation whereas 6, 3 and 10, respectively, were found positive by PCR. However, among food samples viz. beef (30), milk (35), cheese (30), only one beef sample was detected both by culture as well as PCR. Additionally, PCR was found to be more sensitive for C. jejuni detection in spiked faecal and food samples (96.1 percent each) as relative to culture isolation which could detect the organism in 86.7 percent and 80 percent samples, respectively. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.
Asunto(s)
Humanos , Animales , Infecciones por Campylobacter , Campylobacter jejuni/genética , Campylobacter jejuni/aislamiento & purificación , Eficacia , Infecciones por Enterobacteriaceae , Heces , Amplificación de Genes , Técnicas In Vitro , Reacción en Cadena de la Polimerasa/métodos , Fenómenos Químicos , Métodos , MétodosRESUMEN
In the present study, the efficacy of polymerase chain reaction (PCR) based on mapA gene of C. jejuni was tested for detection of Campylobacter jejuni in naturally infected as well as spiked faecal and food samples of human and animal origin. Simultaneously, all the samples were subjected to the cultural isolation of organism and biochemical characterization. The positive samples resulted in the amplification of a DNA fragment of size ~589 bp in PCR assay whereas the absence of such amplicon in DNA extracted from E. coli, Listeria, Salmonella and Staphylococcus confirmed the specificity of the primers. Of randomly collected 143 faecal samples comprising human diarrheic stools (43), cattle diarrheic faeces (48) and poultry faecal swabs (52) only 4, 3 and 8, respectively, could be detected by isolation whereas 6, 3 and 10, respectively, were found positive by PCR. However, among food samples viz. beef (30), milk (35), cheese (30), only one beef sample was detected both by culture as well as PCR. Additionally, PCR was found to be more sensitive for C. jejuni detection in spiked faecal and food samples (96.1% each) as relative to culture isolation which could detect the organism in 86.7% and 80% samples, respectively. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.
RESUMEN
In the present study, the efficacy of polymerase chain reaction (PCR) based on mapA gene of C. jejuni was tested for detection of Campylobacter jejuni in naturally infected as well as spiked faecal and food samples of human and animal origin. Simultaneously, all the samples were subjected to the cultural isolation of organism and biochemical characterization. The positive samples resulted in the amplification of a DNA fragment of size ~589 bp in PCR assay whereas the absence of such amplicon in DNA extracted from E. coli, Listeria, Salmonella and Staphylococcus confirmed the specificity of the primers. Of randomly collected 143 faecal samples comprising human diarrheic stools (43), cattle diarrheic faeces (48) and poultry faecal swabs (52) only 4, 3 and 8, respectively, could be detected by isolation whereas 6, 3 and 10, respectively, were found positive by PCR. However, among food samples viz. beef (30), milk (35), cheese (30), only one beef sample was detected both by culture as well as PCR. Additionally, PCR was found to be more sensitive for C. jejuni detection in spiked faecal and food samples (96.1% each) as relative to culture isolation which could detect the organism in 86.7% and 80% samples, respectively. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.