Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

A facile synthesis of 5'-end solid-anchored, 3'-end free oligodeoxyribonucleotides via the (5'-->3')-elongated phosphoramidite strategy.

It is demonstrated that not only N2- but also O6-protection of the guanine base is necessary for obtaining the oligodeoxyribonucleotides in high yields and at a high purity in the solid-phase synthesis via the (5'--> 3')-chain elongated phosphoramidite approach.

Stereoscopic display of a three-dimensional image of the larynx using high-speed helical scanning.

To evaluate the usefulness of stereoscopic images of larynges using helical CT in stereo mode, a retrospective review of the characteristics of stereoscopic viewing of larynges was made. The subjects were 3 patients with laryngeal cancer, 1 patient with laryngeal leiomyosarcoma and 1 patient with an advanced tongue carcinoma whose formalin-fixed larynx was extirpated. The larynges were scanned by high-speed helical CT using 1- to 2-mm slices. The reproduction of stereographic images was performed by the manipulation and rotation of three-dimensional structures around the y-axis on the computer display. The three-dimensional images of the complex structures, such as the arytenoid cartilage, aryepiglottic fold and pyriform sinus, were better observed by binocular images (stereograms) than by monocular images. Stereoscopic views of the larynx are useful in producing three-dimensional images of the unseen inner surface of the human body.

An efficient synthesis of nucleotides via the phosphoramidite method using a triflic acid salt of an imidazole-related compound as a promoter.

N-Phenylimidazolium triflate and N-methylbenzimidazolium triflate, new imidazole-related compound/triflic acid-complex type of promoters in the phosphoramidite method, has been developed. These reagents are, particularly, useful for internucleotide-bond formation with lowly reactive reactants and have allowed an efficient, high-yield synthesis of oligodeoxyribonucleotides both in a solution phase and on a solid supports.

Three-dimensional imaging of laryngeal cancers using high-speed helical CT scanning.

To evaluate the clinical usefulness and limitations of three-dimensional (3-D) imaging of laryngeal cancers by high-speed helical (spiral) CT scanning, 3-D images were reconstructed for one dissected human larynx and 10 patients with laryngeal cancer. The larynges were scanned in 1- to 2-mm slices, and were reconstructed using a slice thickness of 0.5-1.0 mm. The macroscopic (or endoscopic) findings and the 3-D CT images of the larynx were compared. The selected threshold CT values were -600 HU (Hounsfield units) to -100 HU for the mucous membranes, and 250 HU for bone. Under these conditions, almost all of the structures remained distinct. The 3-D images of the larynx obtained by helical CT were very helpful in understanding laryngeal anatomy, especially in the subglottic area, which cannot be seen clearly by endoscopy or conventional axial CT. Clinically, this system would have advantages in the detection of subglottic cancers, or the invasion of glottic or supraglottic cancers into the subglottic area.

Clinical study of esophageal foreign bodies attributable to PTP material.

Retrospective survey of patients with esophageal foreign bodies who were treated in the Osaka Medical College over the past 21 years, and the patients with esophageal foreign bodies attributed to press through package (PTP) who were treated at the Osaka Central Emergency Clinic, a representative holiday emergency institution in Japan, was carried out. The incidence of foreign bodies attributed to PTP material tends to increase throughout the period reviewed. The patients over 60 years of age accounted for 25/28 (89%) of all PTP patients in Osaka Medical College and 27/32 (84%) in Osaka Central Emergency Clinic, strongly suggesting that PTP dysphagia is most common in elderly patients. Diagnostic methods and preventive measures against PTP foreign bodies were discussed.

Prognostic value of nucleolar organizer regions in supraglottic carcinoma.

The relationship of nucleolar organizer regions (NORs) to proliferative activity and tumor progression was studied in 16 supraglottic carcinomas. The number of NORs stained by a silver colloid staining method (AgNOR staining method) was determined. The mean AgNOR number tended to be higher (but not significantly so) in poorly differentiated tumors. Moreover as T and N categories and stage of the tumor rose, the AgNOR number also rose, but not significantly. More interestingly, the mean AgNOR number was significantly higher in the presence than in the absence of lymph node metastasis. These studies indicate that the AgNOR number might be of clinical value as a predictor of lymph node metastasis of supraglottic carcinomas.

[Clinical studies on autologous blood transfusion].

To study the present status of blood transfusion in head and neck surgery, we investigated recent cases of intraoperative transfusion in our department. In addition, we present our autologous blood transfusion cases, presently involved in an ongoing clinical trial for patients with head and neck cancer in our department which began in 1989. 1. Investigation of intraoperative blood transfusion cases There were 37 cases of intraoperative blood transfusion among 677 cases who underwent surgery under general anesthesia during the period from May, 1991 to December, 1993. We divided these 37 cases into three groups according to the amount of intraoperative blood loss: less than 600ml (10 cases), more than 600ml and less than 1200ml (11 cases), and more than 1200ml (16 cases). Average amounts of intraoperative blood transfusion in each group were 195ml, 475ml and 780ml, respectively. As we noted that most of these 37 cases received a blood transfusion of less than 800ml, the majority needing intraoperative blood transfusion during head and neck surgery are potential candidates for autologous blood transfusion. Therefore, we have promoted autologous blood transfusion for intraoperative blood transfusion in head and neck surgery. Thus, the patients undergoing intraoperative autologous blood transfusion increased to seven annually as of 1994. 2. Clinical studies on autologous blood transfusion Among 677 cases of head and neck surgery conducted during a six year period (1989-1994), we experienced ten cases of autologous blood transfusion. For the prevention of anemia due to repeated blood withdrawal, we administered an iron preparation. Patients who preoperatively showed a low value of Hb (less than 11g/ dl) received intravenous drip infusion of erythropoietin. Since some patients selected for autologous blood transfusion, who also received neo-adjuvant chemotherapy and preoperative radiotherapy, exhibited a generally chronic anemia status, an iron preparation and erythropoietin should be preoperatively administered in combination.

Perceived pitch of whispered vowels--relationship with formant frequencies: a preliminary study.

To clarify the role of formant frequency in the perception of pitch in whispering, we conducted a preliminary experiment to determine (1.) whether speakers change their pitch during whispering; (2.) whether listeners can perceive differences in pitch; and (3.) what the acoustical features are when speakers change their pitch. The listening test of whispered Japanese speech demonstrates that one can determine the perceived pitch of vowel /a/ as ordinary, high, or low. Acoustical analysis revealed that the perception of pitch corresponds to some formant frequencies. Further data with synthesized whispered voice are necessary to confirm the importance of the formant frequencies in detail for perceived pitch of whispered vowels.

Articulation after uvulopalatopharyngoplasty.

We performed perceptual and acoustic studies to demonstrate articulation after uvulopalatopharyngoplasty (UPPP) in Japanese patients at 28.6 days (mean) after surgery (range 21-50 days). The results of listening tests showed that there were no significant changes between pre- and postoperative articulation scores for any of 25 monosyllables tested, and there were no significant changes in the timbres of 5 Japanese vowels after UPPP. In the acoustic study of the first and second formant frequencies of the vowels, some formant frequencies had significant changes after UPPP. However, these changes in formants fell within the range of intraindividual variation. In the acoustic study of /ka/ with a palatal plosive /k/, there was no significant change in the voice onset time or F2 transition after UPPP.

Recurrent laryngeal papillomatosis developing into laryngeal carcinoma with human papilloma virus (HPV) type 18: a case report.

We report a case of recurrent laryngeal papillomatosis which developed into laryngeal squamous cell carcinoma 11 years after the first diagnosis. Interestingly, we could identify HPV type 18 DNA in the carcinoma tissue using the polymerase chain reaction (PCR). Other known risk factors of irradiation, smoking, exposure to chemical agents, or a hereditary tendency to malignant tumours were not present in this case. Our finding suggests that HPV type 18 is another aetiological agent for laryngeal carcinoma.

Tracheo-esophageal shunt speech: report of an unusual case.

A rare case of laryngectomee who acquired TE shunt speech is reported. Our patient was a 64-year-old woman with laryngeal cancer (glottic type T3N0M0). She underwent laryngectomy in 1990, and a Komorn tracheo-esophageal shunt operation was performed simultaneously. A voice prosthesis (BIVONA) was inserted into the shunt, but the voice valve was not used. She acquired shunt speech soon after the operation, and there was no need to close the tracheostoma during phonation. Fiberoptic, X-ray and aerodynamic findings of the shunt and esophagus were as follows: (i) The one-way valve of the voice prosthesis was open during inspiration and closed during phonation. (ii) Swallowing of air, as seen in esophageal speech, was not observed. (iii) The neoglottis was in the upper part of the esophagus. It was concluded that the air for the vibration of the neoglottis entered the esophagus through the T-E shunt during inspiration.

Nucleolar organizer regions in glottic carcinomas: comparison of DNA cytofluorometry and clinicopathological analysis.

The significance of nucleolar organizer regions (NORs) and nuclear DNA content in 73 glottic carcinomas was assessed for proliferative activity and tumor progression. NORs stained with silver colloid were counted, and nuclear DNA content was assayed by cytofluorometry. The cytofluorometric study demonstrated that the percentage of tumors with aneuploidy tended to increase as histological differentiation decreased. Survival rates of patients with diploid and aneuploid tumors were not significantly different. AgNOR staining revealed that mean AgNOR numbers rose as histological differentiation of tumors decreased. Moreover, as T and N categories and stages showed advancing malignancy, mean AgNOR numbers tended to rise. However, there was no significant difference in survival rates between tumors with low and with high AgNOR counts. These studies indicate that while AgNOR staining is better than DNA cytofluorometry for determining histological differentiation of glottic carcinoma, neither is of prognostic value at the present time.