Laparoscopic Sleeve Gastrectomy in Adolescents: Ten-Years Follow-up.

PURPOSE: Metabolic and bariatric surgery (MBS) has emerged as the most effective treatment for adolescents with severe obesity. Despite the steady increase in frequency of MBS in adolescents, most reports focus on short-term (1-2 years) follow-up. OBJECTIVE: To report on long-term weight loss and status of obesity-related comorbidities of adolescents who underwent laparoscopic sleeve gastrectomy (LSG). METHODS: A retrospective analysis of prospectively collected data of patients younger than 18 years who underwent LSG between January 2008 and July 2014 was performed. RESULTS: During the study period, 46 patients (mean age 16.19 ± 1.07 years) underwent LSG, 31 of them (67.39%) completed long-term follow-up and were included in the study. Mean follow-up time was 10.84 ± 2.35 years. There were 18 females (58%). Mean body-mass index (BMI) was 44.94 ± 4.33 kg/m2 and 30.11 ± 710, before, and 10-year following surgery, respectively, a reduction of 33.24% (P < 0.001). Long-term TWL% was 32.31 ± 12.02. Twenty-one patients (67.74%) achieved a BMI < 30 kg/m2. Following weight reduction, resolution of hypertension was noted in 8 patients (88.9%, P < 0.001). Frequent long-term side effects of surgery were gastrointestinal reflux disease (GERD) and alopecia in 22.58% and 48.39%, respectively. Symptomatic cholelithiasis necessitated cholecystectomy in 22.58% of the patients. Using a 1-10 scale, the overall patient satisfaction in the long term was 8.97. CONCLUSION: Our data suggests that LSG is a durable intervention for weight reduction in adolescents.

A prospective, randomized assessment of a novel, local antibiotic releasing platform for the prevention of superficial and deep surgical site infections.

BACKGROUND: Despite significant advances in infection control guidelines and practices, surgical site infections (SSIs) remain a substantial cause of morbidity, prolonged hospitalization, and mortality among patients having both elective and emergent surgeries. D-PLEX100 is a novel, antibiotic-eluting polymer-lipid matrix that supplies a high, local concentration of doxycycline for the prevention of superficial and deep SSIs. The aim of our study was to evaluate the safety and efficacy of D-PLEX in addition to standard of care (SOC) in preventing superficial and deep surgical site infections for patients undergoing elective colorectal surgery. METHODS: From October 10, 2018 to October 6, 2019, as part of a Phase 2 clinical trial, we randomly assigned 202 patients who had scheduled elective colorectal surgery to receive either standard of care SSI prophylaxis or D-PLEX100 in addition to standard of care. The primary objective was to assess the efficacy of D-PLEX100 in superficial and deep SSI reduction, as measured by the incidence of SSIs within 30 days, as adjudicated by both an individual assessor and a three-person endpoint adjudication committee, all of whom were blinded to study-group assignments. Safety was assessed by the stratification and incidence of treatment-emergent adverse events. RESULTS: One hundred and seventy-nine patients were evaluated in the per protocol population, 88 in the intervention arm [51 males, 37 females, median age (64.0 range: 19-92) years] and 91 in the control arm [57 males, 34 females, median age 64.5 (range: 21-88) years]. The SSI rate within 30 day post-index surgery revealed a 64% relative risk reduction in SSI rate in the D-PLEX100 plus standard of care (SOC) group [n = 7/88 (8%)] vs SOC alone [n = 20/91 (22%)]; p = 0.0115. There was no significant difference in treatment-emergent adverse events. CONCLUSIONS: D-PLEX100 application leads to a statistically significant reduction in superficial and deep surgical site infections in this colorectal clinical model without any associated increase in adverse events.

Impact of "critical lesions" on outcomes following cytoreductive surgery and hyperthermic intra-peritoneal chemotherapy.

BACKGROUND: Peritoneal Cancer Index (PCI) and complete cytoreduction are the best outcome predictors following cytoreductive surgery (CRS) with hyperthermic intraperitoneal chemotherapy (HIPEC). Lesions in critical areas, regardless of PCI, complicate surgery and impact oncological outcomes. We prospectively defined "Critical lesions" (CL) as penetrating the hepatic hilum, diaphragm at hepatic outflow, major blood vessels, pancreas, or urinary tract. METHODS: Retrospective analysis of a prospective database of 352 CRS + HIPEC patients from 2015 to 2019. Excluded patients with aborted/redo operation (n = 112), or incomplete data (n = 19). Patients categorized by CL status and compared: operative time, estimated blood loss (EBL), PCI, transfusions, hospital stay, post-operative complications and mortality, overall survival (OS) and disease-free survival (DFS). RESULTS: Included 221 patients (78 CL; 143 no-CL). No difference in patients' characteristics: age, BMI, gender or co-morbidities noted. Operative time longer (5.3 h vs 4.3 h, p < 0.01), EBL higher (769 ml vs 405 ml, p < 0.01), transfusions higher (1.9 vs 0.7 Units, p < 0.001) and PCI higher (15.5 vs 9.5, p < 0.01) in CL. No difference in major complications. Postoperative complications, CL, OR-time and transfusions were predictive of OS in univariate analysis, while only complications remained on multivariate analysis. Median follow up of 21.4 months, 3-year DFS/OS was 22% vs 30% (p < 0.037) and 73% vs 87% (p < 0.014) in CL and non-CL, respectively. Despite CL complete resection, 17/38 patients (44.7%) that recurred had recurrence at previous CL site. CONCLUSIONS: Critical lesions complicate surgery and may be associated with poor oncological outcomes with high local recurrence rate, despite no significant difference in complications. Utilizing adjuvant or intra-operative radiation may be beneficial.

Acute Appendicitis During Pregnancy: Different from the Nonpregnant State?

BACKGROUND: Acute appendicitis is the most common nonobstetric indication for surgical intervention during pregnancy. However, the current literature is scarce and composed of relatively small case series. We aimed to compare the presentation, management, and surgical outcomes of presumed acute appendicitis between a contemporary cohort of pregnant women and nonpregnant women of reproductive age. METHODS: The study group included 92 pregnant patients who underwent appendectomy for presumed acute appendicitis at a single tertiary medical center in 2000-2014. Preoperative, operative, and postoperative clinical data were derived from medical records and compared to data for 494 nonpregnant patients of reproductive age who underwent appendectomy in 2004-2007 at the same institution. RESULTS: Median age was 28 years (range 25-33) in the study group and 26 years (range 20-34) in the control group (P = 0.1). There were no between-group differences in mean white blood cell count, patient interval, hospital interval, or operative time. Preoperative abdominal ultrasound was used in a significantly higher proportion of patients in the pregnant group than in the nonpregnant group (73 and 27 %, respectively, P < 0.001) and computed tomography, in a significantly lower proportion of patients (1 vs. 16 %, respectively, P < 0.001) . The two groups had similar rates of negative appendectomy (23 and 22 %, P = 0.9), complicated appendicitis (12 and 11 %, P = 0.9), and overall postoperative complications (15 and 12 %, P = 0.3). CONCLUSIONS: The clinical presentation and outcome of presumed acute appendicitis are similar in pregnant women and nonpregnant women of reproductive age. Therefore, similar perioperative management algorithms may be applied in both patient populations.

Complex refractive indices in the near-ultraviolet spectral region of biogenic secondary organic aerosol aged with ammonia.

Atmospheric absorption by brown carbon aerosol may play an important role in global radiative forcing. Brown carbon arises from both primary and secondary sources, but the mechanisms and reactions of the latter are highly uncertain. One proposed mechanism is the reaction of ammonia or amino acids with carbonyl products in secondary organic aerosol (SOA). We generated SOA in situ by reacting biogenic alkenes (α-pinene, limonene, and α-humulene) with excess ozone, humidifying the resulting aerosol, and reacting the humidified aerosol with gaseous ammonia. We determined the complex refractive indices (RI) in the 360-420 nm range for these aerosols using broadband cavity enhanced spectroscopy (BBCES). The average real part (n) of the measured spectral range of the NH3-aged α-pinene SOA increased from n = 1.50 (±0.01) for the unreacted SOA to n = 1.57 (±0.01) after 1.5 h of exposure to 1.9 ppm NH3, whereas the imaginary component (k) remained below k < 0.001((+0.002)(-0.001)). For the limonene and α-humulene SOA the real part did not change significantly, and we observed a small change in the imaginary component of the RI. The imaginary component increased from k = 0.000 to an average k = 0.029 (±0.021) for α-humulene SOA, and from k < 0.001((+0.002)(-0.001)) to an average k = 0.032 (±0.019) for limonene SOA after 1.5 h of exposure to 1.3 and 1.9 ppm of NH3, respectively. Collected filter samples of the aged and unreacted α-pinene SOA and limonene SOA were analyzed off-line by nanospray desorption electrospray ionization high resolution mass spectrometry (nano-DESI/HR-MS), and in situ using a Time-of-Flight Aerosol Mass Spectrometer (ToF-AMS), confirming that the SOA reacted and that various nitrogen-containing reaction products formed. If we assume that NH3 aging reactions scale linearly with time and concentration, which will not necessarily be the case in the atmosphere, then a 1.5 h reaction with 1 ppm NH3 in the laboratory is equivalent to 24 h reaction with 63 ppbv NH3, indicating that the observed aerosol absorption will be limited to atmospheric regions with high NH3 concentrations.

First Report of Tomato chlorosis virus in Israel.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5' ATGGAGAACAGT GCCGTTGC 3'; Reverse Primer: 5' TTAGCAACCAGTTATCGATGC 3'). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.