RESUMEN
BACKGROUND: Transmission of infections via contaminated endoscopes is a common problem. Manual cleaning, using at least a detergent, is an important step in endoscope processing and should be performed as soon as possible to avoid drying of organic residues that might interfere with high-level disinfection and promote biofilm formation. AIM: To assess the efficacy of two detergent-disinfectants, enzymatic and non-enzymatic, and of an enzymatic detergent used during the manual cleaning against a Klebsiella pneumoniae biofilm. METHODS: A 24 h biofilm statically formed in a Tygon tube was exposed to detergent-disinfectants at 20 °C and 35 °C for 10 mn, and to enzymatic detergent at 45 °C for 60 mn. The logarithmic reduction in bacteria in the Tygon tube and the number of bacteria in the product supernatant were calculated. FINDINGS: Biofilm formation was reproducible between assays. After exposure to detergent-disinfectants, the logarithmic reduction was between 6.32 and 6.71 log10 cfu/cm2 in the Tygon tubes. No bacteria were found in their supernatants. Results in the detergent-disinfectant group were not affected by the exposure temperature or the addition of enzymes. No decrease in the bacterial load was observed in the Tygon tubes after exposure to the enzymatic detergent. Bacteria were found in its supernatant. CONCLUSION: These results show the importance of the choice of products used during the manual cleaning phase. They also show the potential benefit of combining detergent and disinfectant activity to decrease the bacterial load during the manual cleaning step of endoscope processing.
Asunto(s)
Desinfectantes , Humanos , Desinfectantes/farmacología , Klebsiella pneumoniae , Detergentes/farmacología , Desinfección/métodos , Endoscopios/microbiología , BiopelículasRESUMEN
Introduction: Autosomal recessive cerebellar ataxias (ARCA) are a group of rare and heterogynous neurodegenerative diseases mainly characterized by unbalance and walking difficulty and movement incoordination. Objectives: To clinically and paraclinically characterize ARCA in the department of Neurology at the Teaching Hospital of Point G and identify the underlying genetic defect. Patients and method: We have conducted a longitudinal and prospective study from January 2018 to December 2020. Patients with ARCA phenotype seen in the Department of Neurology at the Teaching Hospital of Point "G" were enrolled. Results: We have enrolled 7 families totaling 13 patients after giving an informed verbal and written consent. The sex ratio was 2.2 in favor of males, Kayes region and Fulani ethnic group were respectively the most represented region and ethnic group.Walking difficulty represented the major symptom followed by loss of vibration and joint sense, nystagmus, dysarthria and skeletal deformities. Alpha-foetoprotein level was high in one patient. Genetic testing confirmed Friedreich ataxia in one family and was not conclusive in 4 families. Conclusion: This study showed that ARCA are not uncommon in Mali and genetic testing is crucial to confirm the diagnosis.
Introduction: Les ataxies cérébelleuses autosomiques récessives (ACAR) constituent un groupe de maladies neurodégénératives rares et hétérogènes caractérisées essentiellement par un trouble de l'équilibre et de la marche, et un trouble de la coordination des mouvements. Objectifs: Caractériser les signes cliniques, paracliniques et génétiques des ataxies cérébelleuses autosomiques récessives au Service de Neurologie du CHU du Point "G". Patients et méthodes: Nous avons réalisé une étude de cas enrôlé dans le cadre d'une étude longitudinale et prospective allant de Janvier 2018 à Décembre 2020, portant sur des patients présentant des symptômes d'ACAR et ayant donné leur consentement éclairé. Résultats: Nous avons enrôlé sept familles totalisant 13 patients. Le sexe ratio était de 2,2 en faveur des hommes, la région de Kayes était la plus représentée et l'ethnie peulh était majoritaire. Les troubles de la marche ont représenté les signes majeurs suivis de troubles de la sensibilité profonde, de nystagmus, de dysarthrie, et des déformations ostéoarticulaires. L'alpha-foetoprotéine était élevée chez une patiente. Le test génétique a retrouvé l'ataxie de Friedreich dans une famille et n'a pas été concluant dans quatre autres. Conclusion: Cette étude montre que les ACAR ne sont pas rares au Mali et l'exploration génétique constitue un outil indispensable pour leur diagnostic de certitude.
Asunto(s)
Ataxia Cerebelosa , Ataxia de Friedreich , Masculino , Humanos , Ataxia Cerebelosa/genética , Estudios Prospectivos , Malí , Ataxia de Friedreich/genética , Pruebas GenéticasRESUMEN
We report a case of intrauterine device (IUD) migration in order to describe the contribution of imaging in its diagnosis. It was a 35-year-old woman received on 06/01/2018 for pelvic ultrasound for pelvic pain. Ultrasound examination revealed a hyperechoic right para-uterine tubular image. A hysterosalpingography revealed an IUD in the pelvis in extra-urine position. Surgical extraction was done without complications. Intrauterine device migration is rare in our context. The radiological means make it possible to specify its topography.
Nous rapportons un cas de migration de dispositif intra-utérin (DIU) dans le but de décrire l'apport de l'imagerie dans son diagnostic. Il s'agissait d'une dame de 35 ans reçue le 01/06/2018 pour une échographie pelvienne dans le bilan d'une douleur pelvienne. L'exploration échographique a objectivé une image hyperéchogène tubulaire para-utérine droite. Une hystérosalpingographie avait objectivé un DIU dans le bassin en position extra-urine. Uneextraction chirurgicale a été faite avec des suites simples. La migration de dispositif intra-utérin est rare dans notre contexte. Les moyens radiologiques permettent de préciser sa topographie.
RESUMEN
INTRODUCTION: Limb-Girdle Muscular dystrophies (LGMD) is a group of inherited diseases characterized by predominantly proximal and limb muscle weakness. These are rare diseases that have not been well studied in sub-saharan Africa. The aim of our was the clinical and paraclinical characterization of patients with recessive LGMD at the Department of Neurology of the Teaching Hospital of Point G. PATIENTS AND METHODS: We conducted a longitudinal prospective study which took place from March 2014 to May 2019. Patients with recessive LGMD phenotype were enrolled. Sociodemographic, clinical and laboratory data were analyzed. RESULTS: We enrolled 46 families (67 patients), i.e. a frequency of 16.7% among the neurodegenerative diseases seen in the service. Among them, 45.6% came from the Sikasso region. Autosomal recessive inheritance pattern was suspected in 67.4% of the families. Symptoms appeared mainly in the first decade of life. Proximal muscle weakness was found in almost all patients. Cardiac examination showed dilated cardiomyopathy in 4.5% of cases. CONCLUSION: Limb-Girdle muscular dystrophy is a disabling disease that is found in Mali. Further study of these cases could elucidate the underlying genetic defects.
Asunto(s)
COVID-19/virología , Contaminación de Equipos , Equipo de Protección Personal/virología , Ropa de Protección/virología , SARS-CoV-2/aislamiento & purificación , Anciano , Prueba de Ácido Nucleico para COVID-19 , Femenino , Instituciones de Salud , Humanos , Masculino , Persona de Mediana Edad , SARS-CoV-2/genéticaRESUMEN
PURPOSE: Report radiographic aspects and assess the contribution of computed tomography for the diagnosis and search for extension of bronchial carcinoid tumors. MATERIAL AND METHODS: This retrospective study included 9 patients with a bronchial carcinoid tumor during a four years period. In all patients, the exploration included standard chest radiography, computed tomography (CT) and abdominal ultrasonography. RESULTS: This series included three females and six males, mean age 25 years (age range 20-52 years). The average time between clinical symptoms and diagnosis was 24 months. The important signs were chest pain, dry cough and dyspnea in 7 cases, hemoptysis in 4 cases. Chest radiography has objectified a rounded opacity speculated in 4 cases, opacity systematized in 3 cases and an opaque lung in 2 cases. Computed tomography (CT) revealed an endobronchial process with a endobronchial budding in 5 cases, pneumonia systematized in 4 cases, collapse in 7 cases, a localized dilatation of bronchus in 2 cases, lymph node metastases in 4 cases. Bronchoscopy has the macroscopic diagnosis in all cases. All patients have surgical treatment, the lobectomy in 4 cases, pneumonectomy in 3 cases and bilobectomy in 2 cases. CONCLUSION: CT is indispensable for positive diagnosis, and topographic localization of extension of bronchial carcinoid tumors. The main contribution of CT compared with fibroscopy is to demonstrate exobronchial tumor development and upstream pulmonary complications.
BUT: Rapporter les aspects radiologiques et évaluer l'apport de la tomodensitométrie dans le diagnostic et le bilan d'extension des tumeurs carcinoïdes bronchiques. MATÉRIEL ET MÉTHODE: Etude rétrospective de 9 cas de tumeurs carcinoïdes bronchiques sur une période de 4 ans, portant sur les patients explorés dans le service de radiologie 20 Août, et opérés dans le service de chirurgie thoracique de CHU Ibn Rochd Casablanca. Tous les patients ont bénéficié de radiographies et d'une tomodensitométrie (TDM) thoraciques, ainsi une échographie abdominale. RÉSULTATS: Il s'agissait de 3 femmes et 6 hommes, la moyenne d'âge était de 25ans. Le délai moyen entre la symptomatologie clinique et le diagnostic était de 24 mois. Les signes révélateurs étaient des douleurs thoraciques, une toux sèche et une dyspnée dans 7 cas, une hémoptysie dans 4 cas. La radiographie thoracique a objectivé une opacité centrale arrondie spiculée dans 4 cas, opacité systématisée dans 3 cas et un poumon opaque dans 2 cas. La tomodensitométrie (TDM) thoracique a montré un processus tissulaire avec bourgeon endobronchique dans 5cas, une pneumopathie systématisé dans 4 cas, un collapsus dans 7 cas, une dilatation de bronches localisée dans 2 cas, des adénopathies médiastinales dans 4 cas. La bronchoscopie a permis le diagnostic macroscopique dans tous les cas. Tous les patients ont bénéficié d'un traitement chirurgical fait de lobectomie dans 4 cas, pneumectomie dans 3 cas et bilobectomie dans 2 cas. CONCLUSION: La TDM est indispensable pour le diagnostic positif topographique et dans le bilan d'extension pré-thérapeutique des tumeurs carcinoïdes bronchiques. Son apport principal par rapport à celui de la fibroscopie est de montrer leur éventuel développement exo-bronchique, et les complications pulmonaires d'aval.
RESUMEN
INTRODUCTION: Subdural empyema (SDE) is a rare complication of chronic subdural hematoma (CSDH) surgery. We introduced antibiotic prophylaxis (AP) for this procedure in 2014 following a morbidity-mortality conference (MMC) in our department. We report the results of retrospective data analysis to assess the effect of systematic AP and to identify risk factors for SDE. MATERIAL AND METHODS: Two hundred eight patients were recruited between January 2013 and December 2015; 5 were excluded for incomplete data: 107 without and 96 with AP (n=203). SDE was confirmed by clinical examination, imaging and bacteriological analysis. Comparisons between AP-(no cefuroxime) and AP+ (cefuroxime) groups were made with Chi2 test and Student's t-test. RESULTS: One empyema was found in each group, indicating that AP had no effect (P=1). The only criterion associated with SDE for these two patients was a greater number of reoperations for CSDH recurrence (P=0.013). DISCUSSION: The incidence of postoperative empyema was 1%, similar to the range of 0.2%-2.1% reported in the literature. This rare incidence explains why we found no significant effect of AP. The medical decision taken at the MMC did not help to reduce the rate of postoperative SDE. MMCs can help to define factors associated with adverse surgical events and identify opportunities for improvement. CONCLUSION: AP, introduced after an MMC, did not impact SDE rates. In practice, AP should be required only in case of reoperation for CSDH recurrence. However, we still continue to use AP following the MMC considering different parameters discussed in the manuscript.
Asunto(s)
Empiema Subdural/terapia , Hematoma Subdural Crónico/cirugía , Complicaciones Posoperatorias/terapia , Anciano , Anciano de 80 o más Años , Profilaxis Antibiótica , Cefuroxima/uso terapéutico , Estudios de Cohortes , Empiema Subdural/epidemiología , Empiema Subdural/etiología , Femenino , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Procedimientos Neuroquirúrgicos/efectos adversos , Procedimientos Neuroquirúrgicos/métodos , Complicaciones Posoperatorias/epidemiología , Recurrencia , Estudios RetrospectivosRESUMEN
BACKGROUND: Surgical site infection (SSI) largely implicates the patient's endogenous skin microbiota. Perioperative disinfection protocols do not follow a general agreement. AIM: To compare antisepsis and skin protection protocols on quantitative analysis of recolonization in the operating room at regular time-steps. The study hypothesis was that one protocol would be more effective than others. METHODS: A single-centre prospective interventional study was conducted between January and June 2019. Healthy volunteers were randomized between protocols and served as their own controls. The protocols began ahead of scheduled orthopaedic surgery with a preoperative shower, mechanical cleansing, application of major antiseptics (alcoholic Bétadine™ 5% or alcoholic chlorhexidine 0.5%), sterile draping, then adhesive draping (3M™ Steri-Drape™ or iodine-impregnated 3M™ Ioban2™). Sampling was by swabbing in the operating room at 30 min intervals up to 90 min after draping. Cultures were performed under aerobic and anaerobic conditions. Qualitative and quantitative (cfu/mL) bacteriology was performed in the laboratory by direct reading on the blood agar plates. FINDINGS: Thirty subjects were included; none was lost to follow-up or excluded from analysis. Bacterial load before manipulation (T0) was significantly higher in males (P < 0.0001) despite a significantly shorter shower-to-sampling interval (P = 0.03). Smoking (P = 0.85), body mass index (P = 0.38), and depilation (P = 0.50) did not significantly affect preoperative load. Mean load increased significantly under all protocols up to T90 min, without significant superiority for any one protocol. Associated Bétadine™/Ioban™ showed the lowest T90 load, and chlorhexidine alone the highest, but without significant difference. Isolates at T0 were predominantly healthy skin commensals: coagulase-negative staphylococci, micrococci, and coryneforms. CONCLUSION: No one protocol demonstrated superiority, whether in immediate bactericidal action or in preventing skin recolonization in the operating room. Further studies are needed to define generally agreed protocols for SSI risk management.
Asunto(s)
Antiinfecciosos Locales/farmacología , Antisepsia/normas , Cuidados Preoperatorios/métodos , Piel/microbiología , Adulto , Antisepsia/métodos , Clorhexidina/farmacología , Desinfección/métodos , Desinfección/normas , Femenino , Humanos , Masculino , Quirófanos , Povidona Yodada/farmacología , Estudios Prospectivos , Distribución Aleatoria , Infección de la Herida Quirúrgica/microbiología , Infección de la Herida Quirúrgica/prevención & control , Adulto JovenRESUMEN
Biofilm in endoscopes is a major problem that can result in failure of disinfection. We studied the survival of K. pneumoniae in a biofilm formed on endoscope tubes subjected to combined chemical and physical stresses. We monitored bacterial survival in the biofilm after the action of 1% and 2% GTA either immediately or after 15 days of desiccation and described the ability of surviving bacteria to recolonize endoscope tubing in a dynamic model. There were surviving bacteria after 5-min exposure to 2% and 1% GTA. The percentage of survivors after 2% and 1% GTA was greater when the GTA treatment was performed after 15 days of prior desiccation of the biofilm. The survivors were able to recolonize and reform biofilm on abiotic surfaces probably because of the survival of persisters in a viable but non-culturable state in the biofilm. Our findings emphasize that the current guidelines on endoscope reprocessing should be strictly followed but that once constituted the biofilm in endoscope tubing will be very difficult to eradicate with present practices.
Asunto(s)
Biopelículas/crecimiento & desarrollo , Desecación , Endoscopios/microbiología , Glutaral/farmacología , Klebsiella pneumoniae/fisiología , Biopelículas/efectos de los fármacos , Recuento de Colonia Microbiana , Desinfección , Humanos , Klebsiella pneumoniae/efectos de los fármacos , Klebsiella pneumoniae/crecimiento & desarrollo , Viabilidad Microbiana , Estrés FisiológicoRESUMEN
INTRODUCTION: Surgical site infections (SSI) are frequent and dangerous in the surgical ward. They represent an obsession for the surgeon. The objectives were to determine the frequency of ISOs and risk factors, to identify the germs and to study their sensitivity to different antibiotics. MATERIALS AND METHODS: This was a cross-sectional study with prospective data collection, performed at the general surgery department of the Bocar Sidy Sall University Hospital Center (Kati CHU) from January 2015 to December 2018. RESULTS: During this period of study we recorded 55 cases of ISO out of 650 operated patients with a frequency of 8.46%. 450 patients were operated on the cold operating program (69.23%) and 200 patients on emergency (30.77%). The average age was 39, the sex ratio was 2.66. Among the 55 cases of ISO, 60% of these patients were operated in emergency and 40% in the operating program. The most common strains found were Escherichia coli (E. coli) in 38.3% of cases, Staphylococcus aureus in 23.4% and Klebsiella pneumonia in 13.3%. Hemoglobin levels were normal in 70% of cases. 4 of our patients or 7.27% were diabetic. We did not have any cases of obesity. Of the 55 cases of ISO, 66% were of class 3 and 4 of Altemeier, 59% were of ASA score 2 and ASA 3, 55% were of score 2 of NNISS (National Nosocomial Infection Surveillance System), 5.45% were NNISS score 3 or 3 cases and these 3 cases developed ISO. The ISOs were parietal in 49 cases, ie 89%. The recovered germs were 100% sensitive to imipenem. The most informative interventions of the ISOs were peritonitis 25 cases (45.45%), intestinal occlusions 12 cases (21.82%), appendicular abscess 8 cases (14.55%). We had 2 death cases, 3.64%, the average hospital stay was 13 days. CONCLUSION: Escherichia coli was the common germ found in the ISO in general surgery at Kati BSS Hospital. The usual resistance to antibiotics must provoke effective preventive actions.
INTRODUCTION: Les infections du site opératoires (ISO) sont fréquentes et redoutables, au service de chirurgie. Elles représentent une hantise pour le chirurgien. Les objectifs étaient de déterminer la fréquence des ISO et les facteurs de risque, d'identifier les germes et étudier leur sensibilité aux différents antibiotiques. MATÉRIELS ET MÉTHODES: il s'agissait d'une étude transversale avec recueil prospectif des données, réalisée au service de chirurgie générale du Centre Hospitalier Universitaire Bocar Sidy Sall (CHU BSS) de Kati allant de janvier 2015 à décembre 2018. Elle a concerné tous les patients opérés dans le service pendant cette période d'étude. N'ont pas été inclus dans cette étude les cas de biopsie. RÉSULTATS: Au cours de cette période d'étude nous avons enregistré 55 cas d'ISO sur 650 malades opérés soit une fréquence de 8,46%. 450 malades ont été opérés au programme opératoire à froid (69,23%) et 200 malades en urgence (30,77%). L'âge moyen était de 39 ans, le sex-ratio à 2,66. Parmi les 55 cas d'ISO, 60% de ces malades ont été opérés en urgence et 40% au programme opératoire. Les différentes souches les plus retrouvées étaient l'Escherichia coli (E. coli) dans 38,3% des cas, le staphylococcus aureus dans 23,4%, klebsiella pneumonia dans 13,3%. Le taux d'hémoglobine était normal dans 70% des cas. 4 de nos patients soit 7,27% étaient diabétiques. Nous n'avions pas enregistré de cas d'obésité. Parmi les 55 cas des ISO, 66 % étaient de classe 3 et 4 d'Altemeier, 59% étaient de score ASA 2 et ASA 3, 55% étaient de score 2 de NNISS (National Nosocomial Infection Surveillance System), 5,45% étaient de score 3 de NNISS soit 3 cas et ces 3 cas ont développé des ISO. Les ISO étaient pariétales dans 49 cas soit 89%. Les germes retrouvés étaient sensibles à 100% à l'imipénème. Les interventions les plus pourvoyeuses des ISO étaient les péritonites 25 cas (45,45%), les occlusions intestinales 12 cas (21,82%), les abcès appendiculaires 8 cas (14,55%). Nous avions enregistré 2 cas de décès soit 3,64%, la durée moyenne d'hospitalisation a été de 13 jours. CONCLUSION: L'Escherichia coli était le germe fréquemment rencontré dans les ISO en chirurgie générale au CHU BSS de Kati. La résistance aux antibiotiques usuels doit susciter des actions préventives efficaces.
RESUMEN
The objectives of the work were to measure the degree of satisfaction of women in the postpartum period and to determine the stability of the immediate postpartum care satisfaction scale (PASS). MATERIAL AND METHOD: The motherhood of the reference health center of commune V served as a study framework. The study was descriptive for evaluative purposes in postpartum women. It covered the period from 11 July 2014 to 14 January 2015. Two interview questionnaires (SSOPPI1) and (SF12 and SSOPPI2) were used for data collection. The data analysis was done on the software EPI-info version 3.5.3. RESULTS: The study involved a total of 145 women in SSOPPI1 and SSOPPI2. The average age was 25.6 years ± 5.5 years. The level of satisfaction for the two phases of the study (SSOPPI1 and SSOPPI2) was a function of level of study, occupation, mode of initiation of labor, route of delivery, status of newborn at birth. Satisfaction was 98.6% in SSOPPI1 and was 98,5% in SSOPPI2 with a statistically insignificant difference (p = 0.67). CONCLUSION: The degree of overall satisfaction was a function of a number of factors. This satisfaction remained stable during both phases of the study.
Les objectifs du travail étaient de mesurer le degré de satisfaction des femmes dans le post-partum et de déterminer la stabilité de l'échelle de mesure de la satisfaction des soins post-partum immédiat(SSOPPI). MATÉRIEL ET MÉTHODE: La maternité du centre de santé de référence de la commune V a servi de cadre d'étude. L'étude était descriptive à visée évaluative portant sur les femmes en post-partum. Elle a couvert la période allant du 11juillet 2014 au 14 janvier 2015. Deux questionnaires d'entrevue (SSOPPI1) et (SF12 et SSOPPI2) ont été utilisés pour la collecte des données. L'analyse des données a été faite sur le logiciel EPI-info version 3.5.3. RÉSULTATS: L'étude a porté sur un total de 145 femmes en SSOPPI1 et SSOPPI2. L'âge moyen était de 25, 6ans±5,5ans. Le degré de satisfaction pour les deux phases de l'étude (SSOPPI1 et SSOPPI2) était fonction du niveau d'étude, la profession, le mode de déclenchement du travail, la voie d'accouchement, l'état du nouveau-né à la naissance. La satisfaction était de 98,6% en SSOPPI1 et de 98,5% en SSOPPI2 avec une différence statistiquement non significative (p=0,67). CONCLUSION: Le degré de satisfaction globale était fonction d'un certain nombre de facteurs. Cette satisfaction est restée stable pendant les deux phases de l'étude.
RESUMEN
Bacterial resistance to carbapenem, which is mainly due to the successful dissemination of carbapenemase-encoding genes, has become a major health problem. Few studies have aimed to characterize the level of resistance in the environment, notably in hospital wastewater, which is a likely hotspot for exchange of antibiotic resistance genes. In this work, we looked for the presence of imipenem-resistant bacteria and imipenem in the effluent of the teaching hospital of Clermont-Ferrand, France. Selective growth of bacteria from 14-day old biofilms formed in the pipe sewer showed that 22.1% of the isolates were imipenem-resistant and identified as Aeromonas (nâ¯=â¯23), Pseudomonas (nâ¯=â¯10), Stenotrophomonas (nâ¯=â¯4) and Acinetobacter (nâ¯=â¯1). Fifteen of these strains harbored acquired carbapenemase-encoding genes blaVIM (nâ¯=â¯11), blaOXA-48 (nâ¯=â¯2), blaGES (nâ¯=â¯1), blaNDM (nâ¯=â¯1). All isolates also harbored associated resistances to aminoglycosides, fluoroquinolones and/or tetracyclin. S1-nuclease pulsed-field gel electrophoresis analysis of eight selected isolates showed that four of them harbored one to two plasmids of molecular weight between 48.5â¯Kb and 194â¯Kb. In vitro transformation assays evidenced the presence of blaVIM and blaNDM on plasmids with the blaVIM harboring 80â¯Kb plasmid having conjugative capacity. The predicted environmental concentration of imipenem in the hospital effluent was 3.16⯵g/L, suggesting that biofilm bacteria are subjected to sub-MICs of imipenem within the effluent. However, no imipenem molecule was detected in the hospital effluent, probably owing to its instability: in vitro assays indicated that imipenem's biological activity was no longer detectable after 45â¯h of storage. However, the predictive value of the hazard quotient relative to the development of resistance was >1.0 (HQrâ¯=â¯28.9⯱â¯1.9), which indicates a possible risk. The presence of carbapenemase-encoding genes in hospital effluent biofilm strains and their ability to transfer are therefore a potential hazard that should not be neglected and points to the need for monitoring antibiotic resistance in hospital wastewater.
Asunto(s)
Antibacterianos/farmacología , Fenómenos Fisiológicos Bacterianos , Biopelículas , Farmacorresistencia Bacteriana , Imipenem/farmacología , Residuos Sanitarios/análisis , Francia , Hospitales , Pruebas de Sensibilidad MicrobianaRESUMEN
Les objectifs du travail étaient de mesurer le degré de satisfaction des femmes dans le post-partum et de déterminer la stabilité de l'échelle de mesure de la satisfaction des soins post-partum immédiat(SSOPPI). Matériel et méthode : La maternité du centre de santé de référence de la commune V a servi de cadre d'étude. L'étude était descriptive à visée évaluative portant sur les femmes en post-partum. Elle a couvert la période allant du 11juillet 2014 au 14 janvier 2015. Deux questionnaires d'entrevue (SSOPPI1) et (SF12 et SSOPPI2) ont été utilisés pour la collecte des données. L'analyse des données a été faite sur le logiciel EPI-info version 3.5.3. Résultats : L'étude a porté sur un total de 145 femmes en SSOPPI1 et SSOPPI2. L'âge moyen était de 25, 6ans±5,5ans. Le degré de satisfaction pour les deux phases de l'étude (SSOPPI1 et SSOPPI2) était fonction du niveau d'étude, la profession, le mode de déclenchement du travail, la voie d'accouchement, l'état du nouveau-né à la naissance. La satisfaction était de 98,6% en SSOPPI1 et de 98,5% en SSOPPI2 avec une différence statistiquement non significative (p=0,67). Conclusion : Le degré de satisfaction globale était fonction d'un certain nombre de facteurs. Cette satisfaction est restée stable pendant les deux phases de l'étude
Asunto(s)
Instituciones de Salud , Recién Nacido , Malí , Satisfacción del Paciente , Periodo PospartoRESUMEN
OBJECTIVES: Infusion in care units, and all the more in intensive care units, is a complex process which can be the source of many risks for the patient. Under cover of an institutional approach for the improvement of the quality and safety of patient healthcare, a risk mapping infusion practices was performed. METHODS: The analysis was focused on intravenous infusion situations in adults, the a priori risk assessment methodology was applied and a multidisciplinary work group established. RESULTS: Forty-three risks were identified for the infusion process (prescription, preparation and administration). The risks' assessment and the existing means of control showed that 48% of them would have a highly critical patient security impact. Recommendations were developed for 20 risks considered to be most critical, to limit their occurrence and severity, and improve their control level. An institutional action plan was developed and validated in the Drug and Sterile Medical Devices Commission. CONCLUSION: This mapping allowed the realization of an exhaustive inventory of potential risks associated with the infusion. At the end of this work, multidisciplinary groups were set up to work on different themes and regular quarterly meetings were established to follow the progress of various projects. Risk mapping will be performed in pediatric and oncology unit where the risks associated with the handling of toxic products is omnipresent.
Asunto(s)
Infusiones Intravenosas/normas , Infusiones Parenterales/normas , Servicio de Farmacia en Hospital/organización & administración , Humanos , Unidades de Cuidados Intensivos/organización & administración , Seguridad del Paciente , Calidad de la Atención de Salud , Medición de RiesgoRESUMEN
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.
RESUMEN
Mucormycoses are rare but emerging diseases with poor prognosis caused by ubiquitous fungi from the environment. In November 2008, our teaching hospital experienced three cutaneous mucormycosis due to Lichtheimia spp. (ex Absidia/Mycocladus) in the intensive care and orthopaedic units. Environmental and epidemiological investigations suggested a possible cross-transmission of L. ramosa between two patients in intensive care. This is the first report of possible person-to-person transmission of mucormycosis species. These cases show the ineffectiveness of hydro-alcoholic solutions against spores and underline the need to respect standard precautions to prevent fungi dissemination.
Asunto(s)
Infección Hospitalaria/microbiología , Dermatomicosis/microbiología , Unidades de Cuidados Intensivos , Mucorales/aislamiento & purificación , Mucormicosis/microbiología , Anciano , Microbiología del Aire , Amputación Quirúrgica , Coinfección , Infecciones Comunitarias Adquiridas/microbiología , Infección Hospitalaria/transmisión , Dermatomicosis/epidemiología , Dermatomicosis/transmisión , Traumatismos de los Pies/microbiología , Traumatismos de los Pies/cirugía , Fracturas Abiertas/microbiología , Francia/epidemiología , Hospitales de Enseñanza , Humanos , Isquemia/complicaciones , Isquemia/cirugía , Pierna/irrigación sanguínea , Traumatismos de la Pierna/microbiología , Traumatismos de la Pierna/cirugía , Masculino , Persona de Mediana Edad , Mucormicosis/epidemiología , Mucormicosis/transmisión , Técnicas de Tipificación Micológica , Quirófanos , Personal de Hospital , Complicaciones Posoperatorias/microbiología , Infección de Heridas/microbiología , Adulto JovenRESUMEN
BACKGROUND: The development of devices with surfaces that have an effect against microbial adhesion or viability is a promising approach to the prevention of device-related infections. AIM: To review the strategies used to design devices with surfaces able to limit microbial adhesion and/or growth. METHODS: A PubMed search of the published literature. FINDINGS: One strategy is to design medical devices with a biocidal agent. Biocides can be incorporated into the materials or coated or covalently bonded, resulting either in release of the biocide or in contact killing without release of the biocide. The use of biocides in medical devices is debated because of the risk of bacterial resistance and potential toxicity. Another strategy is to modify the chemical or physical surface properties of the materials to prevent microbial adhesion, a complex phenomenon that also depends directly on microbial biological structure and the environment. Anti-adhesive chemical surface modifications mostly target the hydrophobicity features of the materials. Topographical modifications are focused on roughness and nanostructures, whose size and spatial organization are controlled. The most effective physical parameters to reduce bacterial adhesion remain to be determined and could depend on shape and other bacterial characteristics. CONCLUSIONS: A prevention strategy based on reducing microbial attachment rather than on releasing a biocide is promising. Evidence of the clinical efficacy of these surface-modified devices is lacking. Additional studies are needed to determine which physical features have the greatest potential for reducing adhesion and to assess the usefulness of antimicrobial coatings other than antibiotics.
Asunto(s)
Biopelículas/crecimiento & desarrollo , Adhesión Celular , Equipos y Suministros/microbiología , Propiedades de Superficie , Biopelículas/efectos de los fármacos , Infección Hospitalaria/prevención & control , Desinfectantes/farmacología , Humanos , Control de Infecciones/métodos , Viabilidad Microbiana/efectos de los fármacosRESUMEN
Vancomycin lock solution (LS) is recommended for the conservative treatment of subcutaneous injection port (SIP)-related infections, but may be associated with failure. We used an in vitro dynamic model of biofilm formation in an SIP, based on a continuous flow circulating via a real SIP, to assess the effectiveness of vancomycin (5 mg/ml), daptomycin (5 mg/ml) and ethanol 40 % LS in eradicating a pre-established Staphylococcus epidermidis biofilm. Heparin, Ringer's lactate and enoxaparin sodium LS were used as controls. The logarithmic reductions of colony-forming units (CFU) were compared by Student's t-test. After 24 h of exposure, the vancomycin LS did not exert a greater bactericidal effect than the heparin LS control (mean logarithmic reduction: 2.27 ± 0.58 vs. 1.34 ± 0.22, respectively, p = 0.3). The mean logarithmic reduction was greater with daptomycin LS (5.45 ± 0.14 vs. 0.39 ± 0.12, p < 0.01) and ethanol LS (6.79 ± 1.03 vs. 1.43 ± 0.54, p = 0.02). Bacterial revival after exposure to 24 h of LS was assessed. The mean viable bacteria count was significantly higher for vancomycin LS (9.36 ± 0.10 log(10)CFU) and daptomycin LS (9.16 ± 0.02 log(10)CFU) than for ethanol LS (2.95 ± 1.65 log(10)CFU). Ethanol appeared to be the most attractive option to treat SIP-related infection, but its poor ability to entirely disrupt the biofilm structure may require its use in association with a dispersal agent to avoid renewal of the biofilm.
Asunto(s)
Biopelículas/efectos de los fármacos , Daptomicina/farmacología , Desinfectantes/farmacología , Desinfección/métodos , Equipos y Suministros/microbiología , Etanol/farmacología , Staphylococcus epidermidis/fisiología , Recuento de Colonia Microbiana , Humanos , Inyecciones Subcutáneas/métodos , Viabilidad Microbiana/efectos de los fármacos , Staphylococcus epidermidis/efectos de los fármacos , Vancomicina/farmacologíaRESUMEN
The CS child, aged 9, is evacuated from a health center located 200km away from Ouagadougou (capital of BF) for decompensated heart failure. Clinically we noted a syndrome of congestive heart failure. No obvious cause has been found outside of the advancing age of parents (50 years) and the potential risks of rubella infection. A Doppler echocardiography revealed a fistula aorto-pulmonary 17mm wide associated with a pericardial effusion of average circumferential abundance and a dilation of the left ventricular. Pulmonary radiography showed a large cardiomegaly and left pleurisy. The discovery of congenital heart disease between 2 and 4 years is very rare but the prognosis is good with surgical treatment.
L'enfant C.S âgée de 9 ans est évacuée d'une formation sanitaire située à 200km de Ouagadougou (capitale du BF) pour cardiopathie décompensée. Cliniquement est noté un syndrome d'insuffisance cardiaque globale. Aucune cause évidente n'est retrouvée en dehors de l'âge avancé des parents (50 ans environ) et des risques potentiels d'infection rubéolique. L'échocardiographie Doppler révèle une fistule aorto-pulmonaire large de 17mm associée à un épanchement péricardique de moyenne abondance circonférentielle et une dilatation du ventricule gauche. La radiographie pulmonaire a noté une volumineuse cardiomégalie et une pleurésie gauche. Cette cardiopathie congénitale de découverte habituelle entre 2 et 4 ans est très rare et de pronostic favorable avec le traitement chirurgical.
RESUMEN
CA, 14 old years, female, born last uterine siblings of 9 children, 4 died of various causes, was admitted in the pediatric service of CHU-YO for functional impairment of the lower limbs. Physical examination revealed swelling and deformation harsh, uneven surfaces, the circumferential upper and lower limbs and lumbar spine associated with spastic paraplegia. Sphincter disturbances accompany this clinical picture. The radiographic bone marrow hypertrophy individually with images of exostosis at the epiphyses. Multiple exostosis or BESSEF Hogen's disease is rare and has a reserve functional prognosis because of outcome of low spinal cord compression and vascular compression. We felt it appropriate to bring this case discovered during our clinical practice because of its rarity and the risk of malignant degeneration.
CA, âgée de 14 ans, de sexe féminin, dernière née d'une fratrie utérine de 9 enfants dont 4 sont décédés de causes diverses, est admise dans le service de pédiatrie du CHU-YO pour impotence fonctionnelle des membres inférieurs. L'examen physique révèle des déformations et des tuméfactions dures, à surfaces irrégulières, circonférentielles aux membres inférieurs et supérieurs et au rachis dorsolombaire associées à une paraplégie spasmodique. Des troubles sphinctériens accompagnent ce tableau clinique.La radiographie osseuse individualise une hypertrophie osseuse avec des images d'exostose au niveau des épiphyses.Affection rare, l'exostose ou maladie des exostoses multiples de BESSEF HOGEN a un pronostic fonctionnel réservé du fait des compressions médullaires basses et vasculaires. Nous avons jugé opportun de rapporter ce cas découvert lors de notre pratique clinique à cause de sa rareté et du risque de dégénérescence maligne.