Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 2 de 2
Filtrar
Más filtros











Base de datos
Intervalo de año de publicación
1.
Am J Med Genet A ; 188(2): 498-508, 2022 02.
Artículo en Inglés | MEDLINE | ID: mdl-34697879

RESUMEN

Autosomal recessive limb-girdle muscular dystrophy-1 (LGMDR1) is an autosomal recessive disorder characterized by progressive weakness of the proximal limb and girdle muscles. Biallelic mutations in CAPN3 are reported frequently to cause LGMDR1. Here, we describe 11 individuals from three unrelated consanguineous families that present with typical features of LGMDR1 that include proximal muscle wasting, weakness of the upper and lower limbs, and elevated serum creatine kinase. Whole-exome sequencing identified a rare homozygous CAPN3 variant near the exon 2 splice donor site that segregates with disease in all three families. mRNA splicing studies showed partial retention of intronic sequence and subsequent introduction of a premature stop codon (NM_000070.3: c.379 + 3A>G; p.Asp128Glyfs*15). Furthermore, we observe reduced CAPN3 expression in primary dermal fibroblasts derived from an affected individual, suggesting instability and/or nonsense-mediated decay of mutation-bearing mRNA. Genome-wide homozygosity mapping and single-nucleotide polymorphism analysis identified a shared haplotype and supports a possible founder effect for the CAPN3 variant. Together, our data extend the mutational spectrum of LGMDR1 and have implications for improved diagnostics for individuals of Pakistani origin.


Asunto(s)
Calpaína , Distrofia Muscular de Cinturas , Calpaína/genética , Humanos , Proteínas Musculares/genética , Distrofia Muscular de Cinturas/diagnóstico , Distrofia Muscular de Cinturas/genética , Mutación , Pakistán , ARN Mensajero/genética
2.
Saudi Med J ; 38(12): 1190-1195, 2017 12.
Artículo en Inglés | MEDLINE | ID: mdl-29209666

RESUMEN

OBJECTIVES: To identify the underlying gene mutation in a large consanguineous Pakistani family.  Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool.  Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein.  Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.


Asunto(s)
Miopatías Distales/genética , Disferlina/genética , Duplicación de Gen , Atrofia Muscular/genética , Mutación , Adulto , Femenino , Humanos , Masculino , Pakistán , Linaje , Adulto Joven
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA