Combinatorial approach of in silico and in vitro evaluation of MLH1 variant associated with Lynch syndrome like metastatic colorectal cancer.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3-4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

Functional Characterization of a Missense Variant of MLH1 Identified in Lynch Syndrome Pedigree.

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a "pathogenic" variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.